18 of 22 hit on Influenza A with c19 ATATTGCAGCAGTACGCACACA primer.

Thinking about if not optimal PCR conditions, how much this nonspecificty would contribute to PCR+ c19 in the face of Influenza A infection?

trying to nucleotide and protein blast

confusing at first

still is

but this shit is interesting