Anonymous ID: 447a0d Feb. 20, 2024, 4:08 p.m. No.20448586   🗄️.is 🔗kun   >>8608 >>8649 >>8920 >>9055

>>20448557

Well that sucks bro, just watch the video then and you will see why papaya are turing PCR c-19 tests positive

 

btw this is just 2 of the first non-spike primer sequence I looked into that they possibly use and there might already be a problem..

Anonymous ID: 447a0d Feb. 20, 2024, 4:10 p.m. No.20448598   🗄️.is 🔗kun

>>20448557

They have an entire crew on twitter fucking with antiv c-19 vax peeps and these people don't know much about this video I posted.

 

It would be fucking aweseome to get someoen to actually talk sense

Anonymous ID: 447a0d Feb. 20, 2024, 4:16 p.m. No.20448654   🗄️.is 🔗kun   >>8662 >>8681

TTACAAACATTGGCCGCAAA

GCGCGACATTCCGAAGAA

 

Screenshot attached has some of their other sequences.

 

I have to double-check them I might have mistyped into my computer one given night but they should be horrible.

 

These sequences are for regions other than spike.

 

https://blast.ncbi.nlm.nih.gov/Blast.cgi (site to search when you realize this is a problem to be focused on)