Watch this and you will understand why PCR testing can be a problem., INCLUDING IN DOGS AND PAPAYAS.
Well that sucks bro, just watch the video then and you will see why papaya are turing PCR c-19 tests positive
btw this is just 2 of the first non-spike primer sequence I looked into that they possibly use and there might already be a problem..
They have an entire crew on twitter fucking with antiv c-19 vax peeps and these people don't know much about this video I posted.
It would be fucking aweseome to get someoen to actually talk sense
TTACAAACATTGGCCGCAAA
GCGCGACATTCCGAAGAA
Screenshot attached has some of their other sequences.
I have to double-check them I might have mistyped into my computer one given night but they should be horrible.
These sequences are for regions other than spike.
https://blast.ncbi.nlm.nih.gov/Blast.cgi (site to search when you realize this is a problem to be focused on)
*shouldn't be horrible, I don't expect too many fuck ups in eeeh eeeh fucking letters.