Welcome To Q Research General

We are researchers who deal in open-source information, reasoned argument, and dank memes. We do battle in the sphere of ideas and ideas only. We neither need nor condone the use of force in our work here.

"We hold these truths to be self-evident: that all men are created equal; that they are endowed by their Creator with certain unalienable rights; that among these are life, liberty, and the pursuit of happiness."

VINCIT OMNIA VERITAS | SEMPER FIDELIS | WWG1WGA | QRESEARCH

Q's Private Board

>>>/projectdcomms/ & Q's Trip-code: Q !!Hs1Jq13jV6

Q's Latest Posts

Tuesday 12.08.2020

>>11953143 ————————————–——– We're Not Gonna Take It (CAP: >>11953295)

Onion Link

Access through Tor http://jthnx5wyvjvzsxtu.onion/qresearch/catalog.html

New here? Q Proofs & Welcome

Welcome to Q Research (README FIRST, THEN PROCEED TO LURK) https://8kun.top/qresearch/welcome.html

100+ Q Proof Graphics qproofs.com

8kun FAQs https://8kun.top/faq.html

Find Q drops here

Main QAnon.pub - qresear.ch/q-posts - QAlerts.pub - operationQ.pub - QPosts.online - qanon.news/Q - 8kun.top/qresearch/qposts.html

Backups QAlerts.app - QAlerts.net - douknowq.com/134295/Q-Anon-Pub.htm -

Dealing with Clowns & Shills

New? Use logic and reason when evaluating posts, look beyond the content of the post(s) and evaluate intent.

>>2322789 How To Quickly Spot A Clown

QResearch Search Engine

* Search all posts from QResearch: https://qresear.ch/

Globals

Donald J Trump https://www.donaldjtrump.com/news | https://www.45office.com | https://www.donaldjtrump.com

Owner: https://gab.com/JimWatkins

BO: FastJack#1006 https://discord.gg/DG8XB4YMvz

Mike Lindell - https://LindellTV.com | https://frankspeech.com/

Mike Lindell Voter Fraud https://www.bitchute.com/video/FtRYtna3YYe9/ | https://zb10-7gsop1v78.bitchute.com/IIC6VbV69ioF/WNP5InC3q6Q0.mp4

Sidney Powell - https://defendingtherepublic.org/

Lin Wood - http://www.fightback.law/

All the cases that the Trump campaign filed for the election fraud http://wiseenergy.org/Energy/Election/2020_Election_Cases.htm

Everything Wrong With the Capitol Shooting https://www.youtube.com/watch?v=9z7VTvyyqMw | https://www.bitchute.com/video/DYlb92zMkj41/

The Secret History of the Shadow Campaign That Saved the 2020 Election. https://8kun.top/qresearch/res/13073507.html#13074178

Lists: CEOs/BlueAnon: https://controlc.com/84d9a3f3 | Civic Alliance https://archive.ph/6AOmQ

Arizona Audit - Volunteers Needed to Watch Arizona Audit Live Feeds https://t.me/ArizonaAuditLiveFeeds | https://azaudit.org/

Arizona Rangers need donations to help secure AZ Election Audit for next several weeks. Please help if you can https://azrangers.gov/donate/

>>13811371, >>13811431, >>13811669 GIGA DROP HAPPENING GET IN HERE - 3,200 pages of Fauci emails. Start digging anons / EYES ON PATRIOTS - FAUCI DOCUMENT RELEASE >>13812647 ARCHIVED.

>>13802689, >>13802749, >>13802702 Games operators play.. More fallout from the B bullshit

>>13792537, >>13792570, >>13792882, >>13792587, >>13792591, >>13792638, >>13792653, >>13793136, >>13793154, >>13793208 Jim confirms it was 'global volunteer' that made the 'B' post on /projectdcomms/ and not Q.

-TOR posting is disabled BO explains why- >>13793136

Notables Are Not Endorsements

#17634

>>13930931 Oped: ‘Exodus of the rich’ to Florida threatens disaster for NYC

>>13930933 Colorado Secretary of State will have no 'fraudits' in her State

>>13930941 Earthquake in Indiana yesterday (West of Bloomingdale)

>>13931009 Planefag reports

>>13931035 Joe Rogan slams CNN's Stelter: 'Your show is f—ing terrible'

>>13931044 USSOCOM: Didn't a Q drop have a picture of an old guy wearing the 5 diamond patch?

>>13931086 "Where the pedovores roam"

>>13931094 EXPLOSIVE DEVELOPMENT: Election Worker Ralph Jones Is Now Second Worker Caught Double-Counting Ballots at the State Farm Center on Election Night!

>>13931098 "Giant Mistake" - CDC Delays Emergency Meeting On Post-Vax Heart Inflammation Due To Juneteenth

>>13931109 Soros Spending in Colorado Elections

>>13931113 Human body activity associated with a task provided to a user may be used in a mining process of a cryptocurrency system.

>>13931189 Illinois governor signs law expanding curbside voting, permanent vote by mail

>>13931197 BREAKING: Congressman Gaetz Issues Letter to FBI Requesting Briefing on Wuhan Lab Whistleblower Investigation

>>13931250, >>13931293 HOT auditing review in August?

>>13931312 Four Young Pilots have Mysteriously Died, but NOT from the Vaccine

>>13931336, >>13931357 Col. Dr. Lawrence Sellin: we need to transition from COVID-19 detectives to CCP-Hunters

>>13931397 Osama Bin Laden’s Niece Trolls Biden With ‘Trump Won’ Sign At Geneva Summit

>>13931559 Liz Cheney Puts The ‘Forever’ In ‘Forever War’

>>13931567 #17634

#17633

>>13930177 @Cernovich finds out California Democrats have a hotline to Twitter Thought Police?

>>13930201 Reminder that while Newsbot self-doxxed, this doesn't mean BakerTools is comped.

>>13930215 2.54 Billion Vaccine Shots administered around the world

>>13930258 Two More Months: Maricopa County Audit Report 'expected in August'

>>13930262 Former WH Physician called on President Biden to immediately undergo a cognitive test to prove he has 'sound mental capabilities'

>>13930274 Michigan Senate Passes Legislation to Add Voter ID Requirements: ‘Overwhelmingly Popular’

>>13930290 Based Black Clinician gives strong rebuke of critical race theory at school meeting

>>13930293 New Congress Bills, >>13930297, >>13930311

>>13930312 Why hasn't Federal Agent Ray Epps (Capitol Hill Riot instigator) been indicted?, >>13930393 Is it because of this?

>>13930377 Chucky 'Cheese Pizza' Schumer warns of Threat of 'Qanon' to 'Peace' in United States

>>13930425 Child Modelling Agencies: a deep swamp of systematic and horrific phsyical, mental and sexual abuse

>>13930489 North Carolina Senate just passed a bill banning private money from being used to administration elections

>>13930481 Israel says it's willing to transfer 1 million vaccines to Palestine, if Palestine is willing to return 1 million vaccines later

>>13930509 House Republicans Demand Answers After Biden Admin Lifts Iran Sanctions Without Consulting Congress

>>13930544 Positive PCR test result do not provide sufficient proof that people infected with COVID, can infect others, >>13930553, >>13930555, >>13930597, >>13930618, >>13930608, >>13930637

>>13930560 CNN's Chris Cuomo dares 'the Internet' to call him a fact-denier.

>>13930598 Election Fraud: 2nd Atlanta official caught double scanning ballots

>>13930599 Reminder why PCR tests are untrustworthy to begin with

>>13930643 On the Geostate: Jeffrey Prather interview: Deep dive into USA, China and Russia military capabilities and vulnerabilities.

>>13930652 PF Update: AF2 on the move

>>13930655 (Source needed) Colorado Secretary of State has just moved to ban any election audit in the state of Colorado

>>13930705 Meet California's Board of Behavioral Sciences, >>13930717, >>13930722

>>13930737 Kind reminder for newfrens.

>>13930848 #17633

#17632

>>13929325 HUUUUGE. Chinese defector held at DIA is fount of intel

>>13929332 DIG INTO MUSIC AND THE CONNECTIONS TO THE CULT - POSTED OR ARCHIVE

>>13929361 Something is in the food, water and air that's holding everyone in a trance

>>13929411, >>13929433, >>13929455 Witnessed

>>13929525, >>13929546 Qclockwork?

>>13929535 Biden gave Vladimir Putin A pair of Randolph Aviator Sunglasses, in the Concord style

>>13929556 Live Bats in Wuhan Lab & “Intense Clashes” Between China & France

Baker change

>>13929628 Recap of last weeks covert wins

>>13929658 (?) Newsbot self-doxxes + an explanation why this is of importance, >>13929964

>>13929690 More about Richard BEEBO Russell

>>13929726 Predictive programming? Large swarts of the American Watersupply is a security disaster waiting to happen.

>>13929807 Voice of Reason: Greenwich parents protest child-masking, 'critical race theory' & the school curriculum.

>>13929848 The 'maybe' line: US-produced make-up sold in Canada, found high level of a marker for toxic PFAS substances.

>>13929857 Gen. Flynn calls Georgian citizens to demand a resignation of their Senator

>>13929861 CDC wiping Vaccine Deaths from their databases?

>>13929940 'fact-checkrs' got their facts wrong again: it's legal to name an unindicted co-conspirator.

>>13929970 NSA Reveals in FOIA Response that the FBI Involved in “Improper Surveillance” of 16,000 Americans

>>13930009 Corona insurance fraud? Judge orders insures to pay New Hampshire based hotel 100 million dollars in Corona damages.

>>13930028 US Senate: ‘Establishment Covid-19 narrative is a lie’

>>13930062 #17632

#17631

>>13928804, >>13929008 SKY KING ACTIVE

>>13929026, >>13929042 Day of the slave 1776 [Learn].

>>13928542, >>13928661, >>13928701 Literally shaking

>>13928546 RE: MAGNETIZING THE MASSES

>>13928553 Chinese government now admits damage to fuel rods at the Taishan nuclear plant but said the problem is “common”

>>13928557 Joe Biden’s Brother Frank Caught Violating Florida Traffic Law, Case Dismissed Due to Police Officer Out for ‘Training’

>>13928582 “Silent Cry: The Darker Side of Trafficking” as we uncover the SATANIC RITUAL ABUSE happening not only under our very noses but in our OWN HOMES!

>>13928574 @Dan Scavino >>13928611 @Lin Wood >>13928626 @Russ_Warrior

>>13928639 "Buckle up, kids!" The NSA has agreed to produce records about the FBI’s illegal snooping on 16,000 Americans

>>13928676 Anti-Israel protests habbening

>>13928733 HRC Body Double Chronological Comparison Chart

>>13928746 Tucker takes aim at military's newest required reading

>>13928702, >>13928780, >>13928810 Do not try to shrink me, [Gyp]sy

>>13928867 New: An Army judge has been named the new chief of the Guantanamo war court judiciary!

>>13929086 Chinese head of Intelligence defects to US with Intel on covid

>>13929087 時間です, it is time

>>13929110, >>13929117, >>13929133 Noteworthy Images

>>13929182 IRS Denies Tax Exemption to Christian Group, Associates Bible With GOP

>>13929192 RE: The 246th anniversary of Bunker Hill

>>13928909, >>13928930, >>13928933, >>13929223 Tranime (Team) Tantrum Is About Doge Baker Taking Away Their Baking Privilage

>>13929232 #17631

>>13927671, >>13927730, >>13927757

#17630

>>13927717 We love you Dan @DanScavino

>>13927710, >>13927719, >>13927735, U.S. Attorney’s Office

>>13927741, >>13927777 Wannabe Vax Mandates RE: Pop Music

>>13927798 FBI Ignored Its Own Warrant And Search Policies To Seize Millions From People's Safety Deposit Boxes

>>13927820, >>13927871 NSA Reveals in FOIA Response that the FBI Involved in “Improper Surveillance” of 16,000 Americans

>>13927840 Former Army Major Apache Pilot Convicted for Murder

>>13927848 US Space Force operations chief: reveals DEWs to the public

>>13927861, >>13927864, >>13927895 Potential Q Proof Incoming

>>13927906 Top Doctor Issues Warning: COVID Vaccine ‘Spike Protein Shedding’ Damages Placenta, ‘We Are Being Experimented On’

>>13927918 PREPARATION FOR WAR GAMES (FT. GENERAL MICHAEL FLYNN & ADMIRAL ROGERS)

>>13928029 Vampires Exist

>>13928120, >>13928095 Cyber Polygon Exercise

>>13928145 FOUR BA Pilots Dead, Potentially From Vaxx Complications

>>13928158 Farmers vs Feds. The “Government Stole Our Water!”

>>13928299 @DARPA high-res multi-waveform implantable stimulator chip and multi-scale electrodes for providing high-res therapy

>>13928308, >>13928375 CDC is holding an(other?) “emergency meeting” RE: Bloodclots

>>13928319 Biden Attacks Voting Integrity Laws at Juneteenth Federal Holiday Signing Ceremony

>>13928366 Remember Anons, just filter, do not reply!!!

>>13928470 #17630

#17629

>>13926863,>>13927215 Heidi Ferrer, a writer for “Dawson’s Creek,” committed suicide in May after a 13 month battle with COVID-19

>>13926874 Boston terror suspects uncle was married to CIA officer's daughter and even shared a home with the agent

>>13926918, >>13926929 RSBN Dan The Man On!

>>13926945, >>13927162 "Fraudits no place colorado" democrat colorado secretary state issues emergency rules prohibiting election audits

>>13926969 PF

>>13927111 @JSolomonReports says: GA Sec. of State Raffensperger sent a contractor to Fulton County, who found "twenty-nine pages of errors, mismanagement, mistakes, grotesque running of an election…"

>>13927187 Fauci Denies Scientists 'Deliberately Suppressed' COVID Lab Theory

>>13927198, >>13927253, >>13927289 Crimes against children, Pedo Roundup News.

>>13927211 Crime boss Bilal Hamze shot dead in Sydney’s CBD

>>13927227 Army Battalion Commander Under Inquiry After Allegedly Telling Soldiers ‘White People Are the Problem’

>>13927240 Ted Cruz Slams the Democrat Election Takeover Bill: ‘Single Most Dangerous Piece of Legislation’ in Congress

>>13927256 Kushner snags book deal with Harper Collins; no deal yet for Trump

>>13927324 Portland's entire riot squad resigns in protest after a colleague is indicted for striking a rioter/activist/photographer.

>>13927379 M Pompeo: "Never give an inch. Period."

>>13927510 CM: Colorado Secretary of State just banned election audits.Why is she scared of an election audit? Surely unrelated: Dominion has (had?) offices in Colorado.

>>13927512 CM: Soros’ biggest mistake this last election was not buying a majority on all the state legislatures.He won’t make the same mistake twice.

>>13927526 CM: A “conspiracy theory” that is proven is called a fact.

>>13927538 Lin Wood: President Trump won re-election by a historic landslide. Just sayin.’

>>13927600 @RealGenFlynn: Fernando Mateo Receives Matching Funds For His Campaign Creating An Even Clearer Path To Victory in November

>>13927622 #17629

#17628 (Anon Bun)

>>13925947 CLIMATE LOCKDOWN?: Globalist Elite Call For Extreme Measures To Tackle ‘Climate Change’

>>13925970 Rep Jackson: When I was Physician to President Trump, the media relentlessly pushed a narrative that he needed a cognitive test.

>>13925975 USPacificFleet: #USNavy's Carrier Strike Group One arrives in Hawaiian Islands Operating Area: #CVN70 #US3rdFleet #NavyReadiness

>>13926003 What If the Media Had Told the Truth? Five MSM Lies for Which Trump Has Been Vindicated, and the Damage They Caused

>>13926016 Watch this parent absolutely obliterate Critical Race Theory at an Illinois school board meeting:

>>13926019 Massive 700-pound George Floyd statue erected at Newark City Hall

>>13926039 Ghislaine Maxwell is awarded just $13.70 compensation after pursuing 'child sex abuse victim' who sued her then dropped case to join Jeffrey Epstein compensation fund instead

>>13926041 JUST IN - Mayor Lori Lightfoot officially declared racism a "public health emergency" today. Chicago to divert nearly $10 million in COVID funds to address the issue.

>>13926095 Louisiana to offer cash prizes, scholarships for vaccinations

>>13926100 Entire Portland Police Riot Squad Quits En Masse, As DA Begins Criminal Investigations Into Officers’ Conduct

>>13926109 Dr. Kelli Ward: Arizona Case on Democrat Ballot Harvesting Will Be Decided by Supreme Court this Month – “We Are Hoping for a Victory”

>>13926132 PEDO BUN 17June 21

>>13926138 IDF Chief of Staff Lt.-Gen. Aviv Kohavi will fly to #Washington on Sunday to discuss a range of regional challenges with his #US counterparts, more than a month after he was set to go to discuss #Iran and other challenges.

>>13926212 Hunter Biden was "BLACKLISTED" from Chateau Marmont, a swanky hotel and celebrity hangout in Los Angeles.

>>13926337 HSBC to announce sale of French retail banking operations on Friday

>>13926352 Revolver's Darren Beattie called out Chris Cuomo for smearing him as a "dirtbag" in relation to Revolver News's groundbreaking story about the FBI's involvement in January 6.

>>13926365 NKorea's Kim says must prepare for 'dialogue and confrontation' with US: KCNA

>>13926400 Swiss police reportedly evacuate train in Daeniken city due to 'situation that could pose threat'

>>13926408 'Dawson's Creek' writer Heidi Ferrer dies by suicide after contracting COVID

>>13926423 Temp Firm Financed By Stacey Abrams Infiltrated All Levels Of GA Government, Including Governor’s Office

>>13926536 Michigan SOS Candidate Kristina Karamo Delivers +7,500 Affidavits Demanding Forensic Audit to Dishonest Jocelyn Benson – BUT HER OFFICE WON’T ACCEPT THEM!

>>13926591 Criminal Charges Filed Against US Marshals For Refusing To Disclose Vaccination Status In Court.

>>13926592 USNG: "I don't think we can do this enough," Lt. Col. Roger Brooks said. "#Patriot21 prepares service members and civilian partners to respond to situations as in the case of a pandemic, earthquake, or overseas in a warfight.

>>13926598 GOP lawmakers, led by ex-White House doc, ask Biden to take cognitive test

>>13926656 Child-care employee at Stepping Stones Daycare arrested on multiple charges of sex abuse

>>13928620 #17628 (anon bun)

#17627

>>13925196 Ex-Trump doctor turned GOP lawmaker wants Biden to take cognitive test

>>13925224 Netanyahu reportedly shredded docs before handing office over to Bennett

>>13925253 IDF Chief of Staff Kohavi to fly to Washington to discuss Iran, Gaza

>>13925259 PF Reports

>>13925277, >>13925773 This texting is between Hunter and his cousin who is really not a high dollar “Madame”.

>>13925294 Rep. Devin Nunes: Republicans Must Stop Talking to Establishment Media

>>13925323 A red shoe a mile from Camp David.

>>13925339 New Report Shows How Lockdowns Destroyed The Middle Class

>>13925283, >>13925287, >>13925295, >>13925306, >>13925326 November 2019, the little fauci piece

>>13925467 MSNBC’s Nicolle Wallace Lost 80% of Her Audience Since Trump Left Office

>>13925458 (FROM JUNE 11th) FCC Announces Nationwide Emergency Alerting Test on August 11, 2021

>>13925516 Need eyes on, please

>>13925188 St. Louis couple who pointed guns at protesters last summer plead guilty to misdemeanor charges, agree to forfeit their weapons

>>13925189 Fauci-Funded Researchers Including Ralph Baric Attended Chinese Government ‘Gain-Of-Function’ Conference With Military Scientists.

>>13925633, >>13925846 Reports coming in of British Airways pilots dying after being vaccinated+flying. Seeking confirmation.

>>13925637, >>13925771 Could it be 11. 3 ? I LIE coding in the books behind biden in Geneva

>>13925677 Herschel Fink, the director of the AZ Democrat Party, says Stacey Abrams helped the Dems “win” in Arizona.

>>13925682 Rep. Marjorie Taylor Greene, R-Ga., planned to introduce a bill Thursday morning that would abolish the Bureau of Alcohol, Tobacco, Firearms and Explosives

>>13925760 President Trump to join Bo Snerdley on his hot new NYC radio show

>>13925777 Former Pfizer VP: “The thing to be terrified of is your government’

>>13925812 RSBN will also be airing Dan Scavino’s interview with Lara Lea Trump, tonight at 8PM EST

>>13925839 Thomas Massie responds to reporter who wants to know his vaccination status…

>>13925862 #17627

Previously Collected Notables

>>13923436 #17624, >>13924225 #17625, >>13925646 #17626

>>13922541 1/2 #17623, >>13922642 2/2 #17623

>>13919982 #17620, >>13920843 #17621, >>13921632 #17622

>>13919944 #17617, >>13917631 #17618, >>13919244 #17619

>>13915050 #17614, >>13915768 #17615, >>13916593 #17616

>>13912647 #17611, >>13913399 #17612, >>13914259 #17613

>>13910339 #17608, >>13911116 #17609, >>13915693 #17610

>>13907915 #17605, >>13910073 #17606, >>13909889 #17607

>>13905687 #17602, >>13906444 #17603, >>13907185 #17604

>>13909584 #17599, >>13904070 #17600, >>13904886 #17601

>>13900938 #17596, >>13901595 #17597, >>13902374 #17598

>>13901708 #17593, >>13901710 #17594, >>13901711 #17595

>>13901705 #17590, >>13901706 #17591, >>13901707 #17592

>>13893785 #17587, >>13894590 #17588, ##13894594 #17589

>>13893395 #17584, >>13892202 #17585, >>13892990 #17586

>>13893273 #17581, >>13889915 #17582, >>13890514 #17583

>>13888344 #17578, >>13887460 #17579, >>13888246 #17580

>>13893318 #17576, >>13888160 #17577, >>13887347 #17577

>>13882213 #17573, >>13893283 #17574, >>13893303 #17575

>>13879842 #17570, >>13880597 #17571, >>13882183 #17572

>>13877397 #17567, >>13878241 #17568, >>13879177 #17569

>>13875058 #17564, >>13875783 #17565, >>13877307 #17566

Notables Aggregators: https://wearethene.ws & https://qnotables.com

>>13685931 Q Research Notables #7

Other Dedicated Research Threads

>>13167502 ————————————–——– Clockwork Qrange #12

International Q Research Threads

>>13741316 ————————————–——– Australia #16

>>13323637 ————————————–——– Balkan #8

>>13167439 ————————————–——– Brazil #2

>>13824934 ————————————–——– Canada #20

>>13269960 ————————————–——– France #4

>>13855387 ————————————–——– Germany #81

>>13187313 ————————————–——– Italia #2

>>13226402 ————————————–——– Japan #2

>>13410974 ————————————–——– Mexico #3

>>13105482 ————————————–——– Nederland #6

>>13163282 ————————————–——– New Zealand #8

>>13163911 ————————————–——– Nordic #3

>>13163805 ————————————–——– Russia #2

>>13163650 ————————————–——– Scotland #4

>>13340853 ————————————–——– South Africa #5

>>13828562 ————————————–——– UK #39

>>13741855 ————————————–——– Vatican #5

Q Proofs

>>6156082 ————————————–——– Q Proofs Threads, Proofs of Q's Validity

QProofs.com ————————————–——– Website dedicated to Q Proofs

Book of Q Proofs ————————————–——– https://mega.nz/#F!afISyCoY!6N1lY_fcYFOz4OQpT82p2w

Q Happenings Calendar

Submit an Event ————————————–——– https://teamup.com/ks8x4ixptej432xt2a

Resignations

Website ————————————–——– https://www.resignation.info

Sealed Indictments

Sealed Indictment Master: https://docs.google.com/spreadsheets/d/1kVQwX9l9HJ5F76x05ic_YnU_Z5yiVS96LbzAOP66EzA/edit#gid=1525422677

Sealed Indictment Master Files Backup: https://drive.google.com/open?id=1iBS4WgngH8u8-wAqhehRIWCVBQKD8-5Y

Searchable Indictment Map w/Dockets, Links & More: https://bad-boys.us/

Board Admin & Discussion Threads

>>13699736 ————————————–——– META (for board admin queries)

>>13699763 ————————————–——– Q Research General Dough/Kitchen Meta #3

Letters of Gratitude

>>13699687 ————————————–——– Letters of Gratitude (Q posted in #1025)

Q Graphics / The MAP - All In GMT

>>13700133 ————————————–——– #001 and scroll down for all continuing in numerical order

QPosts Archives

* QMap & Mirrors PDF:

MEGA: https://mega.nz/#!pjpS1aBI!LwepOu-CyC4UlLj2dXqkxiH49D813WetrOF0OCuIg1Y

MEDIAFIRE: https://www.mediafire.com/file/xszgdtiow4hups0/Q_Anon_-The_Storm-_X.VII.pdf/file

SCRIBD: https://www.scribd.com/document/419874308/Q-Anon-The-Storm-X-VII?secret_password=55SQ1tCYhuNR8ESzm50u

* QPosts Archive, Players in the Game/ Analytics on Q posts & More: qmap.pub

* QPosts Archive, Searchable, interactive with user-explanations: qanon.pub qanon.app (Backup: qntmpkts.keybase.pub)

* QPosts Archive + RSS, Searchable, Analytics, Offsite Bread Archive: qanon.news

* Spreadsheet QPosts Q&A and all images backup: https://docs.google.com/spreadsheets/d/1Efm2AcuMJ7whuuB6T7ouOIwrE_9S-1vDJLAXIVPZU2g

QPosts Archives in Other Formats

* Q Raw Text Dumps: q-clock.com/q_raw.txt

* Expanded Q Text Drops: pastebin.com/dfWVpBbY

* Spreadsheet Timestamps/Deltas: docs.google.com/spreadsheets/d/1OqTR0hPipmL9NE4u_JAzBiWXov3YYOIZIw6nPe3t4wo/

* Memo & OIG Report Links: 8kun.top/qresearch/res/426641.html#427188

* Original, full-size images Q has posted: https://postimg.cc/gallery/29wdmgyze/

Tweet Tools

* Deleted Trump Tweets: https://factba.se/topic/deleted-tweets

* POTUS' Tweet Archive: trumptwitterarchive.com / thetrumparchive.com

* Twitter Video Downloader: http://twittervideodownloader.com/

* Twitter Video Downloader: https://www.savetweetvid.com/

* Whats Tweeting https://onemilliontweetmap.com

* Check Hash Trends https://www.hashtags.org/

* Download Any Videos https://distillvideo.com/

Other Tools

* Complete Listing Tools and Services: https://ghostbin.com/paste/I0F9k

* Searchable Commercial Aviation Incident List: http://avherald.com

* Searchable Hussein WH visitor list: https://archive.org/details/WHvisitorlogs_2010-16_date

* Qcode Guide to Abbreviations: pastebin.com/UhK5tkgb

* Q Happenings Calendar 2018: https://mega.nz/#F!KPQiBJiY!dK3XRe4RYoXgWq_85u4-yg

* Legal News: www.justice.gov/usao/pressreleases

* Digital Infomation Chart: https://pastebin.com/LXhicJNg

* Updated All Google Search Operators: https://ahrefs.com/blog/google-advanced-search-operators/

* Module Retired - Federal Procurement Data System: https://www.fpds.gov/fpdsng_cms/index.php/en/

* Federal Judicial Court dataset from 93 Federal Districts - Searchable db: https://bad-boys.us/

* Catalog of US Government Publications: https://catalog.gpo.gov/F?RN=306384688

* Webpage Archiver: http://archive.md/

* Baker Tools v0.7.5: https://controlc.com/a0409084

* Check Criminal Cases: https://www.justice.gov/usao/find-your-united-states-attorney

* Get your Q clocks anytime (0 - 59 min past posts): https://q-clock.com

* Compress Video https://video.online-convert.com/convert-to-mp4

* Remove Image Background https://www.remove.bg/

* Download Bitchute Video https://pastedownload.com/bitchute-video-downloader/

* Download Rumble Video https://pastedownload.com/rumble-video-downloader/

* Download Webpage as PDF https://webtopdf.com/

* Military Ship Tracker https://www.shiplocation.com/military/tracker

Bread Archives (sites)

Board Archive - The main /research/ board archive: https://8kun.top/qresearch/archive/index.html

Offsite Archive - qanon.news/archives

Bread Archives (downloads)

MasterArchivist qarchives.gq | masterarchivist.github.io/qarchives/

Supplement to MA main spreadsheet, 2nd tab (labeled)

Germanarchiveanon https://mega.nz/folder/LPZxEIYJ#N5JwCNoxOxOtAoErKdUgvw

Missing Catalog Bredz 10964-11007 https://pastebin.com/xT0PWKMf

https://docs.google.com/spreadsheets/d/1M2AzhZKh2PjL7L7GVPN42Em0hZXKWMdhGnj59ZQ3YcQ/edit#gid=0

Learn To Bake!

Simple instructions: https://pastebin.com/aY5LyDPY

Baker templates for formatting crumbs plus links: https://pastebin.com/36a1EXpR

Iwo Jima videos: https://youtu.be/5zezIBBxjEs, https://www.youtube.com/watch?v=MLCupx1UExg

STALE DOUGH

GHOST STILL IN EFFECT

https://controlc.com/e2b5aea6

Guys, I have a huge problem. I was playing with Q's time machine and I went back in time. But then I saw my mom and I got her pregnant and now she's going to give birth to me. Wtf do I do?

13933308 lb

I notice she has the chest of a twelve year old…

>>13933312

Dumb.

>>13933312

Sharpie in pooper

>>13933300

TYB AND TRIPS AND DUBS CHEK'ED

>>13933312

Stop the madness!

You have no choice but to off her… but at that point you should simultaneously not exist! You got yourself into this mess, do the right thing anon!

>>13933312

you smoking the wrong pot, kek!!

>>13933339

Your copy/paste is a vomitous as always. Good news is swordy continuing to bless us all.

""PCR is completely incapable of diagnosing ANY infection.""

It only takes DNA /RNA from a sample and replicates it synthetically into a larger sample so that it can be analysed.

99.9% of people -including Drs and Scientists- touting PCR this or that even so called scientists using it fraudulently as a "test" apparently have zero comprehension of what PCR may even technically really be used for.

WHY IS THAT??

Because the first abuses of PCR started almost 30 years ago and now infectious disease "experts" have 30 years of utterly complete brainwashing behind them and now its even taught in medical schools.

USING PCR THE WAY THEY ARE… IS COMPLETE NONSENSE.

Look closely. This is a DISCLAIMER on a so called PCR HIV test.

This mirrors the disclaimers for ALL PCR so called "tests"

Note that it says not for DIAGNOSIS

There is a very good reason for such a disclaimer:

IT CANNOT DIAGNOSE INFECTION.

>>13933295 LB

>>13933295 LB

It is actually a Holistic Massage class with 120 hours of Polarity Therapy in which we discuss the Chakra system and Aura. Connecting to your Higher self. It is awesome because I see things like this on the board and through the Galactic Federation and Pleadians and such. It is all the same and ties in. I do have hope just my approach needs work. This is exactly it though our Aura extends out like that Torus shape and we work to clean that on people using clear quartz crystals. Human Trafficking comes up because we are learning to be Massage Therapists and that is the scourge of the industry. A 36 year old student mentioned Jeffery Epstein and that's how he got his girls getting them to do massages so it is all related and I know I am on the right track.

You Must Not ‘Do Your Own Research’ When It Comes To Science

By Ethan Siegel

https://www.forbes.com/sites/startswithabang/2020/07/30/you-must-not-do-your-own-research-when-it-comes-to-science/

>>13933300

Tanks B

>>13933333 lb

GBY FLOTUS

o7

>>13933312

Here's what habbened:

Trump's uncle built the time machine, went into the future, found Donnie in prison, went through the history, went back to now, gathered the evidence, gave it to Trump, returned to his own time, destroyed the machine…

You may know him as Q…

Now thats funny…

>>13933300

Any faggot who declares fealty to Mr Piglette is dead to me..

(pb) >>13932546 (pb)

All the digging is done. It's time for burials.

>>13933346

thats not entirely true

you wouldnt have fragments for the primers to replicate if you werent exposed to whatever they're testing for

7 heads & 10 horns

Biblical

Sybil downfall

Georgia Republican David Belle Isle Formally Files Wide Request for Election Records from Brad Raffensperger

Georgia Republican David Belle Isle, who is seeking to unseat Secretary of State Brad Raffensperger (R) in next year’s election, filed a far-reaching formal open records request Thursday for several documents related to Georgia’s 2020 election, Breitbart News has learned exclusively.

Belle Isle, a former mayor of Alpharetta, said in a phone interview with Breitbart News that he is taking the step, which he is entitled to do under Georgia’s Open Records Act, to bring more transparency to the election process.

“When [Raffensperger] came out of the 2020 election, the first thing he says is that it was the safest, most secure election in Georgia’s history,” Belle Isle explained. “Yet more and more things continue to unravel as we look and we see, and people are wanting to know and get to the bottom of it, and if you’re going to trust elections, there has to be transparency.”

The requests, which include items such as signature complaints, chain of custody documents for drop boxes, and surveillance videos for drop boxes, are listed in full below:

1. From the General Election held on November 3, 2020 (hereinafter “2020 General Election”), all written or recorded reports, complaints, requests for investigation, regarding signatures of electors on absentee ballots, envelopes, or voter registration for Fulton, Cobb, Dekalb, and Clayton counties;

2. All reports, records, transfer documents, custody documents, memoranda, notes, written or recorded statements, and any other document or relevant correspondence concerning all chain-of-custody records for every absentee ballot drop box authorized in Georgia for the 2020 General Election;

3. All surveillance videos of every authorized absentee ballot drop box utilized during the 2020 General Election;

4. All correspondence, both paper and electronic, received by negotiation or otherwise by the Georgia Secretary of State’s office in exchange for the Secretary’s consent to the March 6, 2020 Compromise Settlement Agreement And Release in the lawsuit between Democratic Party of Georgia, Inc. (“DPG”), the DSCC, and the DCCC), as Plaintiff, and Brad Raffensperger, Rebecca N. Sullivan, David J. Worley, Seth Harp, and Anh Le, as Defendants.

5. All surveillance videos of the Georgia World Congress Center for the dates of November 3, 2020, and November 4, 2020.

6. All reports, records, and tabulations of absentee ballots received by the Secretary of State’s office during the 2020 General Election.

7. All reports, records, and tabulations of absentee ballots envelopes received by the Secretary of State’s office during the 2020 General Election.

8. All official correspondence to and from the Secretary of State, both paper and electronic, to and from Dominion Voting Systems (hereinafter “Dominion”) or any person associated with Dominion regarding the 2020 General Election.

9. All correspondence, both paper and electronic, regarding any of the following: (1) all official audits of the Dominion ballot marking devices (hereinafter referred to as “BMD”); (2) any relationship between Dominion and Pro V&V; (3) the number of BMDs examined by the Secretary of State; and (4) the extent to which such BMDs were examined.

10. To the extent not previously requested herein, each and every document pertaining to all reports prepared by any expert or election official regarding: (1) the accuracy and performance of BMDs and (2) all reports of any person who investigated BMDs or absentee ballots for the 2020 General Election.

https://www.breitbart.com/2020-election/2021/06/18/exclusive-georgia-republican-david-belle-isle-formally-files-wide-request-for-election-records-from-brad-raffensperger/

>>13933346

Yeah. They literally “step up” the stuff until they get their desired “results”!

Complete bullshit their so-called science is.

>>13933350

>Siegel

Q: Why don't journalists get dementia?

A: They were never mented to begin with.

>>13933357

Beware the Little Horn

>>13933360

Dan The Man on Instagram at approx 5:15 PM EST

https://instagram.com/danscavino?utm_medium=copy_link

https://instagram.com/stories/danscavino/2599049937488505776?utm_source=ig_story_item_share&utm_medium=copy_link

>>13933312

Incest is no fucking joke.

Idiot

>>13933361

Boo. Get off the stage.

>>13933356

It's very easy to get those Fragments.

It's sequence of Human Chromosome 8.

simple.

>>13933312

you fucked now

>>13933364

A beautiful brave new world lies ahead.

President Biden signed a bill Thursday to set aside Juneteenth, or June 19th,

as a federal holiday. It comes at a time when teachers around the country are

navigating pressure from GOP lawmakers to cut back on teaching about racism

in school. (June 18)

https://www.newsweek.com/gavin-newsom-assaulted-oakland-jokes-people-have-different-ways-saying-hello-1602201

Gavin Newsom Assaulted in Oakland, Jokes 'People Have Different Ways of Saying Hello'

Newsom was on a trip to promote small businesses. As he walked to Beastmode Barbershop and Graffiti Pizza, he was "approached by an aggressive individual," Fran Clader, communications director for the California Highway Patrol (CHP), said in a statement.

"Members of the Governor's security detail removed the Governor from the situation and the individual was arrested by CHP officers," she continued.

>>13933312

you violated the Mcfly Rule. Good luck.

>>13933339

filtered maggot faggot

>>13933367

You misspelled wincest.

>>13933375

https://twitter.com/ABC7/status/1405993903656882179?s=19

#BREAKING Gov. Newsom assaulted by 'aggressive' man on CA street https://t.co/tnEJPz4ZtU

>>13933364

>>13933370

what?

each primer is designed to amplify a specific region of dna//rna, in this case the rna of covid

if you arent exposed to covid, you wont have any template to amplify

One Step at a time

>>13933368

Lindell v. Dominion/Smartmatic: Initiating Complaint Summary

https://uncoverdc.com/2021/06/18/lindell-v-dominion-smartmatic-initiating-complaint-summary/

Plaintiff’s June 3, 2021 filing that initiated the Lindell v. Dominion/Smartmatic case is comprised of the Complaint and 17 exhibits. This article summarizes the initiating Complaint. The full series of articles is available through the following links: Intro | Complaint Summary | Exhibits 1-4 Breakdown | Exhibits 5-7 | Exhibits 8-9 | Exhibit 12 | Exhibits 10-11 & 13-17.

Michael J. Lindell v. U.S. Dominion, Inc., et al. Complaint

A legal ‘Complaint‘ is a document filed with a court that functions to initiate a lawsuit and inform the court and the Defendants of Plaintiff’s intent. It offers a summary of ‘facts’ that aim to establish the necessary elements of the claim for relief that a Plaintiff is asserting. These ‘facts’ exist as to allegations against the Defendants, pending supporting evidence that will be brought forth in trial to be considered by the judge and/or jury.

The Complaint filed to start Lindell v. Dominion is more readable than a typical lawsuit in both vocabulary and style. Dystopian quotes are interspersed from George Orwell’s “1984,” E.M. Forster’s “The Machine Stops,” and other famous literature. In it, Plaintiff Lindell alleges that evidence has been suppressed that would show Defendants’ machines were manipulated to affect the November General election results.

Lindell claims that the Defendants’ lawsuits and legal demands against him amount to a weaponization of law or LawFare (Law + Warfare). He says they are essentially government because of their role in elections administration, so it is a violation of his first amendment rights to intimidate and try to silence him.

…

“A total of five (5) companies conduct and administer elections for more than ninety percent (90%) of counties in the United States: (1) Election Systems & Software, (2) Dominion Voting Systems, (3) Smartmatic USA Corp., (4) Hart InterCivic, and (5) Tenex.“

…

The lawsuit claims to show relevant ties to private equity firm Staple Street Capital, global investment firm The Carlyle Group, UBS Securities LLC, Chinese banks and corporations, and the Chinese government. “…by the time of the 2020 election, Chinese government-related entities, Chinese technology companies, and powerful Chinese financial interests had direct or indirect ownership of and near-total access to Dominion’s and Smartmatic’s voting machine technology.”

…

Part D., “Gaslighting: The REAL Big Lie,” begins by noting that the Department of Homeland Security (DHS) Cybersecurity and Infrastructure Security Agency (CISA) had published claims that the 2020 election was the “most secure in American history,” but points out that Dominion is a member of CISA’s Election Infrastructure Sector Coordinating Council, which it says gives them “self-serving influence over CISA’s proclamations.” It notes that Dominion “forced unplanned and unannounced software uploads into its machines” on the night before the 2020 election and that Dominion “publicly denied that any such updates… were made and that its machines were connected to the internet,” calling both statements false.

…

More at link

>>13933374

Sorry gays. Your pride don't matter. Even though you glommed blacks, trannies and mexix to your flag.

Juneteeth is where it's at.

Ayo hol up.

This was posted late lb.

Is it from Fan Club copypasta or Pig?

Delany's Chocolaty Colorado Mail-In Misadventure?

re previous: "Runbeck Louisiana Hero?"

>>13892395 (pb)

>>13893264 (pb)

>>13893305 (pb)

Runbeck's Erin Delany hit some coincidences that made this anon wonder about her role. Is this Baton Rouge Runbeck employee the "hero" recipient of CodeMonkeyZ's recent Baton Rouge chocolate delivery?

Would "Runbeck run" if an employee having Delany's deep SoS connections "kept a copy"?

One more coincidence:

Delany didn't just represent the SoS inAZ and LA, but also inColorado. She "coordinated" the big CO "ballot on demand" operation in 2012, right before mail-in voting went live in 2013. And isn't Colorado in the news now, with the current CO SoS panicking so kekkily.

Just another coincidence?

Or is Erin Delany avery important person in the audit(s)?

-

Kinda convenient, having a system that can print ballots on demand, whenever the SoS might need 'em.

Day or night.

So what does Erin Delany know about SoS offices and on-demand ballot printing?

Except everything?

-

https://gab.com/threesevens/posts/106433732728573527

https://t.me/CodeMonkeyZ/463

https://www.linkedin.com/in/erin-delany-91418277

https://www.sos.state.co.us/pubs/newsRoom/pressReleases/2021/PR20210617Rules.html

>>13933341

fuckworld

>>13933350

I was just pondering this thought earlier today!

With the advances in tech. and the ease with which a person can look-up any topic and try to make it! Natural therapy/medicine disclosure makes it possible with alternative med. Lots of do-it-yourselfers and home school doctors.

>>13933374

>>13933371

Attorney Sidney Powell and other lawyers who filed lawsuits to support former President Donald Trump’s claims about the 2020 election were summoned by a judge to a sanctions hearing in Michigan.

https://www.theepochtimes.com/sidney-powell-summoned-to-michigan-court-for-sanctions-hearing-judge_3864570.html

>>13933354

>>13933356

Not only that.

Sequences of ANYTHING does NOT equal the STATE of "BEING INFECTED".

"a FINDING" of a small segment very short actually of RNA is just that.

You amplified that finding.

It tells you absolutely NOTHING about "Infection".

Bacteria for example may be present (and are present) at all times in Humans that are SOMETIMES pathogenic.

(They are POTENTIALLY Pathogenic)

Just because you find them there does NOT indicate infection BY them.

That's simply ridiculous.

I Found Flies in my garbage.

Every single Trash can has garbage and all of them contain Flies.

Conclusion: Flies CAUSE Garbage.

https://www.wgrz.com/article/news/local/huge-car-dealer-billy-fuccillo-dies-in-florida-at-64/71-ebd546f0-6466-4ae3-b966-6327977e9656

LOCAL NEWS

'Huge' car dealer Billy Fuccillo dies in Florida at 64

''Fuccillo's death, which reportedly came after a long illness.''

Author: WTSP WGRZ

Published: 10:34 AM EDT June 18, 2021

Updated: 12:18 PM EDT June 18, 2021

TAMPA, Fla. — Legendary car dealer, Billy Fuccillo, whose catchphrase was "huge," has died at his Florida home, according to multiple reports.

The Syracuse Auto Dealers Association confirmed Fuccillo's death, which reportedly came after a long illness, CNY Central reported.

According to the Times-Union, his Syracuse-based Fuccillo Automotive Group is the largest privately-owned dealership in New York State, with locations there and in Florida. Fuccillo also owned dealerships on Grand Island.

The 64-year-old, who once played football at Syracuse University, is survived by his wife Cindy and son, Billy Fuccillo Jr.

''H U G E''

>>13933375

>>13933379

They won't be able to walk down the street.

0 becomes 9

P

TYB

This does not look very comforting.

>>13933387

The sad, vacant look on that cat's face always makes it look like it's getting molested by it's owner but can't tell anyone. It looks suicidal.

>>13933349

and

>>13933300

>STALE DOUGH

>GHOST STILL IN EFFECT

TYB noice digits - Looks gud & baked from here baker, anons will continue to hold the line *DIG/MEME/PRAY * SEND IT MY BRETHREN

>>13933375

>>13933379

from the article.

Newsom did not appear to be injured, andreporters did not see exactly what happened, according to the East Bay Times. Reporters on the scene only saw the CHP, which provides security for the governor, detain the suspect. Newsom reportedly joked that "different people have different ways of saying hello," according to the paper.

Video of the arrest was posted by KABC, and appears to show the suspect, a 54-year-old Black man, lying on the ground as an officer puts him in handcuffs. The man was identified as Serge Emanuel Benoit Chaumette Jr. from Berkeley.

>>13933397

its not used to determine infection its used to determine exposure

which is why doctors have a lab run a pcr test while they do an examination of the actual patient, to determine if their symptoms (infection) is caused by covid (pcr test positive) or something else (pcr test negative)

>>13933368

>boo get off the stage

You must mean traitor Pence kek

>>13933403

>>13933349

aha! Illuminati matrix guy.!!

Haven't seen that in awhile.

>>13933333

>>13933407

It's just a cat pic, man.

The real question is: Is Mr. Pig really a Mrs.?

2 Timothy 3

Godlessness in the Last Days

3 But understand this, that yin the last days there will come times of difficulty. 2 For people will be zlovers of self, alovers of money, bproud, barrogant, abusive, bdisobedient to their parents, ungrateful, unholy, 3 cheartless, unappeasable, slanderous, without self-control, brutal, dnot loving good, 4 treacherous, reckless, eswollen with conceit, flovers of pleasure rather than lovers of God, 5 having the appearance of godliness, but gdenying its power. hAvoid such people. 6 For among them are ithose who creep into households and capture weak women, burdened with sins and led astray by various passions, 7 always learning and never able to jarrive at a knowledge of the truth. 8 Just as kJannes and Jambres lopposed Moses, so these men also oppose the truth, mmen corrupted in mind and ndisqualified regarding the faith. 9 But they will not get very far, for their folly will be plain to all, oas was that of those two men.

All Scripture Is Breathed Out by God

10 pYou, however, have followed my teaching, my conduct, my aim in life, my faith, my patience, my love, my steadfastness, 11 my persecutions and sufferings that happened to me qat Antioch, rat Iconium, and sat Lystra—which persecutions I endured; yet tfrom them all uthe Lord rescued me. 12 Indeed, all who desire to vlive a godly life in Christ Jesus wwill be persecuted, 13 while xevil people and impostors will go on from bad to worse, deceiving and ybeing deceived. 14 But as for you, zcontinue in what you have learned and have firmly believed, knowing from whom1 you learned it 15 and how afrom childhood you have been acquainted with bthe sacred writings, cwhich are able to make you wise for salvation through faith in Christ Jesus. 16 dAll Scripture is breathed out by God and profitable for teaching, for reproof, for correction, and for training in righteousness, 17 that ethe man of God2 may be complete, fequipped gfor every good work.

January 6 political prisoners in the D.C. Detention Center are being coerced into receiving the COVID-19 vaccine to avoid ongoing inhumane conditions and mistreatment.

As was reported by multiple outlets, American citizens are facing torturous conditions in the D.C. Detention Center over minor crimes related to the events at the Capitol on January 6, that have been compared to conditions seen in Guantanamo Bay. On April 19, it was reported that these political prisoners were held alone, sometimes with a single cellmate, in their cells for 23 hours a day for over 400 days with zero outside time due to COVID-19 restrictions. Inmates were granted only 1 hour to shower or perform out-of-cell activities.

Conditions of the jail have been widely condemned and criticized. Inmates were restricted from shaving, trimming their toenails, or getting a haircut, only to be provided with a chemical hair remover which many were unable or unwilling to use due to burning of the skin. Inmates were not allowed to receive visits from their lawyers and families, and were only allowed to contact them virtually or over the phone. They were restricted from any library services, therefore having no access to reading material to pass the time while incarcerated. As all court processes have been slowed, many inmates have had their trial dates extended for weeks and even months. Inmates’ lawyers have reported mental and verbal abuse, threats, and violent beatings that have left prisoners with permanent injuries.

“Since his arrest, Ryan Samsel has been held in Washington DC. On March 21, he was awakened by correctional officers, his hands zip-tied, then walked to an unoccupied cell and brutally beaten by the officers. Then Ryan Samsel lost an eye in the beating,” reported Gateway Pundit.

The District of Columbia maintains that such measures were necessary to prevent the spread of the virus in the facility. However, the inhumane conditions drew the attention of Congressman James Comer (R-KY), who issued a letter to D.C. Mayor Muriel Bowser demanding answers. The DC mayor has not responded to the letter in direct violation of the D.C. Home Rule Act, which states that Congress has oversight in the district.

Following the reports of the conditions in the jail, changes were made at the detention center as the COVID-19 pandemic restrictions were being lifted. According to a report by the Washington Post in May, some freedoms for these political prisoners had been restored, but only for those who have been vaccinated for COVID-19.

“D.C. corrections officials will ease an array of coronavirus restrictions in the coming weeks and relax the nearly 24-hour confinement that inmates endured for more than a year, according to plans released Thursday. Beginning May 15 and through July, vaccinated inmates will see a resumption of activities that are in line with the city’s return to pre-pandemic openings, and the rolling back of some of the restrictions that jail officials said were needed to contain the spread of the coronavirus but that drew sharp criticism from lawmakers and allegations of human rights abuses.”

“This means that inmates who are not vaccinated are being held in ongoing inhumane lockdown conditions. This is a clear violation of the Nuremberg code, which prohibits testing medications on inmates, and prohibits the use of force or coercion in the use of medical experiments,” said Suzzanne Monk, conservative activist, journalist, and founder of ReOpen America. “These abuses have been made more possible by the already utter disdain for human rights that has been in place in the DC Detention Center for now over 450 days, human rights violations that continue to this day, and are made even more disturbing in their criminal abuse of medical protocol.”

https://nationalfile.com/d-c-jail-coerced-jan-6-political-prisoners-into-getting-vaccinated-to-avoid-inhumane-treatment/

>>13933349

Kek

>>13933112

Dong also has provided DIA with copies of the contents of the hard drive on Hunter Biden’s laptop, showing the information the Chinese government has about Hunter’s pornography problem and about his (and Joe’s) business dealings with Chinese entities.

motherfuckers really do "have it all" now

Forensic evidence

Chinese whistleblower data

Affidavits

Hunter Laptop

FBI framing Trump supporters

[you] are all fucked

Smug FBIFaggots on here will look and laugh. That's good; keep laughing.

>>13933398

>TAMPA, Fla. — Legendary car dealer, Billy Fuccillo, whose catchphrase was "huge," has died at his Florida home, according to multiple reports.

>The Syracuse Auto Dealers Association confirmed Fuccillo's death, which reportedly came after a long illness, CNY Central reported.

>According to the Times-Union, his Syracuse-based Fuccillo Automotive Group is the largest privately-owned dealership in New York State, with locations there and in Florida. Fuccillo also owned dealerships on Grand Island.

>The 64-year-old, who once played football at Syracuse University, is survived by his wife Cindy and son, Billy Fuccillo Jr.

''Billy Fuccillo was an American car dealer and owner of Fuccillo Automotive Group, which operates a total of 28 dealerships and represents 15 brands in New York and Florida.'' His son, Billy Fuccillo Jr., also owns 5 dealerships in total, with 3 located in New York and 2 in Florida. Wikipedia

Died: June 17, 2021 Trending

Born: 1957, United States

Children: Billy Fuccillo Jr.

>>13933422

>It's just a cat pic, man

A cat with a busted, broken butthole.

Joe Rogan Shitting on stetler

Jon Stewart Shitting on China Wuhan lab

Can you feel it anons?

Friday Night Tendies click

>>13933387

>>13933407

WHAT'S IMPORTANT, IS THE POSTING OF 'AMERICA WINNING'

NOT ABOUT PIG. ABOUT AMERICA.

>>13933428

>>13933434

snore filtered af

>>13933428

This Dong story is the news event of the week.

Hope moar details emerge.

>>13933431

>>13933431

They have audiences over a million - I’m feelin’ ya

#NoHomo

>>13933359

all science.

sadly.

>>13933413

>>13933431

>>13933439

>Joe Rogan Shitting on stetler

>

>Jon Stewart Shitting on China Wuhan lab

>

>Can you feel it anons?

Watch the water.

https://theeventchronicle.com/american-roots-nazi-eugenics/

Begs the question:

Why do SOME PEOPLE think the Swastica and the word NAZI re misused and are actually GOOD!!!

>>13933433

Whatever.

If that was you last bread that posted it then you decided to say you're a chick.

That's breaking news on QR if true.

>>13933423

it is called editing.

jügle it

just when i thought ebot was my friendly image bot because "they never post together" they start posting together

womp womp

>>13933411

The way it is being used?

It absolutely IS being used to say INFECTION is diagnosed.

They are calling it asymptomatic infection.

What did I say?

It cannot be used to diagnose INFECTION.

and that is exactly how they are TOUTING it as being used.

And WHO decided how many cycles?

(Because depending on the cycles you can create the illusion of finding it anywhere you wish… in all humans.)

SO it has nothing to do with exposure.

ALL the PCR standard for current use in USA

is based on the in vitro shit science pulled from a SINGLE patient in Washington.

This is not viremia.

They have tied it to nothing.

Not only that modern virologists following Robert Gallo style of virology

have yet to prove what they are looking for causes anything.

>>13933431

Energy levels Rising.

GA on Schedule and underbudget

>>13933040 lb

Theater huh…

>>13933386

White gays just need to shut up.

>>13933437

>>13933415

Lotta rumors about this guy…

>>13933416

>and then your faggot screamed asshole.

Weird but not muh prob shillaxe & work it out.

NEF

Happy Pride MOnths from Nickoleoden!

Californians can now access a digital copy of their coronavirus

vaccine record, state officials reported Friday.

Permission to proceed Sir?

o7

>>13933452

no, dude, fuck

if it isnt there to begin with it wont get amplified

jesus christ

just because you cant understand something doesnt mean other people dont

>>13933449

>>13933420

Sidney Powell Summoned to Michigan Court for Sanctions Hearing: Judge

https://www.theepochtimes.com/sidney-powell-summoned-to-michigan-court-for-sanctions-hearing-judge_3864570.html

>>13933462

No. let's wait another 3 years.

@BarackObama

On Monday, I’m joining @EricHolder for a grassroots conversation with @AllOnTheLine to talk about why redistricting matters and how the Senate can help protect our democracy. Join us:

https://twitter.com/BarackObama/status/1405874188406210560

Kek

>13932571 (lb)

Posted earlier that Dong and daughter coming to the US in Feb, a few weeks after Bidan is installed as pres. Doesn't make sense.

Story is he has covid stuff and Hunter/Bidan dirt. That would make him a marked man from the CCP side and from the Bidan group side. Who would defect to the US mainland under those conditions?

So, it could be a limited hangout by the Bidan group, trotting out someone who releases a bit of information that points back to US IC activity, for example, or a play by dems that offers up a "defector" who will be easily debunked, thereby discrediting any CCP/Bidan accusations.

Could be, too, that it's Mil Intel who has him outside CONUS and are releasing info bit by bit now as a force multiplier to the election scam revelations. The more state pols like the chick in CO spout off, for example, the harder the fall is the fraud is uncovered. IOW, CO AG got a margin call from the suits with the bucks to deliver the goods for the people who put her in office, and MIL Intel is blowing that up with timed drops.

Bidan/dems will not survive any revelation that they promoted the covid shit as part of an election steal. Time that info release in a way for the normies to connect the dots and it's over for them.

Add too, that a lot of stuff is starting to surface after Bidan's European trip. So could be Bidan fucked up. Can't see European NATO, for example, wanting to cover Bidan's six if he decides to declare the next corporate hack a Russia. attack, or if he demands Ukraine be made a NATO member. Cold War 2.0.

Putin might have jacked his ass in Geneva, say, and Bidan bailed on NATO/UKraine after telling NATO European members he was letting Ukraine in. Zelensky bitched and Bidan froze funds, if reports yesterday are accurate.

That very scenario got Trump impeached. Where the fuck is Vindman when you need him?

Bidan just might be getting tweaked from all sides at this juncture, and has to pick the source least damaging info to take a shit on. In this case, Putin has worse dirt than Zelensky. say, so tough shit for Zelensky.

>>13933431

YES

Enjoy the Show!

>>13933464

That cat has a face that says "rape survivor".

>>13933462

The Virginian-Pilot

Opinion: Reports of QAnon's death aren't exaggerated

That's why QAnon, who made a messiah out of former President Donald Trump, was always bound to lose steam. It will follow the arc of furious, loopy-loo …

30 mins ago

CNA

Commentary: QAnon – how a conspiracy-consuming …

Commentary: QAnon – how a conspiracy-consuming community persists, despite its leader going MIA. From its humble beginnings in drops posted by a prophet- …

38 mins ago

News.com.au

Four Corners: ABC duped by Scott Morrison QAnon …

A Four Corners investigation has raised concerns over Scott Morrison's friendship with one particular QAnon adherent.

2 hours ago

The New York Times

Opinion | Will Christian America Withstand the Pull of QAnon?

Yet there have been no statements or resolutions by the Southern Baptist Convention calling QAnon “incompatible with the Baptist Faith & Message,” which six …

2 hours ago

The Independent

Woman who claims to be secret queen of Canada develops …

According to Vice, her posts on Telegram were soon noticed by figures within the QAnon conspiracy movement, members of whom were accused of taking part …

3 hours ago

>>13933463

if one has ever had the flu it will show if amplified enough.

find one person with no flu viral remnants.

you are a sounding brass.

>>13933466

]OUR_GIRL[

>>13928145 pb

>FOUR BA Pilots Dead, Potentially From Vaxx Complications

Supports theory that vaxx hits high achievers hardest, possibly due to rhesus negative link

A job fair is taking place at the Pomona Fairplex Thursday and Friday. DeMarco Morgan reports.

>>13933464

TOGTFO

@MichelleObama

It’s almost #FathersDay, so I’m thinking a lot about my dad and reflecting on some of the memories we shared growing up. I’d love to hear about the fathers in your life—what qualities you value in them, what makes them unique, and what the best advice they’ve given you has been.

https://twitter.com/MichelleObama/status/1405940927160635393

>>13933476

>you are sounding brass

and your esl is failing

>>13933363

So, wasn't the military suppose to do something? Like restore law and order, save the republic, reinstate the rightful and lawful winner of the 2020 election? What happened to those guys? Oh, I kremember now, they're too busy getting woke and reading the CRT book that was suggested they read. Well, maybe later.

>>13933471

you think every litter of kittens came from consent?

It's a wild world out there. Especially with catnip.

>>13933481

>>13933446

>>13933461

>>13933480

ebot behavior trending towards pissed tranime behavior

>>13933487

>So, wasn't the military suppose to do something? Like restore law and order, save the republic, reinstate the rightful and lawful winner of the 2020 election? What happened to those guys? Oh, I kremember now, they're too busy getting woke and reading the CRT book that was suggested they read. Well, maybe later.

>>13933488

>>13933483

Dolores Wong's contributions to the community includes the first public library in Chinatown.

Chris Holmstrom reports.

Pentagon reportedly pulling jets, anti-missile guns out of Middle East

By Samuel ChamberlainJune 18, 2021 | 6:42pm

https://nypost.com/2021/06/18/pentagon-reportedly-pulling-jets-anti-missile-guns-out-of-middle-east/?utm_source=NYPTwitter&utm_medium=SocialFlow&utm_campaign=SocialFlow

>>13933381

The WHO’s forward, reverse primers and probe protocols, for the alleged SARS-CoV-2 viral genome,

are based upon RdRp, Orf1, N and E gene profiles. Anyone can run them through BLAST to see what

we find.

The vital RdRP nucleotide sequence, used as a forward primer is – ATGAGCTTAGTCCTGTTG. If we

run a nucleotide BLAST this is recorded as a complete SARS-CoV-2 isolate with a 100% matched

sequence identity. Similarly the reverse E gene primer sequence – ATATTGCAGCAGTACGCACACA

– reveals the presence of the Orf1ab sequence which also identifies SARS-CoV-2.

However, BLAST also enables us to search the nucleotide sequences of the microbial and human

genomes. If we search for the RdRp SARS-CoV-2 sequence it reveals 99 human chromosome with a

100% sequence identity match. The Orf1ab (E gene) returns 90 with a 100% sequence identity match

to human chromosomes.

Doing the same for these sequences with a microbial search finds 92 microbes with a 100% match to

the SARS-CoV-2 E gene and 100 matched microbes, with a 100% sequence identity, to the vital SARS-

CoV-2 RdRp gene.

Whenever we check the so-called unique genetic markers for SARS-CoV-2, recorded in the WHO

protocols, we find complete or high percentage matches with various fragments of the human genome.

This suggests that the genetic sequences, which are supposed to identify SARS-CoV-2, are not unique.

They could be anything from microbial sequences to fragments of human chromosomes.

>>13933399

>>13933467

Obamas wingman

>>13933487

Sadly, both Trump and Q appear to be Deep State operatives.

We've seen dog comms. Clock comms. Schumann comms. Corn comms.

But what about titty comms?

>>13933468

most countries' intel know biden presidency is a sham and that he is being propped up by cabal/deep state mockingbird media and by ccp controlled social media companies

>>13933505

>But what about titty comms?

I wish.

Can't even get a timestamp these days.

>>13933386

Pride. One of the 7 deadly sins for a reason.

>>13933415

Michael Richard Pence professes to be a devout Christian… The Lord said: Do not let your good be evil spoken of and WE will know His children by their Fruit!

>>13933509

times are tough anon, but we'll get through it

>>13933390

>Lots of do-it-yourselfers and home school doctors.

No! Bad sheep.

Only your betters know better. Ethan says.

>>13933508

We're at the stage in The Plan where every9one starts turning into a talking meme.

Better buy some moar coffee so Jim can keep the Image Server running 24X7.

>>13933400

>>13933504

You know, that's probably true, but it still hurts seeing it in print like that.

>>13933415

The fly knows.

>>13933379

Black dude in cuffs lying on the street? On Juneteenth eve? Dafuq?

Wouldn't a white guy with MAGA gear be better optics?

What were they thinking?

>>13933519

https://www.nytimes.com/2021/06/16/opinion/putin-winning.html

We’ve Come a Long Way Since Trump. Putin Is Still Winning.

By Alexander Vindman

Mr. Vindman served as director for European and Russian affairs at the National Security Council from 2018 to 2020.

The last time an American president held a summit with President Vladimir Putin of Russia — July 16, 2018, in Helsinki — happened to be my first day working at the White House as the National Security Council director for European and Russian affairs. It was not the usual mundane Day 1 of H.R. meetings, to put it mildly. Instead, I was thrust into a vortex of unending press inquiries and hasty meetings with other National Security Council staff members. We were all responding to frantic calls from embassies and congressional aides demanding comments and clarification on President Donald Trump’s bizarre assertion that he seemed to believe Mr. Putin’s (false) denials of interference in the 2016 election at least as much as the assessment of the United States intelligence community.

The decidedly sedate spectacle of Wednesday’s summit between President Biden and Mr. Putin in Geneva could not be a starker contrast to the frenzied mayhem of three years ago. Russia watchers expected the standard fare of arms control discussions and renewed “strategic stability” talks, including discussions on reducing the threat of unintended conflicts. What I found most reassuring were Mr. Biden’s statements that he would stand firm on defending democratic values, be critical of human rights violations, protect the free press and seek justice for American citizens wrongfully detained by the Russian government. A welcome surprise and a major departure from Mr. Trump’s Russia policy was the signaling of a muscular response to any further attacks on the United States, including retaliating against future cyberattacks.

Critics will argue that little was accomplished Wednesday that would move the needle on U.S.-Russia relations. That may be so, if progress is measured by a single meeting. In reality, diplomacy doesn’t work that way.

In the short term, we will quickly see respective ambassadors return to their posts, and strategic stability talks and cyber working groups resume meetings. Yet real, long-term progress will be measured in terms of how intentionally the United States responds to Russian aggression.

If, for instance, America continues to be the victim of cyberattacks, then there must be real consequences to deter Russia’s actions. Ultimately, it is the United States’ response to continued Russian aggression that will steer the relationship back to one of establishing deterrence. Mr. Biden’s statements about the relationship being based on “self-interest and verification” and “the proof of the pudding is in the eating” show he is aware of these complexities.

Behind the scenes, Mr. Biden started to set the conditions to constrain Russia’s behavior. In the frank exchanges — as evidenced by the statements issued during the news conferences — it seems clear that Mr. Biden delivered strong warnings. But American officials know very well that constraining Russia’s belligerence will take far more than tough talk or unilateral U.S. actions. It will take unwavering toughness from Mr. Biden and a solid front among allies — all united and cleareyed in the belief that Mr. Putin is fundamentally an adversary who needs to be kept in check.

>>13933410

> a 54-year-old Black man, lying on the ground as an officer puts him in handcuffs

Your betters, like Gov Newsom, have no problem putting blacks in cuffs. No riots. No pushback.

>>13933524

Mr. Biden’s statements will no doubt play well in the U.S. media for a short time, but the visual of Mr. Putin shaking hands with Mr. Biden will probably be replayed ad nauseam on Russia’s state media for weeks and months, particularly in advance of September parliamentary elections.

The clear problem here is that Russia is coming away with a public relations win while the U.S. has little to show from the summit in terms of tangible improvements to national security. Mr. Putin has once again been elevated to the world stage in a face-off against the world’s pre-eminent superpower in a well-rehearsed and tiresome script that burnishes his credentials as a world leader.

The Biden administration’s short-term objective of using the summit to de-escalate some tensions, like the buildup along the Russia-Ukraine border, ending the tit-for-tat expulsions of diplomats and forestalling the death of opposition leader Alexei Navalny made a summit a good tactical play. But this one-off summit has done little to advance the long-term strategic objectives of containing Russia’s growing aggression and interference in the domestic affairs of Western democracies.

The overriding U.S. foreign policy aim must be to prevent an existential confrontation with Russia, given its growing belligerence, propensity to employ conventional military capability and consistent pattern of apparently miscalculating the effects of attacks on neighbors and adversaries. U.S. policy must focus on reducing the short-term risks of miscalculations while addressing the ever-increasing long-term risk of a confrontation with Russia continually testing U.S. resolve.

What is necessary is an approach that establishes prohibitively high costs and denies the benefits of Russia’s belligerence. This includes symmetric and asymmetric responses to Russian cyberattacks, significantly increased security assistance to Ukraine if Russia continues to escalate its war there and active engagement with Russian civil-society and pro-democracy groups as Moscow continues its information warfare in the United States and the West.

To offset the risks of this approach, the United States will need to remain engaged with Russia in order to provide clarity on the severe ramifications of further transgressions. This must be accompanied by the swift execution of those promised consequences. There can’t be rowed-back red lines. (Frankly, Russia has already crossed several of them through its blatant interference in our democratic process and cyberattacks.) And that approach must also be executed in coordination with allies and partners, because Russia will undoubtedly exploit the fissures within existing alliances to undermine any multilateral strategy.

The Biden administration may have hoped that, by holding the summit, it would check off the undesirable obligation of engaging with Russia and then move on to the more pressing business of an overflowing domestic agenda and the challenges of a rising China. But as we well know, no one puts Vladimir Putin in a corner; he will continue to demand presidential-level engagements with Mr. Biden, especially as his credibility is reliant on asserting Russian power.

The Biden administration’s approach has to be a combination of sustained engagement, including strategic stability talks with senior national security leaders from both countries, along with calibrated steady pressure to end Russian aggression. Getting that right, without tipping into a full-blown confrontation, is the Biden administration’s Gordian knot.

>>13933519

I see so many liberals with the crazy-eyes that it's become a definite pattern.

>>13933509

Bubbles is still the MVP timestamp or no

>>13933491

There will be no 15 and 16. Winner take all. Game theory.

16

>>13933381

No

YOU'RE a sounding brass fren.

Let's call each other names!

YAY!!!

https://www.thegatewaypundit.com/2021/06/homeless-man-arrested-assaulting-gavin-newsom-visit-downtown-oakland-video/

Homeless Man Arrested For Assaulting Gavin Newsom During His Visit to Downtown Oakland (VIDEO)

By Cristina Laila

Published June 18, 2021 at 5:53pm

>>13933379

>>13933460

>>13933482

in our family photos, we smile.

it's a big part of who we are.

in their family photos, they sneer

it's a big part of who they are

My fucking NPC family is still pushing me to get the vax

This is the hill I’ll die on, alone apparently

welp, thats what i get for engaging in anything but shitposting on this board

obviously its going to be some indian bot or whatever

>>13933509

>Can't even get a timestamp these days.

What's the latest you have?

We got one just the other night.

>>13933383

>>13933526

Agree 100%. Fuck "comfy".

>>13933537

the image gives off bad vibrations.

https://www.upi.com/Top_News/US/2021/06/18/Dow-Jones-sinks-by-500-points-capping-worst-week-since-October/2451624048920/

U.S. News

June 18, 2021 / 5:20 PM

Dow Jones sinks more than 500 points, capping worst week since October

By

Don Jacobson

Should I Go On FOX News? (after what happened last time!)

•Jun 18, 2021

Russell Brand

https://youtu.be/79xQW-jrcKA

Yes!

>>13933513

>>13933530

Of course - Not Bubbles (pic related) is another hottie in her own right, too.

Both can eat crackers anywhere they want.

But, even Bubbles is burnt out these days.

"Jeez guys - aren't you tired of mine yet???"

>>13933531

sweet

>>13933428

Clearly this is an epstein situation

the girl does not embrace Hunter.

>>13933537

>>13933537

They call it screw face. It's a hood thing.

>Screw Face (Adjective)

>English Translation: Scowling face

>Definition: Term used to refer someone that has an angry or bad tempered expression on their face

>Example Sentences

>Patois: Mi nuh like how di screw face man deh look pan mi

>English: I don’t like how the scowling face man is looking on me

>>13933539

I don't mean to sound critical, but didn't you see this world, or something very like it, coming?

Did you prep in any way, mentally? How were you blindsided by this? Just trying to understand

>>13933504

>>13933518

Get a room

>>13933551

I noticed that also, thought the same also.

https://www.instagram.com/p/CP6m9F9tfJV/

>>13933511

https://www.wsj.com/articles/u-s-military-to-withdraw-hundreds-of-troops-aircraft-antimissile-batteries-from-middle-east-11624045575

WSJ News Exclusive Middle East

U.S. Military to Withdraw Hundreds of Troops, Aircraft, Antimissile Batteries From Middle East

Defense Secretary Lloyd Austin told Saudi crown prince of drawdown in June 2 call, officials say

Updated June 18, 2021 6:33 pm ET

>>13933542

New Bubbles from the other night.

Or, is there a newfag pair that I missed.

>>13933421

>>13933445

>Watch the water.

Cnn has been running non stop stories about the drought in AZ and CA…and how low the Hoover dam is now.

water drying up in the west.

Cattle being sold off

prices going to rise.

thats not fair

fucking with the jidf is a legitimate pastime as well

on Fox News at 6:50 pm "Unless there is a defector" we may never know in response to question about Wuhan Lab leak.

>>13933539

Stay strong. Never ever inject that shit into your body.

>>13933549

Yes they are the Dynamic Duo of QR. As long as they never take the vaccine, I will always love them.

Speaking of bewbs, if I run into BewbArchiveAnon I have a question for him. Regarding the Blue Bewbies

>>13933428

>>13933506

>

Agree.

So is Dong a DS limited hang out or a good guy trump card? Will be interesting. You can feel the stress level being cranked up.

Bidan undergoing a cognitive test. MSM being called out by middle of the road normie faction talk figures. Must be a vacuum building inside the Bidan group that will flip the whole info industry when it pops. Final days of the corporate MSM paradigm?

>>13933509

>>13933542

>We got one just the other night.

& yes anon archives everything offline.

>>13933539

Tell them “my body my choice”

Plus tell them you are not anti vax, but anti experimental gene therapy drugs. If the vaccine was a real one containing nothing but a small dose of the isolated COVID virus to trigger a natural auto immune response you would be the first inline to take it. Let your family chew on that.

>>13933551

That's Hunter's nice Caroline.

>>13933553

>Patois: Mi nuh like how di screw face man deh look pan mi

so is this a Caribbean culture that's become part of the afican american culture?

For a while, Caribbean culture was distinct from afican american culture. Perhaps that's part of the psyop they're working on, is mainstreaming those patois ways among US blacks?

>>13933573

*niece

The end of the worldly troubles is in sight but even when you return to what you would call normality there is much to be done to start anew and leave much of the old behind. With lockdown many countries have been laid bare and their shortcomings so apparent. It is not always the result of mismanagement but circumstances that have led to the acknowledgement of antiquated systems and a lack of foresight. Inequality has led to a great disparity between countries, although it is also due to the misuse of funds that have been kept for personal gain. These situations are coming to light and steps are being taken to remove those who have abused their power for their personal benefit.

Times are approaching when there will be no hiding place for those who have committed criminal acts against the people. There are of course genuine and honest people amongst you but sometimes they are overwhelmed by the actions of those who only serve self. It will all change, it has to if society is to be seen openly working for the betterment of all people. Sadly the dark Ones have had the power to move into positions of authority from where they further their own agenda. Many promises are made but thrust aside to allow abuse of their power and these actions are often carried out openly, but in future they will be closely monitored and action taken to prevent a recurrence.

The time is approaching when the people will rise up and demand an end to poverty and look for a more equal society. There are more than ample funds in the world to allow for such changes and it is just a matter of having a fairer system of distribution. This would be without claiming the funds “stolen” by the dark Ones to pay for their projects such as Space flights and all that is associated with them. You really are the Cinderella of the world but your day will come, perhaps much quicker than you might imagine. It always seems that the dark Ones can get away with whatever they wish, but be assured their power is already being limited. Nothing can be revealed in advance or broadcast about the tasks ahead, as secrecy is the best way to shield them but you may be assured that when successful they will be made known to the public in due course.

These are the times when we are in touch with your Space friends who would gladly help you out when in need, but apart from giving you encouragement they cannot directly help you but do their best to influence you to take the right action. Much is done that you will probably never become aware of, but you will realize you always have your unseen helpers around you. They do their best to ensure that you have every opportunity to help the Light in its battle against the dark Ones. This battle has been raging for millennia of time but it is drawing to a close. You have won the battle and now it is time to clear the planet from their influences.

The future for many of you is going to be exciting as you take part in reorganizing the Earth to its original plan, and the beauty of it is that as the vibrations continue to rise you will find less and less obstruction to your work. Little by little you will find that your powers have increased so be alert to the changes that are coming. These are strange times but suddenly the purpose behind everything will become apparent, and it is preparations for your Ascension. Obviously it is now very important that you keep the Light around you and do not allow the dark Ones to interfere with your continued evolution.

As we have often suggested, you should concentrate on the path you are following that is of your choice. The more progress you make the quicker you will establish yourself within the higher vibrations, and become free of the attention of the dark Ones. There will come a point where they can no longer keep pace with you. Even now you can safely avoid negative issues or actions by keeping inside your aura. When you are within it no one can interfere with you because you are well protected.

The Earth erupts to the raucous sounds that are emitted often in the name of music, yet when it is serene and gentle in a classical way it is actually of a healing quality. As you will learn through your experiences of sound it can actually harm or heal your body and the choice is yours. Mozart for example was overshadowed when composing and his music has a quality that can be very healing.

Sound has often played a part in various types of healing including mental afflictions. The vibrations can pass in to your body and put right any imbalances that may exist. Think upon the way that soothing music can help send you to sleep, even when you may be unsettled within. Equally when music is used romantically it can almost send people into a peaceful trance. You may experience most of these feelings without giving a thought to what has brought them about.

>>13933537

looks like 'they' was raised in a black household filled with late-60s anger at "the man"….which is why they had to make the Linc character on Mod Squad. …but at least the mad dad was a present father, albeit a father who raised his offspring to hate the country

>>13933568

He usually checks in to Night Shift after 10PM ET so could be here soon.

@LisaMarieBoothe

It’s insane to force people to get a vaccine that isn’t FDA approved for a virus that has a global fatality rate of .15%. You people are in a cult.

6:56 PM · Jun 18, 2021

>>13933555

>>13933573

>>13933575

>niece

So then he definitely fucked her

>>13933578

I'll raise the Batsignal later kek

>>13933538

>>13933564

>water drying up in the west

Water bypassing the farmers and getting flushed into the ocean.

Fixed it for ya.

Doesn't Congress go on summer break real soon?

https://pjmedia.com/news-and-politics/tyler-o-neil/2021/06/18/lawsuit-twitter-conspired-with-democrats-on-orwellian-censorship-of-election-concerns-n1455569

News & Politics

LAWSUIT: Twitter Conspired With Democrats on 'Orwellian' Censorship of Election Concerns

By Tyler O'Neil Jun 18, 2021 3:35 PM ET

>>13933562

Yup new Bubbles from other night, I think.

Glow in da dark, yes?

>>13933571

We're talking Anon Bewbs not *.com ones, tho.

>>13933573

>Hunter's nice Caroline

https://www.thesun.co.uk/news/15304813/who-is-joe-bidens-niece-caroline/

Hunter Biden reportedly used the racial epithet "yellow" when discussing dating an Asian woman in a 2019 text message exchange with his cousin Caroline.

"Do you want foreign or domestic," Caroline wrote in one message.

"I can't give you f***ing Asian sorry. I'm not doing it."

The president's 51-year-old son reportedly agreed, before adding: "Domesticated foreigner is fine. No yellow."

>>13933581

Didn't have the second amendment.

Pig is tuned in (when not clicking).

>>13933455

That’s not very nice. Starting to fit stereotypes?

>>13933582

exactly!

>>13933573

>That's Hunter's nice Caroline.

does that matter?

>>13933554

I didn’t say anything about being blindsided, how do you prepare for your family turning against you?

The U.S. is devoting $3.2 billion to advance development of antiviral

pills for COVID-19. Dr. Anthony Fauci, the nation’s top infectious disease

expert, announced the investment as part of a new “antiviral program for

pandemics.” (June 17)

>>13933555

There are no purely good guys out here in real life. Everyone has skeletons. If you think hard about the fucked up things you've done, that you don't talk about, you'll realize no one is coming to save you who isn't first and foremost out to save themselves.

Do you go out saving people? Do you see people on this board talk about how they go out and save people? But somehow, you think some vast organization of do-gooders is coming, secretly and silently to put things back just they way YOU, not THE PEOPLE DOING ALL THE WORK, want it.

That's extremely unlikely. You do understand that, right?

June 16, 2021

Greetings,

I am Queen An-Ra, from the Grand Council of New Earth Council, which was formed last year. I removed the council members in our realty and in your reality from Alliance, who were working on behalf of the Negative Entities trying to jeopardize the progress with Disclosure and Ascension.

The truth that was hidden for a long time is starting to surface to the general population. The Darkness as usual tries to manipulate with your Media the humankind and some Light community by hiding information about the secret tunnels built globally under cities in every country.

They have been changing your reality daily with their hidden agenda and portraying themselves as elite beings, who are in charge of your planet. These entities brainwashed everyone for a very long time, so well that no one ever questioned or doubted that you were living in a false world.

Each day, I see that more and more of you are realizing the truth by seeing, what is going on around you. The Illuminati, Anunaki, Reptilians, Orions and others have been playing Gods thinking that it’s okay to torture and sacrifice kids, allowed for the Secret Space Program to be hidden from the humanity by saying that there are no other life in this Milky Galaxy or Universe, and they deprived you from prosperity and health.

These corrupted souls conducted themselves by violating Universal Laws and Codes left and right. They felt being untouchable and superior, and forgot one very important fact that no one can abuse others without eventual consequences. We all have a free will, and it’s not permitted to violate and force on someone their rules, which are not in compliance with basic right to live freely in the truth.

The Darkness never allowed for the human beings to flourish by being nurtured and happy. They are going to pay dearly for their crimes. Some of them already paid by being captured and put in jail. I personally removed many members from the council and Alliance, who were trying to slowdown and disrupt our progress in assisting Mother Earth during the transition to the Golden Age.

My daughter is going to take my responsibilities of leading the Egyptian Civilization, this is why Anubis built a new fleet, as it will be needed in the near future for different upcoming missions. On Earth she will proceed as the ambassador and overlook globally the construction of Light Centers. These centers are gong to play a key role in the intergalactic communication and interaction between humans and civilizations from the Cosmos. Also, they will provide healing technologies for the Earth inhabitants.

Our plan is only to assist your world, the majority of the load of work will fall on your shoulders. You are going to learn and understand, what it means to build the civilization from scratch and make it prosper and shine with Light and Love. Many of us are going to help and teach you, on how to become an independent and a free society without being controlled and manipulated by the controllers.

The Light always wins against the Darkness. Just trust and have faith that happy times are ahead for all of you. I am Queen An-Ra, and I am going to leave you in Peace and Light.

It was my pleasure to communicate with everyone today, and I am looking forward for more transmissions through this Universal Channel. Thank you.

Create Your Future in the Now.

Queen An-Ra

Channeled by Erena Velazquez

https://voyagesoflight.blogspot.com/2021/06/queen-ra-via-erena-velazquez-june-16.html

From 2018

Want to fight GOP voter suppression and gerrymandering? Elect Democratic secretaries of state

https://www.dailykos.com/stories/2018/8/1/1784650/-Want-to-fight-GOP-voter-suppression-and-gerrymandering-Elect-Democratic-secretaries-of-state

>13933599

hahaha this ones back

>>13933585

yep, that's why the Dem Gov's are lifting restrictions for the summer. So they can all go to the mansions on the lake without breaking their rules.

>>13933354

If not deceased, at least brain dead.

>>13933584

Yea that has been happening for years. Let's starve people and the economy so some worm in the river bottoms are good (probably was a fake narrative to start with).

>>13933597

>antiviral pills for COVID-19

Can anybody believe this? No wonder our Country is going to hell!

https://gab.com/realdonaldtrump/posts/106433887852884913

>>13933595

Not to the Biden family.

>>13933428

10 trillion dollars

>>13933312

nigger's read Heinlein

https://blindhypnosis.com/time-enough-for-love-pdf-robert-a.-heinlein.html

>>13933574

Probably happened in the 60s, 70s & 80s when reggae hit NYC.

one whom q has driven mad.

>>13933599

>>13933572

Yeah I’ve tried that but they come back with look how safe it is, millions of people are getting the shot and no ones having side very bad side effects

I mention vaers and that simply gets dismissed

>>13933587

These - spoilered only because she's always here and while that's a goofy reason I dunno feels like I should.

The Canadian Government are now all of a sudden go after Internet Porn, the Mass Murderer, https://en.wikipedia.org/wiki/Chris_Warkentin has stated he will work to control the Internet so expect them to try and load porn on your system as he is as evil and satanic as they come murdering entire areas to absorb the farmland into his Farm.

>>13933588

>We're talking Anon Bewbs not *.com ones, tho.

Negative anon, you need to implement the word "NEW".

>>13933570

if the stories are to be believed, the cabal/deep state media outlets, such as cnn, msdnc, have lost something like 2/3 of their viewers, so they are losing their control over the normie population

regarding dong, he most certainly is in protective custody, protecting him from ccp, but also from the corrupt intel agencies here in the United States

>>13933597

check it out his vocal fry is mostly gone

weird hearing him 'normal'

>>13933611

one whom still thinks Egyptian slaves actually built the pyramids

>>13933583

HE SPILL HIS COFV!!!!!!!!!!!!!

BAD KITTEH!!!

>>13933569

>>13933597

Fauci has a 100 million a week budget.

How do you even begin to spend that?

Immunity from natural infection would be better, logically.

>>13933613

Negative, these are the last "glow in dark bewbs" with TS…

>>13933403

>>13933417

0=♾

>>13933599

you should speak to our leader, ohh thats right we do not have one, kek

Sep 23 2020

Q&A: Colorado’s Jena Griswold on How to Handle Election Security Threats

The Colorado secretary of state explains how the state is approaching election cybersecurity this year.

https://statetechmagazine.com/article/2020/09/qa-colorados-jena-griswold-how-handle-election-security-threats

>>13933587

Oh, 2 Anon Bewbs ago not the last one - you mean these.

Edit: Someone already posted because file exits error.

why is queen an-ra commenting on fauci's budget?

>>13933462

soon

>>13933624

>>13933626

Seen a lot of leaders in my life, I think going it alone & thinking for myself is a fine thing.

>>13933428

Breeding pedo hillbilly carnie grifting demonics

>>13933615

Wut?

It's always been for amateur Board Anons, Anon.

That's why timestamps matter.

The bizarro world of 'Inside No. 9'

https://twitter.com/nypost/status/1406024491029905414

>>13933597

Giving up on the Vax and going to a HCQ clone pill at c. 1000x times the price of HCQ. Make HCQ illegal, or some such horseshit in the meantime,

These fuckers are just big pharma lobbyists and middle men, disguised as scientists. Surprised Fauci hasn't been doing interviews in a white lab coat.

Now I know what sentiment birthed the, "Hanging's too good", line.

https://www.wnd.com/2021/06/4924508/

Quid pro quo? Biden stops military aid to Ukraine 2 days after Putin summit

'Remember when freezing military aid to Ukraine was an impeachable offense?'

Art Moore By Art Moore

Published June 18, 2021 at 5:30pm

>>13933627

>Q&A: Colorado’s Jena Griswold on How to Handle Election Security Threats

>>13933624

Yeah, that was from the day before Bubbles which threw me off tho prolly shouldn't have.

>>13933628

Line up… [[[you]]] are next

>>13933362

>>13933395

2014

>>13933515

>>13933632

god wins

>>13933628

Yeah >>13933641

I remember, pulled a very late night shift & early morning into day into night again breads. KEEEEEEEEK gud times.

I can’t wait for the slaughter

>>13933647

Night Shift has had some good ones lately.

I prolly jinxed tonight's by saying that but it's true.

>>13933616

>regarding dong, he most certainly is in protective custody,

That's what I'm hoping. MIL intel has him. Would mean, too, theory that Bidan is not CiC is accurate.

>>13933330

The three simple electric charge characteristics as it relates to an antenna specifically a dipole antenna are:

• Charged particles have an electric field at all times

• Charged particles create an magnetic field when moving at a constant speed.

• Charged particles create an electromagnetic field when accelerating or reversing

Half wavelength antennas at resonance have characteristics of a capacitor in that the current leads the voltage by 90 degrees within the antenna. Standing waves of voltage and current occur and each form their own distinct half sine wave over the antenna whereby the current is maximum whenever the voltage is minimum. The ends are voltage loops and the center is the current loop.

When a reversing current interacts with a resonant antenna it allows part of the antenna's collapsing electric field lines of force to be isolated from the antenna and loop on themselves and be propelled away from the antenna by the antenna electric field since the fields repel each other. The newly isolated moving looped electric field lines of force create magnetic lines of force that are in phase and have the same sign of magnitude. In the electromagnetic field the electric and magnetic fields are combined and in phase but 90 degrees apart or perpendicular to each other in space.

The local antenna electric and magnetic fields are called near field which along with properly timed new incoming charges allow for this creation of electromagnetic radiation which becomes the far field. The voltage versus current 90 degree phase relationship in the antenna and new charge timing allow this far field radiation to occur.

In 1926, Nicola Tesla predicted people would one day be able to communicate instantly with one another with devices that fit inside a vest pocket

>>13933549

https://twitter.com/JackPosobiec/status/1406025541556355072

>>13933624

Looks familiar.

>>13933565

deer/headlights

>>13933648

>>13933574

>Patois: Mi nuh like how di screw face man deh look pan mi

>so is this a Caribbean culture that's become part of the afican american culture?

Everyting gwarn be iree

oh wow

i think i found trannimae

>>13933655

>Jack Posobeic

>>13933516

>>>13933486

>>>>>>then jfk frontbutt tranny daniel

>>>>>>and joshua buttgehy

$300 trillion contract written in his own blood

>>13933649

>Night Shift has had some good ones lately.

>I prolly jinxed tonight's by saying that but it's true.

Was thinking same anon & I don't believe in that shit anymore so we gud. Carry on we will make it gud.

>>13933657