""PCR is completely incapable of diagnosing ANY infection.""

It only takes DNA /RNA from a sample and replicates it synthetically into a larger sample so that it can be analysed.

99.9% of people -including Drs and Scientists- touting PCR this or that even so called scientists using it fraudulently as a "test" apparently have zero comprehension of what PCR may even technically really be used for.

WHY IS THAT??

Because the first abuses of PCR started almost 30 years ago and now infectious disease "experts" have 30 years of utterly complete brainwashing behind them and now its even taught in medical schools.

USING PCR THE WAY THEY ARE… IS COMPLETE NONSENSE.

Look closely. This is a DISCLAIMER on a so called PCR HIV test.

This mirrors the disclaimers for ALL PCR so called "tests"

Note that it says not for DIAGNOSIS

There is a very good reason for such a disclaimer:

IT CANNOT DIAGNOSE INFECTION.

>>13933356

It's very easy to get those Fragments.

It's sequence of Human Chromosome 8.

simple.

>>13933356

Not only that.

Sequences of ANYTHING does NOT equal the STATE of "BEING INFECTED".

"a FINDING" of a small segment very short actually of RNA is just that.

You amplified that finding.

It tells you absolutely NOTHING about "Infection".

Bacteria for example may be present (and are present) at all times in Humans that are SOMETIMES pathogenic.

(They are POTENTIALLY Pathogenic)

Just because you find them there does NOT indicate infection BY them.

That's simply ridiculous.

I Found Flies in my garbage.

Every single Trash can has garbage and all of them contain Flies.

Conclusion: Flies CAUSE Garbage.

>>13933349

aha! Illuminati matrix guy.!!

Haven't seen that in awhile.

>>13933411

The way it is being used?

It absolutely IS being used to say INFECTION is diagnosed.

They are calling it asymptomatic infection.

What did I say?

It cannot be used to diagnose INFECTION.

and that is exactly how they are TOUTING it as being used.

And WHO decided how many cycles?

(Because depending on the cycles you can create the illusion of finding it anywhere you wish… in all humans.)

SO it has nothing to do with exposure.

ALL the PCR standard for current use in USA

is based on the in vitro shit science pulled from a SINGLE patient in Washington.

This is not viremia.

They have tied it to nothing.

Not only that modern virologists following Robert Gallo style of virology

have yet to prove what they are looking for causes anything.

>>13933381

The WHO’s forward, reverse primers and probe protocols, for the alleged SARS-CoV-2 viral genome,

are based upon RdRp, Orf1, N and E gene profiles. Anyone can run them through BLAST to see what

we find.

The vital RdRP nucleotide sequence, used as a forward primer is – ATGAGCTTAGTCCTGTTG. If we

run a nucleotide BLAST this is recorded as a complete SARS-CoV-2 isolate with a 100% matched

sequence identity. Similarly the reverse E gene primer sequence – ATATTGCAGCAGTACGCACACA

– reveals the presence of the Orf1ab sequence which also identifies SARS-CoV-2.

However, BLAST also enables us to search the nucleotide sequences of the microbial and human

genomes. If we search for the RdRp SARS-CoV-2 sequence it reveals 99 human chromosome with a

100% sequence identity match. The Orf1ab (E gene) returns 90 with a 100% sequence identity match

to human chromosomes.

Doing the same for these sequences with a microbial search finds 92 microbes with a 100% match to

the SARS-CoV-2 E gene and 100 matched microbes, with a 100% sequence identity, to the vital SARS-

CoV-2 RdRp gene.

Whenever we check the so-called unique genetic markers for SARS-CoV-2, recorded in the WHO

protocols, we find complete or high percentage matches with various fragments of the human genome.

This suggests that the genetic sequences, which are supposed to identify SARS-CoV-2, are not unique.

They could be anything from microbial sequences to fragments of human chromosomes.

>>13933381

No

YOU'RE a sounding brass fren.

Let's call each other names!

YAY!!!