dChan - Q Origins Project Archive

Thank You, Baker.

Anonymous ID: a3e5e3 Feb. 20, 2024, 3:19 p.m. No.20448317 🗄️.is 🔗kun >>8325

>>20448308 (pb)

manipulator agency troll, you might bake the breads but your crap doesn't wash with anon.

Will wokeness ever end? Or is it here to stay 'cause of how the internet works?

I'm re-watching media from the early 2000s and i miss when women were women and it was okay for a woman to be sexy FOR men.

>>20448180 LB

>if humans were genetically modified into existence in the same way that humans genetically modified the Dog into existence…who created the humans and what purposes do humans serve

Don't you see? We did. God does through us.

Recognise the signs of the times.

Anonymous ID: e3de21 Feb. 20, 2024, 3:19 p.m. No.20448320 🗄️.is 🔗kun >>8335

o7

tyb

o7

>>20448304 lb

>https://twitter.com/DanScavino/status/1759933378282033308

>>20448189 lb

She's from Central Casting

/ourgirl/

>>20448317

Why aren't you forgiving me?

TYB

Anonymous ID: a3e5e3 Feb. 20, 2024, 3:22 p.m. No.20448329 🗄️.is 🔗kun >>8337

>>20448325

are you admitting to being a manipulative agency troll?

>>20448261 pb

wrong. it is a private board.

Anonymous ID: 091131 Feb. 20, 2024, 3:22 p.m. No.20448331 🗄️.is 🔗kun >>8343

TYB

>>20448321

>>20448325

You won't do anything VPN.

/filtered

Anonymous ID: 58ddd7 Feb. 20, 2024, 3:22 p.m. No.20448334 🗄️.is 🔗kun >>8561

TYB

>>20448320

gonna have to steal that

Anonymous ID: 903f03 Feb. 20, 2024, 3:23 p.m. No.20448336 🗄️.is 🔗kun >>8341

>>20448330

Then make it Private.

If Anon can post on it, it's not private.

Mark yer shit

Anonymous ID: 2ef6f6 Feb. 20, 2024, 3:23 p.m. No.20448337 🗄️.is 🔗kun >>8353

>>20448329

Check my notes and you decide.

morning katana.

tyb

o7

Anonymous ID: 667c26 Feb. 20, 2024, 3:23 p.m. No.20448339 🗄️.is 🔗kun >>8757

Looking Ahead

America can be as free and prosperous as ever if we stand firm on our principles and hew to what has always made America the greatest nation in the history of the world. There is no holding back freedom and American prosperity if we lean on the principles and pillars outlined in this agenda – such as a strong national defense, free markets, traditional values, the right to life, school choice, patriotic education, border security, free, fair, and reciprocal trade, confronting the Chinese Communist party’s aggressive agenda, – and if we keep faith with our Constitution. Securing these pillars is essential to the survival of freedom. The solution to any problem can be found in strengthening American culture, American opportunity, and American leadership. WE, champions of freedom and the Declaration of Independence, are the last line of defense of the Constitution and our American heritage. For our country and our future, for our children and our grandchildren, we must move forward united and with faith in the One who has ever guided the destiny of our land – move forward to ensure that the best days for the greatest nation on earth are yet to come.

Anonymous ID: 45a5a6 Feb. 20, 2024, 3:23 p.m. No.20448340 🗄️.is 🔗kun >>8771

>>20448336

you are clueless. Private ownership does not mean the public cannot post.

Anonymous ID: 7bf048 Feb. 20, 2024, 3:24 p.m. No.20448343 🗄️.is 🔗kun >>8424

>>20448331

Anonymous ID: 47b43c Feb. 20, 2024, 3:24 p.m. No.20448344 🗄️.is 🔗kun >>8348

Tater landsempty callsignmaybe he gets out without tripping.

excellent look at migrant crisis in NYC

mind blowing - they live in full-service fancy hotels and are paid and provided for, but can't work 7 months after their arrival. they all thank Biden for their circumstance. meanwhile tax-paying Americans continue to struggle and suffer.

Hydrogels in COVID Vaccine as Programmable Human Interface

watch video here https://t.me/gregreesevideoreports/457

Anonymous ID: 24035c Feb. 20, 2024, 3:25 p.m. No.20448348 🗄️.is 🔗kun >>8354

>>20448344

Anonymous ID: 6d54ad Feb. 20, 2024, 3:26 p.m. No.20448349 🗄️.is 🔗kun >>8375

If there's no demand for it, you can keep it closed, and if there's another space, you can post it there, so what's the problem?

rushin butt ID: 9fc25f Feb. 20, 2024, 3:25 p.m. No.20448350 🗄️.is 🔗kun >>8358

@$$wuz$old

>>20448330

>wrong. it is a private board.

Yeah, (((PRIVAT)))!

https://www.bitchute.com/video/kefnCXMJrNTg/

Anonymous ID: a3e5e3 Feb. 20, 2024, 3:26 p.m. No.20448353 🗄️.is 🔗kun >>8361

>>20448337

sorry, I have places to go people to see, and I am bowing out for this bread.

maybe I'll be back later in the evening.

>>20448348

Oy vey!

Anonymous ID: 59dc47 Feb. 20, 2024, 3:26 p.m. No.20448355 🗄️.is 🔗kun >>8780

There are plenty of environments where you can speak freely at all times, so why stick to a particular place?

What is the reason?

Anonymous ID: 0fed43 Feb. 20, 2024, 3:27 p.m. No.20448358 🗄️.is 🔗kun >>8368

>>20448350

wut bout duh child seks slavurs french nazi xinu juw iphones invade

>>20448353

You don't sound very forgiving.

"THE AUTHORITATIVE PERSONALITY" Adorno T. W. (1950)

Read here: https://archive.org/details/dli.ernet.469826/mode/2up

Only 'God's Chosen People' are permitted to have ethnic, religious, racial, social and geographical purity and exclusivity, led by a strong, responsible, loving, patriarchal based, family unit.

For everyone else Equity Diversity and Inclusivity are essential factors in all areas of life with White European Masculinity considered Toxic with a capital T. and must be neutralized.

No more portrayal of 'Masculine White Male Heroes' allowed in your (((their))) media, ask Henry Cavil or any other White Male actor who hasn't been castrated.

Where do all the so called 'Woke' social justice philosophies come from? Certainly not from a grass-roots, fundamental societal (Family) sources.

Anonymous ID: 6d54ad Feb. 20, 2024, 3:28 p.m. No.20448363 🗄️.is 🔗kun >>8382

If there was a reason to stick with it, did you articulate it?

It seems as if you're just complaining.

>>20448321

>>20448345

>>20448347

maybe the vaxxed have been programmed to reckless behavior that will result in death- like driving into buildings and trees, taking street and big Pharma drugs, more vaxx, suicide, murderous rampages, sacrificing of children, chaos, madness

What is Smart Dust?

Smart dust is in the chemtrails. This is why we are seeing a decline in birds and other wildlife. Smart dust has the potential to cause environmental damage. As these sensors are very small and light, they can easily be blown away by wind and end up in rivers or oceans where they are harming wildlife. These are single-use items, and there is no practical way to retrieve them once deployed. Similar to microplastics, smart dust could eventually accumulate in us and the environment and cause irreparable damage.

Smart dust is highly intrusive and poses a threat to privacy. Thousands of virtually invisible sensors collecting data on our movements, conversations, and activities without oversight is a significant cause for concern. Fallen into the wrong hands, the data collected by smart dust will be used for nefarious purposes. I assume it already is.

https://www.bitchute.com/video/PrxgloqkIduY/

Anonymous ID: 47b43c Feb. 20, 2024, 3:29 p.m. No.20448368 🗄️.is 🔗kun >>8374

>>20448358

Kill it with fire!

Anonymous ID: e57533 Feb. 20, 2024, 3:29 p.m. No.20448369 🗄️.is 🔗kun >>8390

>>20448364

Anonymous ID: 31d6f5 Feb. 20, 2024, 3:30 p.m. No.20448370 🗄️.is 🔗kun >>8380

>>20448196 PB

>The Mayor of @CNLV announces the city will discriminate against white business owners.

White people should boycott Black businesses.

Anonymous ID: 65d375 Feb. 20, 2024, 3:30 p.m. No.20448371 🗄️.is 🔗kun >>8377

https://youtu.be/Rqacvc9UJfw

Fani Willis HEATED in Disqualification Hearing & Cries Victim At Church

CartierFamily

901K subscribers

2/20/2024

Anonymous ID: 59dc47 Feb. 20, 2024, 3:31 p.m. No.20448373 🗄️.is 🔗kun >>8383

Anonymous ID: 0fed43 Feb. 20, 2024, 3:31 p.m. No.20448374 🗄️.is 🔗kun >>8387

>>20448368

Anonymous ID: 03e78a Feb. 20, 2024, 3:31 p.m. No.20448375 🗄️.is 🔗kun >>8384

>>20448349

you have the problem.

>This is why we are seeing a decline in birds and other wildlife

Don’t they have seed vaults around the world?

Surely those planners have bird seeds stored.

Anonymous ID: f60158 Feb. 20, 2024, 3:31 p.m. No.20448377 🗄️.is 🔗kun >>8405

>>20448371

OMFG looks like they are finally admitting COVID shots hurt people and are blaming Trump's Warp speed.

You can't make this shit up.

https://www.thegatewaypundit.com/2024/02/judge-engoron-accused-banging-secretary-opposing-counsel-previous/

>>20448370

>White people should boycott Black businesses.

and slay all the filthy Yids ww!

Anonymous ID: 6d54ad Feb. 20, 2024, 3:32 p.m. No.20448381 🗄️.is 🔗kun >>8389

If you are talking about anomalous deletions in QR

Don't.

That's been going on for ages.

It's a new thing now.

I've outgrown this anon.

>>20448363

I am not the one complaining. You are about free speech on a private board. so just fuck off with your free speech nonsense.

>>20448373

>>20448375

You too.

>>20448055 Tucker Carlson says Boris Johnson wants "a million dollars" from him to talk about Ukraine (PN) Why would anyone want BJ back? Would Nigel actually work with BJ, he's a criminal.

10 Dec, 2023 17:21

UK Tories plotting Boris Johnson's comeback – Daily Mail

The ex-British PM is seen by some Tory rebels as being the most formidable opponent to Keir Starmer’s Labour, according to a report

Tory rebels are considering a plan to “crash” UK Prime Minister Rishi Sunak’s Conservative government and reinstall Boris Johnson as leader as concerns rise over flagging poll figures and surging support for the opposition Labour Party ahead of an expected general election next year, according to the Daily Mail.

Amid the high-profile cabinet departures of former Home Secretary Suella Braverman and Immigration Minister Robert Jenrick, Sunak’s authority over Tory ranks is set to be further tested this week when he faces a pivotal vote over his flagship Rwanda migrant-handling plan.

Citing anonymous Conservative MPs, the Daily Mail wrote on Saturday that Tory insiders are urgently attempting to address a growing revolt – with peerages being offered to possible rebels to convince them to toe party lines. The tabloid claims that disgruntled Tories will increasingly seek to “crash” the Sunak government with a series of Commons votes and outspoken interventions, which the newspaper’s sources said is crudely referred to as an ‘Advent calendar of sh*t.’

Furthermore, the outlet cites anonymous sources as saying there is a belief within the party that Johnson – who stood down as prime minister in September 2022 – is the only person who possesses the necessary skills to pose a challenge to Labour leader Keir Starmer.

The newspaper also notes that the Reform Party, thesuccessor to Nigel Farage’s Brexit Party, is siphoning votes that might otherwise have gone to the Conservatives– with a so-called Johnson/Farage “dream ticket” beingfloated. It also notes that Farage’s appearance on a popular UK reality television series has bolstered support for the Brexit architect.

Johnson, who is a columnist for the Daily Mail, did not elaborate on his possible political ambitions when contacted by the newspaper. A spokesperson for Farage, who, like Johnson, is not currently an MP, said that any political alliance between the two would “soon end in tears.”

“Reform are going to kill us,” the newspaper cites an anonymous Tory MP as saying. “We have to buy Farage off. The plan is we get him into the Lords, give him some brief like we did with [David] Cameron – maybe even home secretary– then go to the country with the ‘Dream Team.’”

Another possibility for a post-Sunak scenario, per the Mail, would be for Johnson ally and former Home Secretary Priti Patel to be appointed as temporary PM while Johnson seeks a ‘safe’ seat in the election – after which he would hypothetically return to Downing Street.

Recent polling has indicated that Labour holds a commanding lead over the Tories ahead of the next general election, which must take place before January 2025.

https://www.rt.com/news/588843-uk-boris-johnson-tory-rebels/

STOP ALL FUNDING TO ISRAEL

STOP ALL FUNDING TO UKRAINE

CLOSE THE BORDER

SAVE MAUI FROM WEF GLOBALISTS!

Kill it too!

you tagged wrong anon. Have been responding TO the haters.

>>20448369

Yes Normies

you have AIDs

Not Full Blow AIDs

Just a Little Tiny bit of AIDs

Does Framing it like that make it Better?

Anonymous ID: 08dd54 Feb. 20, 2024, 3:34 p.m. No.20448393 🗄️.is 🔗kun >>8420

Thank you baker…………!

My neighbor is on point.

>>20448391

Filthy fuckwits got brainaids!

>>20448382

Oh, I see.

OK.

Anonymous ID: 9111ce Feb. 20, 2024, 3:35 p.m. No.20448396 🗄️.is 🔗kun >>8410

The jab made people stupid. Moderate thinkers who could still manage critical thinking seem to have gone over to the dark side narrative repetitions after the jabs.

Could the nano particle graphene oxide really have made them antennas to pick up the narratives carried over the wireless airwaves?

seriously? I know that was a theory, but it seems to have borne fruit.

How do we pipe them free thinking again?

Anonymous ID: f41c45 Feb. 20, 2024, 3:35 p.m. No.20448397 🗄️.is 🔗kun >>8400

>>20448385

>>20448397

Filthy fuck is part of the YidWorldOdor!

mother jones already said that Trump can't take credit for Warp Speed. it was all put in place by Obama.

https://jonathanturley.org/2024/02/20/pay-to-play-trump-faces-a-staggering-cost-for-appeal/

Trump supposedly has to come up with hundreds of millions of $ just to get an appeal.

How is that fair?

>>20448382

when is the concept of free speech nonsense?

>>20448389

Huh?

Hate?

I'm looking forward to it, okay?

You see the hate?

Maybe that's projection, huh?

digits and kek

nasty

Good morning, asshole.

Anonymous ID: e9b6c6 Feb. 20, 2024, 3:37 p.m. No.20448410 🗄️.is 🔗kun >>8421

>>20448396

only 3% of the population is Vaccinated

Vaccinated = 8 Shots

97% of the Population isn't Complying

Which is a good sign

Tucker Carlson - Mass Immigration is Destroying the United States and No One is Doing Anything About It… Why Journalists are Afraid

https://rumble.com/v4eofsi-tucker-carlson-mass-migration-is-destroying-america-and-no-one-is-doing-any.html

>>20448402

Straight white man don't love Yids!

Anonymous ID: 65d375 Feb. 20, 2024, 3:38 p.m. No.20448413 🗄️.is 🔗kun >>8417

Dr Ardis says Vitamin C to help prevent cancer fyi

>>20448403

When the Jewish don’t like what you say?

INVADERS AND ILLEGALS GOT NO JABS NO JOBS

WHY ARE THEY HERE AGAIN?

>>20448413

Cedar Leaf Tea

>>20448389

So?

What's up?

Aura fag.

What color is my heart now?

vintage meme

2020

vintage sauce

2018

https://www.forbes.com/sites/bernardmarr/2018/09/16/smart-dust-is-coming-are-you-ready/

Anonymous ID: cdca73 Feb. 20, 2024, 3:39 p.m. No.20448420 🗄️.is 🔗kun >>8433

>>20448393

Changes yours to FBIareFaggots

>>20448410

thanks anon

Keep the fur

TYB

aei

laffin

Anonymous ID: 49200f Feb. 20, 2024, 3:40 p.m. No.20448424 🗄️.is 🔗kun >>8436

>>20448343

To kill the white race, simple!

Anonymous ID: caf1df Feb. 20, 2024, 3:40 p.m. No.20448426 🗄️.is 🔗kun >>8506

The HO2 ticket

KaMOOla and Ikki Nikki!

>>20448391

Anonymous ID: 3bb96a Feb. 20, 2024, 3:40 p.m. No.20448429 🗄️.is 🔗kun >>8469

TYB

There's always time for forgiveness.

rasberries make kenedy jealous >>20448379

Anonymous ID: 5a9a9e Feb. 20, 2024, 3:41 p.m. No.20448432 🗄️.is 🔗kun >>8458

>>20448407

>>20448420

I was thinking CIA or NSA.

Anonymous ID: 6d54ad Feb. 20, 2024, 3:42 p.m. No.20448434 🗄️.is 🔗kun >>8444

Why are you here?

https://twitter.com/WallStreetApes/status/1759948784904126620

AOC Is A Political Actor

Did You Know Alexandria Ocasio-Cortez Was Elected Thanks To A Casting Call Put Out By Democrats?

AOC’s Brother Submitter Her Application & She Was Chosen By The Executive Director of Justice Democrats Out Of 10,000 Candidates

It’s All On Camera. Here’s The Story, Watch To The End To See Footage Of AOC & Alexandra Rojas Confirming This On Camera

“Alexandria Ocasio Cortez is not really the congresswoman of New York's 14th congressional district.She is essentially an actress. She's merely playing the part of a New York congresswoman.I know this sounds crazy, but bear with me. In 2017, a group called the Justice Democrats held auditions for potential congressional candidates that they would run on their platform for various congressional seats throughout the country.

Alexandria Ocasio Cortez's brother Gabriel submitted her for the role. Now I've auditioned for many acting roles in my day. I've also cast many of my own projects. I know how this works. If you find somebody with star power, even if they don't 100% fit the part, you go with it.

Obviously, AOC has star power. Just look at her. She's a superstar, the most famous person in Congress, maybe ever. Their casting was perfect. Now I didn't have to go digging for evidence for this because they freely admit it.

They brag about it.”

Alexandra Rojas Executive Director of Justice Democrats “Back in 2016, we put out a call for nominations. We got over 10,000 nominations. Out of those 10,000 nominations, we found Alexandria.”

Alexandria Ocasio-Cortez “My brother told me that he had sent my nomination in the summer, but I was, like, literally working out of restaurant. It's like, there's no way.”

“- A casting call. They had a casting call. They cast Alexandria Ocasio Cortez in the role of congresswoman.”

Anonymous ID: b70f08 Feb. 20, 2024, 3:42 p.m. No.20448436 🗄️.is 🔗kun >>8573

>>20448424

Anonymous ID: 6b7289 Feb. 20, 2024, 3:43 p.m. No.20448438 🗄️.is 🔗kun >>8448

neither did your mail carrier and that fed comes to your house every day

Anonymous ID: 3afed9 Feb. 20, 2024, 3:43 p.m. No.20448439 🗄️.is 🔗kun >>8536

>>20448401

>Trump can't take credit for Warp Speed

surely such fake narratives were anticipated by PDJT well in advance!

he knew other people would try to take the credit, and he told everyone at CPAC to never let them!

because the Trump Administration is fully responsible for the vaccine, said POTUS at CPAC!

AFTER he left office!

vidrel

23:15 begins vaccine review and credits

https://youtu.be/9kL9KiUNoZQ

Anonymous ID: 6d54ad Feb. 20, 2024, 3:44 p.m. No.20448440 🗄️.is 🔗kun >>8535

>>20448437

I'm glad there are people like you on the Research board.

I feel like I'm still allowed to speak this way.

Anonymous ID: 83b330 Feb. 20, 2024, 3:44 p.m. No.20448441 🗄️.is 🔗kun >>8551

The Record From Recorded Future News

@TheRecord_Media

5h

.@TheJusticeDept has unsealed indictments against two alleged members of the #LockBit ransomware group, Artur Sungatov and Ivan Kondratiev, also known as Bassterlord. The Treasury Department also announced sanctions against them.

Feb 20, 2024 · 6:27 PM UTC

https://twitter.com/TheRecord_Media/status/1760008351906242654

Anonymous ID: f25fa7 Feb. 20, 2024, 3:44 p.m. No.20448444 🗄️.is 🔗kun >>8453

>>20448434

to nail VPN's of the cyber engagement center

/filtered

>>20448366

The social credit system was the driving force behind control over the vaxx and lock downs inside chyna. Now analyse those who complied with vaxx and lockdown measures outside of chyna where no "social credit" app exists (yet) and people still did as thy were told through social manipulation and taking sides with a misguided morals.

>>20448304 LB

Her Snek no good

>>20448438

Cyber engagement center horse shit propaganda

/filtered

Anonymous ID: 21b84f Feb. 20, 2024, 3:46 p.m. No.20448449 🗄️.is 🔗kun >>8454

I would wager

That Cargill

Stole all their land with the new shipping ports on the Amazon and Congo basins

Then they get counted and given an A number

So that they can borrow on their asses

Just like they did you

Anonymous ID: 31d6f5 Feb. 20, 2024, 3:46 p.m. No.20448451 🗄️.is 🔗kun >>8460

>>20448401

Once again, Trump uses himself as bait.

They will only let the truth leak out if they think they can somehow use it to try to dis Trump.

Anonymous ID: 8b47b6 Feb. 20, 2024, 3:46 p.m. No.20448452 🗄️.is 🔗kun >>8461

>>20448364

targeting conservative voters, likely to actually vote

>>20448444

I don't filter. It's a hobby.

I feel like a guy who can't handle the truth.

Anonymous ID: f25fa7 Feb. 20, 2024, 3:47 p.m. No.20448454 🗄️.is 🔗kun >>8462

>>20448449

since you have ttwo posts I think you are paid by BEHAVIOUR MATRIX 120 k a year.

But still you are really just a VPN piece of shit for the cyber engagement center

/filtered

Get ready for the dancing nurses.

cell phones work better, and actually exist

It is playing the "muh censorship" card again

Generally a sign the DOAR faggots are around again

Anonymous ID: f60158 Feb. 20, 2024, 3:47 p.m. No.20448458 🗄️.is 🔗kun >>8498

>>20448398

>>20448432

SHE MAN, 'ta ta tata ta ta taaa'

>>20448402

>How is that fair?

Fairness is a plot device.

>>20448451

exactly…mother jones claimed Ivanka was trying to give her Father all the credit and poor Obama was the real hero

>>20448452

Also, a good way of getting rid of the useless eaters who are using up Medicare and Social Security dollars.

>>20448454

And I think

You need

To spit that dick out

It ain't yours

Anonymous ID: c3bc22 Feb. 20, 2024, 3:48 p.m. No.20448464 🗄️.is 🔗kun >>8473

tyb

>>20448450

Why did so many unusual deletions start?

wrong war reich rasberries

Anonymous ID: f60158 Feb. 20, 2024, 3:49 p.m. No.20448468 🗄️.is 🔗kun >>8475

>>20448463

Anonymous ID: 2ef6f6 Feb. 20, 2024, 3:49 p.m. No.20448469 🗄️.is 🔗kun >>8488

>>20448429

Get lost, guilt trip shill.

Anonymous ID: 3afed9 Feb. 20, 2024, 3:50 p.m. No.20448470 🗄️.is 🔗kun >>8482

>>20448455

notable

Recruitment underway for 'Disease X' Dance Choreographers for 2024 planned pandemic and lockdown

Anonymous ID: a771bf Feb. 20, 2024, 3:49 p.m. No.20448471 🗄️.is 🔗kun >>8496

Unfinished meme any takers….o7

>>20448465

>Why did so many unusual deletions start?

Cause filthy 8Cunt mongrels are Yiddish gatekeeper!

>>20448464

>>20448465

Flint

>>20448468

What english accent is this?

(Video of a mercenary in Avdiivka)

Anon hears two accents, American (calling FUCK, let me get back there for a minute) and Australian (you're OK mate… can you get up, you gonna have to get up)

Anonymous ID: fdd8e4 Feb. 20, 2024, 3:52 p.m. No.20448477 🗄️.is 🔗kun >>8720

>>20447355 pb

Asked this question the other day, didn't get an answer. Cui Bono? Who benefits with the death of Navalny? Putin or Putin's enemies?

>>20448455

Where da sauce?

Anonymous ID: 501cc3 Feb. 20, 2024, 3:52 p.m. No.20448479 🗄️.is 🔗kun >>8502

>>20448385

I'm just going to nix this in the bud. NO, Bojo is not making a comeback in the Conservative party. He is a remnant of the old tory gang. Cameron is also, but is a different fish (or pig) all together. Eyes need to be on him and Samantha.

>>20448455

Link?

>>20448470

Anonymous ID: 99b597 Feb. 20, 2024, 3:53 p.m. No.20448483 🗄️.is 🔗kun >>8504

NUMBER 1 on Radio Jerusalem since 1969.

Holy, has it finally been two weeks?

Or should I check back in a fort night?

Prayer Time Soon

Get ready, it's going to be Biblical

Anonymous ID: 3bb96a Feb. 20, 2024, 3:53 p.m. No.20448488 🗄️.is 🔗kun >>8513

>>20448469

No one is guilting anyone. I forgive you for your projections. You consider forgiveness as weakness when it couldn't be further from the truth. It makes you stronger. God bless you, and thank you for baking.

Wonder who took down Brendon O'connels channel after it was posted earlier?

Pathetic.

We all photograph sawdust, dont we ?

Hunter Biden’s Lawyers Lash Out at Special Counsel, Claim Photos on iPhone Are Sawdust, Not Crack Cocaine

https://www.thegatewaypundit.com/2024/02/hunter-bidens-lawyers-lash-special-counsel-claim-photos/

Hunter Biden’s lawyers lashed out at Special Counsel Dave Weiss and claimed photos on Hunter’s iPhone are sawdust, not crack cocaine.

The Justice Department last Tuesday released photos from Hunter Biden’s iPhone showing his use of cocaine, crack cocaine, and drug paraphernalia.

Last year, Hunter Biden was indicted on federal gun charges. He faced indictment in a Delaware court on three counts relating to his possession of a firearm while using drugs.

These charges include one count of making a false statement in the purchase of a firearm, one count of making a false statement related to information required to be kept by a federal firearms licensed dealer, and one count of possession of a firearm by a person who is an unlawful user of or addicted to a controlled substance.

The Gateway Pundit reported back in October 2020 that his then-lover and deceased brother’s widow, Hallie Biden, tossed the gun in the trash. Hunter admitted this in an online conversation with his family when they accused him of inappropriate conduct in front of a child.

Five years after Hallie Biden discarded his firearm in a trash can behind a Delaware grocery store, the weapon underwent further examination by FBI officials, according to the New York Post.

According to a court filing by Special Counsel David Weiss, FBI agents retrieved the sealed Colt Cobra 38SPL revolver from a state police vault. They photographed the weapon and noticed white powder on the pouch that contained the firearm.

The DOJ released photos from Hunter Biden’s iPhone showing his illicit drug use to prove he was addicted to drugs while he lied about it on a federal firearm form.

Hunter’s lawyers attacked the special counsel in a court filing on Tuesday.

“Mistaking sawdust for cocaine sounds more like a storyline from one of the 1980s Police Academy comedies than what should be expected in a high-profile prosecution by the U.S. Department of Justice,” Hunter Biden’s lawyer said in a court filing.

bizzare parra adumma mortgage late

Anonymous ID: 3958d2 Feb. 20, 2024, 3:54 p.m. No.20448492 🗄️.is 🔗kun >>8672

>>20448403

When it is mentioned by you fuckheads

https://twitter.com/TheRecord_Media/status/1758634152570814736

Anonymous ID: 47b43c Feb. 20, 2024, 3:55 p.m. No.20448495 🗄️.is 🔗kun >>8514

>>20448471

commie marxist socialist globalist terrorist nazi leninist maoist fascist eugenicist pedoist zionist and identity fraud who hold government office are stealing money and putting the blame for war crimes on us when we can't control the US government anymore.

These fucking trans national war criminals have conspired to KILL EVERY AMERICAN.

The SHERIFF PROTECTS THESE MOTHERFUCKERS!!!

https://www.youtube.com/embed/8leaZ7GzjmM

Anonymous ID: 501cc3 Feb. 20, 2024, 3:55 p.m. No.20448498 🗄️.is 🔗kun >>8516

>>20448458

Anonymous ID: 31d6f5 Feb. 20, 2024, 3:56 p.m. No.20448499 🗄️.is 🔗kun >>8507

>>20448463

kek

They thought he was one of them.

That's why they hate him so much because he knows all of their dirty tricks, and is always several steps ahead of them.

‘Don’t touch the kids,’ Putin tells gays

Adults can live and let live, but children are off limits, the president warned

Russia is actually tolerant of people with non-traditional sexual orientations, so long as they don’t target children or flaunt their preferences, President Vladimir Putin said on Tuesday.

The president made the remarks while addressing visitors to the ‘Strong Ideas for a New Time’ forum, a yearly event organized by Russia’s state-backed Agency of Strategic Initiatives.

“We are quite tolerant towards people with non-traditional sexual orientations. We just don’t flaunt it, and we don’t believe it’s right to flaunt it. Let everyone live – the adults – as they want. Nobody limits them in anything,” Putin stated, explaining that, basically, there are only a handful of rules which limit the LGBTQ community in the country.

As for children, I have already said many times: ‘Don’t touch the children.’ That’s it. This is the first one. And the second one is, we are, first and foremost, a state that is guided by traditional values.

Over the past few years, Russia has gradually tightened its legislation aimed at countering the spread of what it calls “LGBT ideology.” The drive began in 2013, when the dissemination of said propaganda was outlawed among minors.

The ban was reinforced in December 2022, when new legislation introduced major fines for anyone found guilty of promoting “non-traditional sexual relations,” pedophilia, and transgenderism among minors and adults alike.

Late last year, the Supreme Court of Russia outlawed the “international LGBT public movement,” designating it as extremist. The ban stemmed from a lawsuit filed by the Russian Justice Ministry, which asked the top court to do so, arguing that the movement has been involved in “incitements of social and religious discord” as well as exhibiting unspecified “extremist traits.”

The extremist designation has been harshly criticized by multiple rights groups in the West, which have argued that it is “absurd” and vague, and that it has had a “catastrophic” effect on the LGBTQ community in Russia. The inclusion of any group in Russia’s “extremist organizations” list effectively bans all of their activities and outlaws all of their associated symbols.

https://www.rt.com/russia/592788-gays-welcome-putin-says/

>>20448479

>pig

Kek

>>20448496

Lmao good one anon…o7

>>20448483

surely you're not tuned to the right frequency

THIS is the number one song, in Jerusalem and throughout the world

Anonymous ID: 312af8 Feb. 20, 2024, 3:57 p.m. No.20448505 🗄️.is 🔗kun >>8739

Wow, just tried to red-pill someone on Trump's goodness by using the whole Trump Sneaker thing. I thought if they actually knew someone who got in on buying the sneakers that they would say “Oh, if it worked for you then there must be something to it.” Nope, nothing. He just kept saying “no one is making money on these sneakers.” I say, “Sure they are look on eBay.” He says, “eBay has all kinds of scams, you won’t receive the sneakers or the money.” Told friend that I was one of a thousand people in America who bought them! I didn't get a congratulations or a raised eyebrow, ZERO curiosity. Not a single question. He just shook his head saying you're going to get ripped off. He's FOOLED you!" Why wouldn't he say “how did you do it? Was it all online, when do you get them, can I see them, what do you mean they are selling for $5,000?” Not a single question, he just said I gotta go. And I said “do you want me to tell you next time this happens?” The answer was “it won't happen again, Trump's trying to rip you off, I gotta go.” He wouldn't accept that the money is not going to Trump and looked upset. I said "Why are you upset, I'm telling you I just won the freakin' lottery?" and he said "You haven't won anything, you are being taken advantage of and I gotta go."

I pray in the name of Jesus that they wake up and see the Light. Strange thing is these are REALLY good, generous, considerate, Jesus loving people, but they are completely blind to the good in what Trump is doing. Keep on praying for these people, please. Don't write them off. They're not all bad, there are still A LOT of good people who are 100% blind to Trump. Do not give up on them, please. Prayer works. Thank you for your prayers, Patriots.

"The Lord is not slow in keeping his promise, as some understand slowness. Instead he is patient with you, not wanting anyone to parish, but everyone to come to repentance." 2 Peter 3:9

>>20448426

>>20448499

>That's why they hate him so much because he knows all of their dirty tricks, and is always several steps ahead of them.

Retard, half of his family are Yids, the other part are Kikes!

Owned by 6 corps

and 272 execs

bla bla bla it's WRONG!

THIS IS FUKING Feb 20, 2024

FCC + BBG are tainted and controlled by the color of laws.

18 USC 1001b

smith mundt modernization act

ndaa

patriot act

aumf

cog

Anonymous ID: 2cda72 Feb. 20, 2024, 3:58 p.m. No.20448509 🗄️.is 🔗kun >>8579

the stage is set

Leader of drug trafficking organization imprisoned for international cocaine distribution scheme

https://www.justice.gov/usao-sdtx/pr/leader-drug-trafficking-organization-imprisoned-international-cocaine-distribution

Anonymous ID: 903f03 Feb. 20, 2024, 3:58 p.m. No.20448511 🗄️.is 🔗kun >>8601

It's not Private.

It's not marked Private

It's not Unlisted

It's Public.

Anonymous ID: 49200f Feb. 20, 2024, 3:58 p.m. No.20448512 🗄️.is 🔗kun >>8543

"Sawdust"

>>20448488

You forgive because you are too weak to get even.

>>20448495

Once all of the non-Jewish White people are gone, the White Jews will stick out like a sore thumb and will be slaughtered in the streets.

They are eliminating their camouflage by getting rid of the non-Jewish Whites.

Did they think this thru all the way?

Watch this and you will understand why PCR testing can be a problem., INCLUDING IN DOGS AND PAPAYAS.

>>20448498

Now then, now then…

Anonymous ID: 6d54ad Feb. 20, 2024, 3:59 p.m. No.20448517 🗄️.is 🔗kun >>8693

>>20448472

>>20448474

If the reasons for deletion or banning were made into a well-written formula, it might reduce the number of deletions.

I'm pretty sure you could state in red text that you were banned or why, right?

Like this person was banned for this reason.

Is that what should do instead of deleting?

It might also eliminate mistakes.

But then would get spam and mold all over the place, wouldn't ?

What should do?

Balance of freedom?

tyb

Anonymous ID: 3afed9 Feb. 20, 2024, 4 p.m. No.20448520 🗄️.is 🔗kun >>8527

TO TAKE YOUR JOB, YOUR HOUSE, YOUR MONEY and YOUR WOMEN

>>20448510

it's DOJ trying to justify existance when they should be deactivate the DOJ and SENT INTO THE US MILITARY FOR THE NEXT WAR THEY START.

So

Sanctions on the countries with a viable currency

Only thing that gets me

They can say this shit with a straight face

Bastards deserve Emmy

>>20448496

TRUMP LIVE ON LAURA INGRAHAM

>>20448520

(whitelisted this anon)

I listened to her speech today and it sounded like a little girl Karen sing songing that she was not quitting…yah,yah,yah, yah, yah!

Wanted to slap the bitch!

Israel has the same Western support as Hitler – Maduro

The president of Venezuela backed the assessment of the Gaza conflict made by his Brazilian counterpart Lula da Silva

Modern Israel enjoys “the same encouragement, the same funding, and the same support” of the collective West like Adolf Hitler’s Nazi Germany before the World War II, Venezuelan President Nicolas Maduro has said.

The president made the remarks on his own TV program With Maduro Plus, backing the assessment of the situation in the Middle East provided recently by his Brazilian counterpart Lula da Silva.

“Powerful family names in the US, Europe and London supported and celebrated Hitler’s arrival to power in 1933. They encouraged him and allowed him to persecute my Jewish ancestors,” Maduro stated. The president made public his Jewish ancestry back in early 2010s, revealing his grandparents were Sephardic Jews who converted to Catholicism.

The Western elites “kept quiet because they were preparing Hitler for him to launch his military power against the Soviet Union,” Maduro explained, stressing that, ultimately, Hitler was “a construct, a monster” created by the collective West.

Modern Israel has turned into the very same thing, the president asserted, urging Jewish people who are still true to their roots to end the ongoing “massacre” of the Palestinians.

“The criminal military apparatus of the State of Israel also has the same encouragement, the same funding, and the same support” of the West, Maduro stressed. “As President Lula da Silva said, the Israeli government is doing the same thing [to the Palestinians] that Hitler did to the Jewish people.”

Brazil’s da Silva delivered the explosive remarks over the weekend, describing Israel’s military action against Hamas militants in Gaza as “genocide” and “slaughter.”

https://www.rt.com/news/592798-israel-hitler-comparison-maduro/

>>20448513

Why not both?

Just because you forgive someone doesn't mean that you alleviate them from justice.

Forgiving them just prevents them from living rent free in your head.

>>20448526

True Story

https://streamfare.com/foxnews

Anonymous ID: 58ddd7 Feb. 20, 2024, 4:02 p.m. No.20448533 🗄️.is 🔗kun >>8534

US and EU are not the only ones suffering an invasion crisis. Australia is quietly right up there and with a population of only 25 mil, will be gobbled up by Muslims in short time.

>>20448533

Anonymous ID: e45293 Feb. 20, 2024, 4:02 p.m. No.20448535 🗄️.is 🔗kun >>8548

>>20448440

kek

Anonymous ID: 3958d2 Feb. 20, 2024, 4:02 p.m. No.20448536 🗄️.is 🔗kun >>8566

>>20448439

That's part of the fun

PDJT says take the vaxx, lefties hate everything PDJT likes, so no vaxx

Lefties steal election, sheeple already scared by MSM, so not only do lefties say "take the vax" but go to mandate the shit or you go to the camps

Now it's time to play the "no, we never wanted the vax, it was all Orange Man" when there's so much video and shit out there proving them liars

Old timey "damned if you do, damned if you don't"

>>20448515

Baker, make this notable

This is knowledge that will demolish the deep state.

So you mean what everyone has known and been saying since he was pimping the Vaxx? Yeah you said they were fedboi shills retard

Transnational Coordinated Terrorism on America is what the fuck is happening and our LOCAL SHERIFF Protects it.

Anonymous ID: 676f0e Feb. 20, 2024, 4:03 p.m. No.20448542 🗄️.is 🔗kun >>8549

LISTEN UP……TRUMP LIVE

>>20448512

Apparently a lot of folks are smoking sawdust.

They sell a shit-ton of that online. They don’t even try and hide it either.

>>20448526

MAGA!

>>20448535

>>20448542

https://usnewson.com/watch/fox-news-live

Anonymous ID: b363d7 Feb. 20, 2024, 4:04 p.m. No.20448550 🗄️.is 🔗kun >>8559

[Fauci]

>>20448441

Big

BIG

BIGLY

Anonymous ID: f25fa7 Feb. 20, 2024, 4:04 p.m. No.20448553 🗄️.is 🔗kun >>8576

3300 sheriffs just got GAZA GENOCIDE TRAINING…

WHAT DO THEY PLAN TO DO NEXT?

US To Hit Moscow With New "Major Sanctions Package" Over Navalny's Death

Russia has already been subject of the most steadily applied US and EU sanctions regimen on earth over the last two years due to the Ukraine war. But in the wake of Alexei Navaly's reported death in a far northern Russian prison, which Western officials are blaming "dictator" President Putin for, Washington is about to roll out with… more sanctions – which it should be noted are "major".

US National Security Council spokesperson John Kirby on Tuesday previewed what he's calling a "major sanctions package" targeting Moscow in response to Navalny's death.

The new sanctions, to be formally unveiled Friday, will "hold Russia accountable for what happened to Mr. Navalny, and quite frankly, for all its actions over the course of this vicious and brutal war that has now raged on for two years."

An course the administration hasn't missed the opportunity to tell House Republicans they must pass Biden's massive $60 billion for Ukraine defense aid bill.

"One of the most powerful things that we can do right now to stand up to Vladimir Putin, of course, is to, again, pass the bipartisan national security supplemental bill and support Ukraine as they continue to fight bravely and assess their country," Kirby continued in his remarks to reporters on a conference call.

The White House is talking about various 'options' in terms of consequences for the Russian opposition activist's death in custody:

In 2021, Biden told reporters that if Navalny died, the consequences for Russia would be “devastating.” Asked directly about that on Friday, the president said his remark was three years ago, and they’ve faced “a hell of a lot of consequences” since then.

Biden directly blamed Russia for Navalny’s death and said: “We’re contemplating what else can be done,” adding, “We’re looking at a whole number of options.”

In Europe, various governments' embassies have been summoning the resident Russian ambassador to condemn Navalny's death and gain answers. Poland was the latest to summon the Russian ambassador Tuesday.

Meanwhile, Navalny's widow, Yulia Navalnaya, has quickly become spokesperson for her husband's cause, having addressed the Munich Security Council over the weekend. While she's relatively unknown, over the past days since her husband's death Western media has been highlighting her words of denunciation aimed at Putin and Moscow. Putin "killed the father of my children," she's told press briefings.

https://www.zerohedge.com/geopolitical/us-hit-moscow-new-major-sanctions-package-over-navalnys-death

>>20448549

TRUMP LIVE

>>20448538

Anon, self-nommed is automatically rejected

Anonymous ID: 3bb96a Feb. 20, 2024, 4:04 p.m. No.20448558 🗄️.is 🔗kun >>8582

>>20448513

I forgive you for your baseless projection without any context or proof. I get even, then I forgive. God bless you.

>>20448531

See what this anon said. Then forgive this Anon for being more spiritually and intellectually ascended than you.

>>20448550

"Well I settled it about three months ago."

–Trump

Anonymous ID: 24eefd Feb. 20, 2024, 4:05 p.m. No.20448561 🗄️.is 🔗kun >>8577

>>20448334

<000_Biblical_Smoke_On_The_Water.MP4

Hunter Biden attorneys say prosecutors mistook sawdust for cocaine in evidence dump

https://twitter.com/nypost/status/1760057741899333778

Anonymous ID: 0fed43 Feb. 20, 2024, 4:05 p.m. No.20448564 🗄️.is 🔗kun >>8579

>>20448536

games without frontiers

war without fears

>That's part of the fun

except humanity dies

including (You)

> Donald Trump and Laura Ingraham

The energy here in Greenville, South Carolina is electric! You can feel the anticipation in the air for tonight’s Town Hall with Donald Trump. Tune in to

@FoxNews

at 7 PM sharp.

6:21 PM · Feb 20, 2024

·

42K

Views

https://twitter.com/IngrahamAngle/status/1760082364858827142

:17

>>20448543

Man

Bimbo Bakeries

Uses up the sawdust

Cellulose ……..

Who owns the smokable….

>>20448563

>>20448549

TRUMP LIVE … Town Hall of Laura Ingraham

>>20448567

>https://twitter.com/IngrahamAngle/status/1760082364858827142

>>20448557

thats not auto true

this anon has an 80% success rate self nomming

1) use sparingly if needed

2) ulmost always appreciated

spam is spam

>>20448436

>>20448563

Hey Hunter!

I gots wots ya needz

Anonymous ID: 3afed9 Feb. 20, 2024, 4:07 p.m. No.20448575 🗄️.is 🔗kun >>8609

clown pushing Navalny story

FILT HERD

>>20448553

I'm hoping they plan on finding you a nice heavy cotton jacket that lets you hug yourself

>>20448561

Correct, anon stolled it and frenamed it for anon convenience.

Anonymous ID: 8b47b6 Feb. 20, 2024, 4:07 p.m. No.20448578 🗄️.is 🔗kun >>8609

glowing

#16 garage door

It was the Israel Sheriff's that protected against the HAMAS Tunnels and Baby raping head cuttin (p[ropaganda/lies) by shooting thru their own people to get them.

Now 3300 American sheriffs just got GAZA GENOCIDE TRAINING…

WHAT DO THEY PLAN TO DO NEXT?

Trumps Daily Attacks Won’t Stop

6:11 PM · Feb 20, 2024

·

13.9K

Views

https://twitter.com/THEUNITEDSPOT_/status/1760079882669945202

>>20448531

Empty words; Justice is the opposite of forgiving.

>>20448558

Empty words; getting even means no forgiveness is required hence why it's called getting even.

Interesting the speech contents…they touch on what to do with the migrant issue…caused by the democratic opposition…the timing is so…with Our.. The Plan.

We are just continuing their plan..script…proofs here that we are so on target…COZY

Has you seen picture of GAZA? why not

Bad doggie comms for the Shift

https://x.com/ktla/status/1760093253418840122

>>20448557

Well that sucks bro, just watch the video then and you will see why papaya are turing PCR c-19 tests positive

btw this is just 2 of the first non-spike primer sequence I looked into that they possibly use and there might already be a problem..

Will America look like GAZA after the Sheriff protects Bidens Multinational Invasion?

>>20448569

sawdust pipe

i have been wrong all along, huh

Anonymous ID: 6d54ad Feb. 20, 2024, 4:09 p.m. No.20448589 🗄️.is 🔗kun >>8617

>>20448472

>>20448474

If the reasons for deletion or banning were made into a well-written formula, it might reduce the number of deletions.

I'm pretty sure you could state in red text that you were banned or why, right?

Like this person was banned for this reason.

Is that what should do instead of deleting?

It might also eliminate mistakes.

But then would get spam and mold all over the place, wouldn't ?

What should do?

Balance of freedom?

If were to state the reason for each and every deletion, we would have to increase the BV.

Well, in other words, are these anons trying to say that there is a problem with the criteria for deleting BOs and BVs here?

That was the point?

Anonymous ID: 1d56f5 Feb. 20, 2024, 4:09 p.m. No.20448590 🗄️.is 🔗kun >>8606

>>20448567

hint of a threat

>>20448582

>Justice is the opposite of forgiving

Just ice

Anonymous ID: f25fa7 Feb. 20, 2024, 4:09 p.m. No.20448592 🗄️.is 🔗kun >>8645

How many of the Sheriffs got the Bio Agent Jabs?

Anonymous ID: 1935e3 Feb. 20, 2024, 4:09 p.m. No.20448593 🗄️.is 🔗kun >>8668

>>20448322

>the ride never ends

o7

rental rasberries

Trump LIVE Faux News TOWN HALL

get in here

FREE WATCHING

https://streamfare.com/foxnews

https://usnewson.com/watch/fox-news-live

>>20448568

Fuck-all. I never knew it did anything. Did you?

>>20448407

>>20448557

They have an entire crew on twitter fucking with antiv c-19 vax peeps and these people don't know much about this video I posted.

It would be fucking aweseome to get someoen to actually talk sense

Anonymous ID: f25fa7 Feb. 20, 2024, 4:10 p.m. No.20448599 🗄️.is 🔗kun >>8610

America is already over.

The SHERIFF did it.

>>20448585

compton

pitbulls code for blacks

>>20448511

you are literally too stupid to continue this conversation.

As long as your against Russia

Biden will forgive your sins

Even a Nazi Sympathizer

meanwhile an American Journalist dies in a Ukraine Jail

Not a Peep

Anonymous ID: 501cc3 Feb. 20, 2024, 4:10 p.m. No.20448603 🗄️.is 🔗kun >>8615

>>20448583

The New Rogan here humanizing a bit the huge mistake of not seeing History repeat itself or the Dangers of Living in the feels of Ignorance is Bliss

>>20448597

Okay, you can stay…

>>20448590

Mosquito drones with micro explosives honing in on the ear buds?

Hot summer indeed.

>>20448586

>sequence

>>20448575

>>20448578

Seriously you shills are retards

How am I glowing for pushing what is happening?

Here is your usual sauces then

Anonymous ID: 0c1f5a Feb. 20, 2024, 4:11 p.m. No.20448610 🗄️.is 🔗kun >>8622

>>20448599

the sheriff is just the last Illusion of just law enforcement to die

my sheriff knelt with BLM, did yours?

Anonymous ID: e45293 Feb. 20, 2024, 4:11 p.m. No.20448611 🗄️.is 🔗kun >>8620

>>20448543

"smoked" salmon

if there's ever a new government, I say one line that could have stopped all this non-violently is a new law and oath….

Old oath wasn't bad but the founders missed the new threats commie marxist socialist globalist terrorist nazi leninist maoist fascist eugenicist pedoist zionist or identity fraud

so help you god

now make the LAW go with it.

>>20448445

THIS

>>20448603

Nailed it

>>20448382

>so just fuck off with your free speech nonsense.

Evening, Arnold.

>>20448589

But this deletion issue is something we've been talking about for a long time.

Maybe I have to change myself after all？

Anonymous ID: 451bf7 Feb. 20, 2024, 4:12 p.m. No.20448618 🗄️.is 🔗kun >>8644

>https://usnewson.com/watch/fox-news-live

>>20448596

Many moons ago

Got some shit

Looked like sawdust

Tasted like fuel oil

And …..shooooooweee

Anonymous ID: 45a5a6 Feb. 20, 2024, 4:12 p.m. No.20448620 🗄️.is 🔗kun >>8627

>>20448611

No. Fucking. Way.!

People are smokin’ fish too?

>>20448610

(whitelisted)

I have no evidence MY sheriff knelt. But I agree with your opinion they knelt to transnational terrorists (and yes I paraphrase you)

link to town hall

Anonymous ID: 5a9a9e Feb. 20, 2024, 4:13 p.m. No.20448624 🗄️.is 🔗kun >>8633

>>20448623

https://streamfare.com/foxnews

>>20448623

>>https://usnewson.com/watch/fox-news-live

nevermind

>>20448538

your dumfukkery is notable

me me me me me my post my post my post

>>20448620

it's crazy

Anonymous ID: 8b47b6 Feb. 20, 2024, 4:13 p.m. No.20448628 🗄️.is 🔗kun >>8659

>>20448609

i was referring to the bereaved widow

who already had a speech written and ready to go two hours after…

but if you identify as a clown, don't let me interfere

>>20448445

cities

>>20448563

was he building something?

>>20448568

>>20448596

shaped like food

flavored like food

never grows mold

>>20448582

Justice is irrelevant to forgiveness. You can get justice with totally getting even then afterwards you're faced with a choice to harbor resentment or otherwise forgive. You forgive to let go of the negativity. You choose not to forgive to maintain the negativity. I can easily get even with with sub par intellect when it comes to these discussions then very incredibly easily forgive you for all of it. You should try it sometime. God bless you.

>>20448624

thanks. sometimes one has to have a backup

not duh first parra adumma

butt wuz tribute

>>20448597

Morlock bikini line. Yup. Didn't expect that one today.

Anonymous ID: 45a5a6 Feb. 20, 2024, 4:14 p.m. No.20448638 🗄️.is 🔗kun >>8643

You guys think Hunter smokes fish?

Joe said he’s pretty smart (I know, consider the source).

>>20448569

Anonymous ID: a674ae Feb. 20, 2024, 4:14 p.m. No.20448640 🗄️.is 🔗kun >>8655

>>20448609

nobody gives a shit about navalny

Anonymous ID: 6d54ad Feb. 20, 2024, 4:14 p.m. No.20448641 🗄️.is 🔗kun >>8754

>>20448617

So you are trying to get me to make the choice to leave by telling me I have to change myself?

Is this Boot Camp for the soul?

Hmmm.

Anonymous ID: 5a9a9e Feb. 20, 2024, 4:14 p.m. No.20448642 🗄️.is 🔗kun >>8651

Anonymous ID: 59dc47 Feb. 20, 2024, 4:15 p.m. No.20448643 🗄️.is 🔗kun >>8650

>>20448638

He's been known to smoke parmesan cheese, so who knows? Anything could happen with a crackhead, especially rich ones.

>>20448618

>GREENVILLE SOUTH CAROLINA

>GREENVILLE SOUTH CAROLINA

Anonymous ID: f88cf8 Feb. 20, 2024, 4:15 p.m. No.20448645 🗄️.is 🔗kun >>8686

>>20448592

called the local cops said at least of the force 17% of the force might be prudent control group.

Anonymous ID: f25fa7 Feb. 20, 2024, 4:15 p.m. No.20448646 🗄️.is 🔗kun >>8663

>>20448631

no that came from Micrographx simply 3d dawg…

>https://usnewson.com/watch/fox-news-live

Thanks anon. Watching…

Notes ~315

#25085 >>20448296

>>20448595, >>20448571 Trump live for Town Hall with Laura Ingraham

>>20448345 Planefag

>>20448362 The Authoritative Personality (1950), Adorno T. W.

>>20448367 What is Smart Dust?

>>20448411 Tucker Carlson - Mass Immigration is Destroying the United States and No One is Doing Anything About It… Why Journalists are Afraid

>>20448443, >>20448493 @TheJusticeDept has unsealed indictments against two alleged Russian members of the #LockBit ransomware group

>>20448490 Hunter Biden’s Lawyers Lash Out at Special Counsel, Claim Photos on iPhone Are Sawdust, Not Crack Cocaine

>>20448510 Leader of drug trafficking organization, Francisco Rene Luna, imprisoned for international cocaine distribution scheme

>>20448515, >>20448586, >>20448608 Understanding PCR

>>20448555 US To Hit Moscow With New "Major Sanctions Package" Over Navalny's Death

>>20448585 Dog comms: 13 pit bulls euthanized after deadly mauling in Compton

#25085

>>20448643

it's meth that he smokes, anon

not crack

>>20448642

Distraction needed, sanctions won't mean much soon

Remember the discussion last year about the death of the petrodollar once it was not a currency of international trade?

Cairo Officially Ditches American Greenback for Trade

February, 17, 2024

TEHRAN (Tasnim) – In a sign of an unfolding BRICS de-dollarization plan, Egypt has officially started ditching the US dollar in trade.

The country was one of five nations to accept an invitation to join the alliance at its 2023 summit.

The BRICS expansion was the first time the alliance grew since 2001 and had massive geopolitical implications. Alongside Egypt, Iran, Saudi Arabia, the United Arab Emirates (UAE), and Ethiopia have joined the bloc. Now, Egypt has already expressed its desire to move away from the greenback in trade.

Egypt has decisively severed its reliance on the US dollar, aligning itself with the BRICS bloc's strategic move towards de-dollarization.

For much of the last year, BRICS made countless headlines for its activities and initiatives. Those actions were defined by its desire to decrease the international prevalence of the US dollar and to grow its ranks. Subsequently, both of those goals coincide with a development that occurred this week.

Indeed, now part of the BRICS alliance, Egypt is set to ditch the US Dollar in its trade activity, watcher. guru reported.

Specifically, the country’s Ministry of Foreign Affairs stated its intention earlier this week. The country assured that it will work to urge countries it trade within national currencies to lessen the burden of the rising cost of utilizing foreign currencies for settlements.

Furthermore, Egypt said that the decision was a result of a global economic shift. As a matter of fact, they noted the “international crises over the past four years,” as a major development in its decision. Subsequently, it is likely the change in trade currency is rooted in similar factors that have pushed the same action in many of the BRICS nations.

https://www.tasnimnews.com/en/news/2024/02/17/3040570/cairo-officially-ditches-american-greenback-for-trade

More sauce:

Egypt Abandons US Dollar for International Trade

Joy Onuorah 4 days ago

https://businesselitesafrica.com/2024/02/16/egypt-abandons-us-dollar-for-international-trade/?v=7516fd43adaa

Egypt starts getting rid of the US Dollar

Osama Ali Published February 16th, 2024 - 07:49 GMT

https://www.albawaba.com/business/egypt-starts-getting-rid-us-dollar-1553378

Egypt Stops Use Of US Dollar For Trade

By Lucy Adautin February 16, 2024

https://www.theheritagetimes.com/egypt-stops-use-of-us-dollar-for-trade/

Anonymous ID: a674ae Feb. 20, 2024, 4:16 p.m. No.20448653 🗄️.is 🔗kun >>8664

>>20448632

you are forgiving so many anons in your latest psyop slide you must be about to run out

how about you forgive yourself just before you neck yourself?

post livestream when you kys

TTACAAACATTGGCCGCAAA

GCGCGACATTCCGAAGAA

Screenshot attached has some of their other sequences.

I have to double-check them I might have mistyped into my computer one given night but they should be horrible.

These sequences are for regions other than spike.

https://blast.ncbi.nlm.nih.gov/Blast.cgi (site to search when you realize this is a problem to be focused on)

>>20448640

naval a ny, under radar.

Anonymous ID: 451bf7 Feb. 20, 2024, 4:17 p.m. No.20448656 🗄️.is 🔗kun >>8687

https://twitter.com/simonateba/status/1760030827935633577

BREAKING: President Biden just successfully boarded Air Force One after nearly tripping twice. In the end, the 81-year-old President made it safely to the finish line. CONGRATULATIONS Mr. President. WATCH

Anonymous ID: 21b84f Feb. 20, 2024, 4:17 p.m. No.20448658 🗄️.is 🔗kun >>8676

>>20448631

Don't Twinkies

Come with

A warranty……18 to life….

Anonymous ID: 8b47b6 Feb. 20, 2024, 4:17 p.m. No.20448659 🗄️.is 🔗kun >>8723

>>20448609

>>20448628

you could wait for the autopsy

before you dispute the autopsy

Occam's Razor could be of help too:

why publicize an execution?

why do it less than a month before elections?

and

how many Americans even know who Navalny is?

this tempest is not organic, and is being pushed hard by the family that smokes sawdust

>>20448650

I don't care enough and the difference to even acknowledge the difference.

>>20448654

*shouldn't be horrible, I don't expect too many fuck ups in eeeh eeeh fucking letters.

>>20448646

copyright shit ya know

can not photograph offending foods

food disparagement laws

you can find 39% roadkill or euthanized pets in the meat

and

it may be 100% true

but if you SAY IT

you will be sued for "food disparagement"

Anonymous ID: 3bb96a Feb. 20, 2024, 4:18 p.m. No.20448664 🗄️.is 🔗kun >>8671

>>20448653

Completely and utterly 100% forgiven for your obvious violence shilling as a fed. God bless you.

https://usnewson.com/watch/fox-news-live

Trump!

>>20448661 (edit)

>and the

between the

>>20448322

>>20448593

this vid actually

it has most all

of the ride never ends gifs in it

Anonymous ID: 3afed9 Feb. 20, 2024, 4:18 p.m. No.20448669 🗄️.is 🔗kun >>8683

>>20448661

if you don't care about looking stupid, by all means carry on in your ignorance

Witch hunt

>>20448664

seriously,kys

Anonymous ID: d5467b Feb. 20, 2024, 4:18 p.m. No.20448672 🗄️.is 🔗kun >>8688

>>20448492

>everyone I don't like is OSS

Everybody drink!

Anonymous ID: 7b9427 Feb. 20, 2024, 4:19 p.m. No.20448674 🗄️.is 🔗kun >>8690

>>20448566

Anonymous ID: 2ef6f6 Feb. 20, 2024, 4:19 p.m. No.20448675 🗄️.is 🔗kun >>8689

>>20448632

>Justice is irrelevant to forgiveness

…

They are polar opposites. Forgiveness is only possible if you have a bad memory.

Anonymous ID: 58ddd7 Feb. 20, 2024, 4:19 p.m. No.20448676 🗄️.is 🔗kun >>8711

>>20448658

Twinkies is what anon finds in his pants after riding motorbike at 200 mph.

https://thehighwire.com/news/ny-bill-would-allow-children-to-consent-to-medical-procedures/

NY BILL WOULD ALLOW CHILDREN TO CONSENT TO MEDICAL PROCEDURES

The documentary delves into the complex and often controversial topic of the depiction of violence by Yahweh, the God of the Bible, and its implications for those seeking moral guidance from the sacred text. Featuring insights from Dr. Joshua Bowen and other preeminent scholars, it meticulously examines the instances where divine commands and actions in the Bible are fraught with violence, raising serious ethical and theological questions. The documentary highlights the lengths to which believers might go to reconcile these narratives with a moral framework, including employing hyperbole or finding justifications for divine decrees that appear morally questionable by contemporary standards. This exploration sheds light on the profound challenges and dilemmas faced by individuals trying to align their faith with modern ethical principles, illustrating the complexities of interpreting ancient religious texts in a modern context.

https://youtu.be/RO_EuhPDdBg

Anonymous ID: 7ac3ba Feb. 20, 2024, 4:20 p.m. No.20448679 🗄️.is 🔗kun >>8751

MIGRANT CRIME!

Oh, I'm sorry. I wouldn't want to offend someone by calling them a crackhead when they're a methhead, or vice versa. Who's the idiot now, fuckface? In the filter. Like I said, I don't care enough between the difference to acknowledge the difference. It's a self-destructive hole with those two.

America is the most corrupted country on the planet worse that Israel.

Anonymous ID: 7b9427 Feb. 20, 2024, 4:20 p.m. No.20448685 🗄️.is 🔗kun >>8710

Anonymous ID: f25fa7 Feb. 20, 2024, 4:21 p.m. No.20448686 🗄️.is 🔗kun >>8704

>>20448645

I hear the .mil is worse.

in 2024 when I say Military I have to wonder if they are Illegals, or Mavni or actual foreign attack on us soil, just what the fuck they are.

>>20448656

>>20448672

This is a post with Punch/Spice.

Blabo.

>>20448675

No that's forgetting. One can forgive while remembering.

>>20448674

Israel corrupted America numb nuts

>>20448517

If the reasons for filtering or filtering were made into a well-written formula, it might reduce the number of filterings.

I'm pretty sure you could state in red text that you were filtered or why, right?

Like this person was filtered for this reason.

Is that what should do instead of filtering?

It might also eliminate mistakes.

But then would get spam and mold all over the place, wouldn't ?

What should do?

Balance of freedom?

Or simply scroll on by?

Anonymous ID: 45a5a6 Feb. 20, 2024, 4:22 p.m. No.20448694 🗄️.is 🔗kun >>8737

All the merchants waxed rich from her.

Anonymous ID: 5a9a9e Feb. 20, 2024, 4:22 p.m. No.20448695 🗄️.is 🔗kun >>8727

>>20448690

Anonymous ID: 17020f Feb. 20, 2024, 4:22 p.m. No.20448696 🗄️.is 🔗kun >>8738

>https://streamfare.com/foxnews

Thank you Fren!!

>>20448650

crack

coc and crack

>>20448330

you fuckhead….QR is public facing,anyone can post here

finish 3rd grade before posting here you ignoramus

calling a baldwin a faggot is a insult to french nazi xinu juw iphone invades

>>20448689

Same thing.

can't tell you a 1000 years ago.

Laura keeps interrupting him.

Did she take lessons from Hannity?

Anonymous ID: 3bb96a Feb. 20, 2024, 4:23 p.m. No.20448703 🗄️.is 🔗kun >>8836

>>20448689

Forgive the angry baker. He's only human. He doesn't get the point being conveyed. Maybe some day.

o7

>>20448686

cops are muh neighbors moar good than bad

was just watching the Trump interview on ustvgo fox news and the blocked it. 403 forbidden.

>>20448693

Sorry if that didn't come across well.

Triangle what ¿????

Anonymous ID: 152579 Feb. 20, 2024, 4:23 p.m. No.20448708 🗄️.is 🔗kun >>8731

>>20448668

Cool

Anonymous ID: 17020f Feb. 20, 2024, 4:24 p.m. No.20448710 🗄️.is 🔗kun >>8737

>>20448685

Anonymous ID: 75e8da Feb. 20, 2024, 4:24 p.m. No.20448711 🗄️.is 🔗kun >>8729

>>20448676

they are fermented? for a long time

not cooked or baked forget

Can a super nice anon post POTUS in SC on FOX here so all we haf to do is push the arrow? Please and TY!

Laura Ingraham needs a bitch slapping if she keeps interrupting Trump..

Anonymous ID: 8a7819 Feb. 20, 2024, 4:24 p.m. No.20448714 🗄️.is 🔗kun >>8742

>>20448690

>>20448362

Adorno is "Frankfurt" scholl

Tavistock

Study of Marxism.

Home of "Critical Theory"

https://en.wikipedia.org/wiki/Frankfurt_School

Adorno is said to have written all the songs of the Beatles

Social Engineering project by Marxist and neo-Marxists

Anonymous ID: 2604ae Feb. 20, 2024, 4:24 p.m. No.20448716 🗄️.is 🔗kun >>8728

Can a super nice anon post POTUS in SC on FOX here so all we haf to do is push the arrow? Please and TY!

true

Very frustrating!!

Let him speak!!

Anonymous ID: 45a5a6 Feb. 20, 2024, 4:25 p.m. No.20448719 🗄️.is 🔗kun >>8749

>>20448704

You live next door to a stash house?

That’s messed up.

Anonymous ID: 24eefd Feb. 20, 2024, 4:25 p.m. No.20448720 🗄️.is 🔗kun >>8733

>>20448477

checked

>Who benefits with the death of Navalny?

The ©lowns

See Maui is all Fixed. RIGHT?

Laura interrupts everybody just like Hannity.

>>20448659

I thoroughly agree anon

Doug Sahm and Band Dealer's Blues

thanks!

See here, fren anon posted it…

>>20448711

Landing a plane on ice will make your ass pucker so tight you don't have that problem

>>20448693

I've tried to think of a good way to solve some kind of anomalous deletion problem.

Well, but it's been going on for so long that I'm tired of it.

>>20448708

Anon I found this on half chan and they all said it is..

Anonymous ID: f25fa7 Feb. 20, 2024, 4:27 p.m. No.20448732 🗄️.is 🔗kun >>8749

>>20448704

well how ever good they are .

They still protect WAR CRIMINALS

>>20448720

>The ©lowns

Oops

*NOT the ©lowns

Reading from a Card

Get a vet up there

Vet's don't read cue cards

TY, baker.

notable

Anonymous ID: 75e8da Feb. 20, 2024, 4:27 p.m. No.20448738 🗄️.is 🔗kun >>8785

>>20448696

covfefe later

>>20448505

Its truly bad out there in this regard. We seem to be at 'awakened saturation' point. I'm hoping we get an 'I told you so' moment in the near future to break the bottleneck.

The United States is already done and finished. You dumfucking tards just don’t realize it yet and it’s ALL YOUR FAULT. USLESS CUNTS

local fox but at least the ingraham show should show up later tonight.

>>20448714

I mean if she didn't have that nasally annoying voice it wouldn't be so bad but it's like a knife in anon's brain that takes the focus off anything Trump is saying.

Anonymous ID: e9b6c6 Feb. 20, 2024, 4:29 p.m. No.20448745 🗄️.is 🔗kun >>8762

In an Information War

Comms are Vital for Victory

Comms & the Truth

Then you have to tell them exactly what you want them to do.

rushin butt ID: 385d14 Feb. 20, 2024, 4:29 p.m. No.20448748 🗄️.is 🔗kun >>8794

divorced butt stuff available

Anonymous ID: f88cf8 Feb. 20, 2024, 4:29 p.m. No.20448749 🗄️.is 🔗kun >>8794

>>20448732

blunt force

>>20448719

the court ball. noice bums.

from Bannon the Bloviator

>>20448679

Anonymous ID: af132c Feb. 20, 2024, 4:30 p.m. No.20448752 🗄️.is 🔗kun >>8783

they get away with all of it because it's a world wide pyramid scheme and they at the top are too big to fail. follow the money. they don't care. to fight the system is suicide [for you] while they live on eternal

Dis and Mis, a little difference!

Kek!

>>20448617

>>20448641

The "deletion issue" has been a favorite of the shills and schizos trying to throw shade on the BO and BVs

halfmind, VD, last-fag-standing whine about deletion frequently

Behold:

General Research #23139 >>18851346

Not going to work anymore. The cycles are becoming clearer. Gore and cp to test the defenses, then cycle through tons of muh joo, then racist/white supremacy, then some slide like "RRN is legit" and then when the garbage gets tossed, scream "muh censorship"

Bitch about BO and BVs and the truly retarded among you bitch about bakers deleting stuff all you want, not going to work, not going to change anything.

The Fuckitol has taken effect. The continuous bombardment of all the playbook shit has finally done the same thing as the pussyhats screaming nazi, or racist. Overused to the point of uselessness. Game Over shill bois. You have induced "Fuckwad Fatigue" and become nothing but noise to be easily tuned out. Like a dog with fireworks, every now and then, flash and bang and Fido cowers. But this was Fourth of July Finale shit basically 24/7 for six years. You turned Fido into a Cavalry Horse, the shit simply no longer matters. It's "oh, this shit again" and every angle is known.

>20448731

>>20448339

>WE, champions of freedom and the Declaration of Independence, are the last line of defense of the Constitution and our American heritage

Excellent discourse.

None of the sanctions worked before, Bidan is just making Putin and Russia stronger

>>20448731

God help us

These people are sick evil

My sheriff is a good sheriff. bla bla bla.

Ya sure about that? Have you TESTED the theory lately?

I thought the same thing.

Do yourself a favor, TEST.

Remember See something say something.

well they seem to want to fuck the people REPORTING THINGS UP.

Yes tell us the GPS coordinates of your house Sir or Mam so we can send the 2K LB bom I mean Help..

>>20448745

If that COMMUNICATION is a honey trap…

appears the image server has shit the bed

Anonymous ID: 17020f Feb. 20, 2024, 4:32 p.m. No.20448766 🗄️.is 🔗kun >>8783

True, the old corporation is done!

Anonymous ID: 152579 Feb. 20, 2024, 4:32 p.m. No.20448767 🗄️.is 🔗kun >>8783

why did all the images turn into Join or 404?

Hannity in a dress!

Thank You Anon!

I thought that was just my end

Anonymous ID: e3f7cc Feb. 20, 2024, 4:32 p.m. No.20448771 🗄️.is 🔗kun >>8805

>>20448340

turns out you actually CAN grow a pair

President Trump you look marvelous

>>20448731

Gen. 6:2 that the sons of God saw that the daughters of men were beautiful; and they took wives for themselves, whomever they chose.

Anonymous ID: f25fa7 Feb. 20, 2024, 4:33 p.m. No.20448775 🗄️.is 🔗kun >>8792

Voting is DANGEROUS because there are SECRET INDIVIDUAL CODE MARKINGS ON YOUR BALLOT THAT MATCH YOU. WHO EVER CONTROLS THIS METADATA COULD FEED IT TO MOLFAR AND HAVE YOU ELIMINATED OFF PLANET EARTH.

THIS IS WHY TRANSPARENCY IS IMPORTANT

THIS IS WHY THE SECRETARY OF STATE OF CALIFORNIA IS THE MOST DANGEROUS PERSON IN THE UNITED STATES

well hell!

https://rumble.com/v4el4p9-young-black-man-schools-old-black-man-on-how-to-do-for-self.html

https://rumble.com/embed/v4bzuv6/?pub=9ikqh

I can't get a rumble vid to embed to save my life….

tyb

Anonymous ID: 8a7819 Feb. 20, 2024, 4:33 p.m. No.20448779 🗄️.is 🔗kun >>8790

who offended the image server

>>20448355

but not a name fag

Anonymous ID: 7f033a Feb. 20, 2024, 4:34 p.m. No.20448781 🗄️.is 🔗kun >>8796

>https://streamfare.com/foxnews

I love Trump. He won't answer her stupid questions and give her the soundbites she wants

and right after i went ahead and converted a bunch of fresh gifs

fuck man

heres an embed then👍

the ride truly never ends

Anonymous ID: f88cf8 Feb. 20, 2024, 4:34 p.m. No.20448783 🗄️.is 🔗kun >>8793

rewind the clock manually 2 days. certificate.

>>20448738

You're on Fren!

Anonymous ID: 0fed43 Feb. 20, 2024, 4:34 p.m. No.20448786 🗄️.is 🔗kun >>8791

>>20448754

Respect for coming right out.(Respect for fast work)

Is this a problem that can be solved by changing the BO?

If so, who would you nominate?

You?

>>20448779

I am thinking that Hunter Biden photo did

Anonymous ID: 189b16 Feb. 20, 2024, 4:35 p.m. No.20448791 🗄️.is 🔗kun >>8808

>>20448786

would those kicks fit inside a scooter?

>>20448775

Somebody might have had a bit too much LDS

Anonymous ID: 3afed9 Feb. 20, 2024, 4:35 p.m. No.20448793 🗄️.is 🔗kun >>8823

>>20448783

>certificate.

this post and the subject matter reflect the incompetence of the 8kun administration.

Anonymous ID: c804bb Feb. 20, 2024, 4:35 p.m. No.20448794 🗄️.is 🔗kun >>8823

>>20448749

>>20448748

Anonymous ID: 597e91 Feb. 20, 2024, 4:35 p.m. No.20448795 🗄️.is 🔗kun >>8806

Image server Borked?

>>20448781

Her low IQ is showing, let her know.

Anonymous ID: 99b597 Feb. 20, 2024, 4:35 p.m. No.20448798 🗄️.is 🔗kun >>8870

>>20448583

Notice his numerous recorded speeches, both audio and film, are never, never translated or subtitled to English, or other languages for that matter, on the History Channel or other Western Programming, to hear first-hand what is being said.

Only ever snippets of those sentences that serve to propagandize and indoctrinate the audience are permitted.

It was always going to be 'Six Million'. New York Times Friday October 18, 1918 Page 12.

>>20448782

👍🏻

Anonymous ID: 45a9b5 Feb. 20, 2024, 4:36 p.m. No.20448800 🗄️.is 🔗kun >>8824

>>20448782

ok then,,,… youtube perhaps for one that always works

kekkitty

>>20448754

Found the free speech hating communist censorship fag

Anonymous ID: f25fa7 Feb. 20, 2024, 4:36 p.m. No.20448802 🗄️.is 🔗kun >>8840

>>20448792

so you are the first of the Cyber Engagement Center VPN to get filtered it is then.

/filtered with predjuce

q research is a battle cry

do not go gently into that good night

biggest fundraiser in SC for Trump, $6.5 million. Bannon: "Trump's Representing The American People, He's Putting You First"

Birdbrain will hang on forever.

7:31

https://rumble.com/embed/v4c303r/?pub=4

>>20448771

That’s incredible on moar than one level!

>>20448795

seems so

>>20448797

shit's gettin' real out there folks

>>20448791

Can you see it?

Anonymous ID: 5a9a9e Feb. 20, 2024, 4:37 p.m. No.20448809 🗄️.is 🔗kun >>8851

>>20448803

>>20448797

Kek

Laura ingraham

adopted children

supports anti weed legislation

works for the man

overpaid shill

>>20448788

>Is this a problem that can be solved by changing the BO?

Didn't you try that same shit about three months ago?

Seems like a familiar stench

Anonymous ID: 189b16 Feb. 20, 2024, 4:38 p.m. No.20448813 🗄️.is 🔗kun >>8828

>>20448808

a special "mark" by Nguyen at the factory?

Anonymous ID: 3afed9 Feb. 20, 2024, 4:38 p.m. No.20448814 🗄️.is 🔗kun >>8828

>>20448808

is that your taint?

.>>20448779

>who offended the image server

https://twitter.com/rawsalerts/status/1760086751484219554

🚨#BREAKING: Confirmed Explosion at a shopping center lockdowns and evacuation in place

📌#Tustin | #California

Currently, numerous law enforcement officers, including the Bomb Squad, are on the scene. As Officials have confirmed that there was an explosion in the Tustin Legacy shopping center or near the Bank of America in Tustin, California. Evacuations and lockdowns are in place, and the FBI is involved as the loud boom could be heard from miles away. It is not immediately known if anyone was hurt this is still developing

Be groovy

Anonymous ID: 45a5a6 Feb. 20, 2024, 4:39 p.m. No.20448818 🗄️.is 🔗kun >>8851

>>20448792

Anonymous ID: 6fe189 Feb. 20, 2024, 4:39 p.m. No.20448819 🗄️.is 🔗kun >>8851

hunter biden photo that was dropped fucked shit up my guess. Do not see people talking about on pol as stated and appeard to be choke fucking natalie at least that was what I think was implied.

Will show the face and Name of a man that is suspected of killing a child

Won't show the face of the men that fired into a crowd at a parade

So weird

The two youts

803 post Q

which is better rumble or youtube for embeds

>>20448808

Anonymous ID: d5467b Feb. 20, 2024, 4:39 p.m. No.20448826 🗄️.is 🔗kun >>8832

Dammit Jim

Potusonkillimageserver.jpg

Anonymous ID: 0fed43 Feb. 20, 2024, 4:40 p.m. No.20448828 🗄️.is 🔗kun >>8912

>>20448813

>>20448814

You two are very special.

>>20448801

it's the last phase of the QR larp

Laura askin' some good Q's

Anonymous ID: e45293 Feb. 20, 2024, 4:40 p.m. No.20448831 🗄️.is 🔗kun >>8848

Fuck that guy

>>20448826

INDEED!

POTUS quotes the 8th amendment

TRUMP JUST READ THE 8TH AMENDMENT!!

was that you Hunter Biden? fucking and filming your niece? who films, daddy Biden?

>>20448703

>He doesn't get the point being conveyed

Condescending guilt trip shill. I see beyond your comprehension.

>>20448834

>>20448833

We're going all the way to SCOTUS

>>20448835

>who films

this^^^

>>20448802

Being filtered by you would make me ever so happy

Anonymous ID: 0c538d Feb. 20, 2024, 4:42 p.m. No.20448841 🗄️.is 🔗kun >>8865

>>20448835

dr jill?

https://usnewson.com/watch/fox-news-live

MAGA

We can do it!

What the hell did somebody have to image server or what's going on

>>20448804

The Allies are freaking out according to Coons because the US wants them to pay their fair share. We are sick if it. The US had very few allies in WWII. They are a protectorate, they are not our allies they sucking off US since WWII. EU caused Ukraine and want us to fund all if it. We will not budge on Ukraine, you broker it, you fix it!

>>20448812

Huh?

What the hell?

I'm just talking about improving the problem.

I just talked to him when was screaming？

Anonymous ID: 17020f Feb. 20, 2024, 4:43 p.m. No.20448847 🗄️.is 🔗kun >>8881

"I'm done" - Ingraham

Trump - I can't!!

Ingraham, you're so stupid!!!

Anonymous ID: ed5760 Feb. 20, 2024, 4:43 p.m. No.20448848 🗄️.is 🔗kun >>8854

>>20448831

>zero accountability

Anonymous ID: e9b6c6 Feb. 20, 2024, 4:43 p.m. No.20448849 🗄️.is 🔗kun >>8858

These are Sick People

Laura Interuptus.

this irregular place

It's a game they're playing. Dave Weiss arrests a long time FBI human source and the source confessed that the $10 million that Hunter and his dad ordered the Burisma owner story was given to him by Russian intel operators and then the Bidens do this make it look like Weiss is working against them.

>>20448812

What the hell?

Go on.

Anonymous ID: e45293 Feb. 20, 2024, 4:43 p.m. No.20448854 🗄️.is 🔗kun >>8867

>>20448848

_████████__██████

___█░░░░░░░░██_██░░░░░░█

__█░░░░░░░░░░░█░░░░░░░░░█

_█░░░░░░░███░░░█░░░░░░░░░█

_█░░░░███░░░███░█░░░████░█

______█░░░██░░░░░░░░███░██░░░░██

_____█░░░░░░░░░░░░░░░░░█░░░░░░░░███

____█░░░░░░░░░░░░░██████░░░░░████░░█

____█░░░░░░░░░█████░░░████░░██░░██░░█

___██░░░░░░░███░░░░░░░░░░█░░░░░░░░███

__█░░░░░░░░░░░░░░█████████░░█████████

█░░░░░░░░░░██████████████████_█

█░░░░░░░░░░█______█████_____█████

█░░░░░░░░░░░░█████████__██_██████

░░░░░░░░░░░░░█████████░░░████████░░░█

░░░░░░░░░░░░░░░░█░░░░░█░░░░░░░░░░░░█

░░░░░░░░░░░░░░░░░░░░██░░░░█░░░░░░██

░░░░░░░░░░░░░░░░░░██░░░░░░░███████

░░░░░░░░░░░░░░░░██░░░░░░░░░░█░░░░░█

░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░█

░░░░░░░░░░░█████████░░░░░░░░░░░░░░██

░░░░░░░░░░█▒▒▒▒▒▒▒▒███████████████▒▒█

░░░░░░░░░█▒▒███████▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒█

░░░░░░░░░█▒▒▒▒▒▒▒▒▒█████████████████

░░░░░░░░░░████████▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒█

░░░░░░░░░░░░░░░░░░██████████████████

░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░█

██░░░░░░░░░░░░░░░░░░░░░░░░░░░██

▓██░░░░░░░░░░░░░░░░░░░░░░░░██

▓▓▓███░░░░░░░░░░░░░░░░░░░░█

▓▓▓▓▓▓███░░░░░░░░░░░░░░░██

▓▓▓▓▓▓▓▓▓███████████████▓▓█

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓██

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓█

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓█

>>20448844

double dubs fren…[they're] in a bigPANIC!

Is she wearing an earpiece?

Anonymous ID: 6d54ad Feb. 20, 2024, 4:44 p.m. No.20448858 🗄️.is 🔗kun >>8868

>>20448849

You too.

Seems 128ducks forgot to renew their certificate.

>>20448844

chkt

▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒╢╣╣╣╣╣╣╢╣╣╢▓▓▓████████████████████████▓▓▒▒▒▒▒▒▒▒▒▒▒░░░░░░░░░░░░░░

▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒╢╣╢╢╢▒▒▓██████████████████████████████████▓▓╣▒▒▒▒▒▒▒░░░░░░░░░░░░░

▒▒▒▒▒▒▒▒▒▒▒▒▒▒╢╢╢▒▓██████████████████████████████████████████▓▒▒▒▒░░░░░░░░░░░░░░

▒▒▒▒▒▒▒▒▒▒▒▒╢╢╢▓███████████████████████████████████████████████▓▓╢▒░░░░░░░░░░░░░

▒▒▒▒▒▒▒▒▒╢╢╫▓████████████████████████████████████████████████████▓╣▒░░░░░░░░░░░░

▒▒▒▒▒▒╢╣╢╣▓████████████████████████████████████████████████████████▓▒▒░░░░░░░░░░

▒▒╣▒▒╢╢╢╣████████████████████████████████████████████████████████████▒▒▒░░░░░░░░

▒╣╣╢╢╢╢▓█████████████████████████████▓▓▓▓▓▓▓▓▓▓▓▓▓████████████████████╣▒▒░░░░░░░

╢╢╢╢╢╢▓███████████████████████▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓█████████████╣▒▒░░░░░░

╢╢╢╢╫▓████████████████████▓▓▓▓▓▓▓▓▓▓▓╣╣╣╣╬╣╢╢╢╢╣╣╢╢╣╣▒╢╢╢╢▓▓▓▓██████████▒▒▒▒░░░░

╢╢╣╢▓▓█████████████████▓▓▓▓▓▓▓▓▓▓▓▓▓╣╬╬╬╣╣╣╢╣╢╢╢╢╢╢╢╣╢▒▒╢╢╢╢╢╢╢▓▓████████▓▒▒░░░░

╣╢╢▓▓███████████████▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓╣╣╣╣╣╢╢╢╢╢╢╢╣╣╣╢▒▒▒╢╢╢╢╢╢╢╫╣╢▓▓███████@▒▒░░░

╢╢╣▓▓███████████████▓▓▓▓▓▓▓▓▓▓▓▓▓▓╣╣╢╢╣▒▒▒▒╢╢╢╣╣╣╢▒▒▒▒▒▒╢╢▒▒▒╢╢╢╢▓▓▓███████╣░▒░░

╢╢╢▓▓██████████████▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓╬╣╢╣╢╢╢╢╢╢╢▒▒▒▒▒▒▒▒▒▒▒▒▒▒╢╫╬▓▓▓██████▌▒░░░

╢╢▓▓▓█████████████▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓╣╢╢▒▒▒▒▒╢╢╢▒▒▒▒▒▒▒▒▒▒▒▒▒╢╢╢╫╣╣╬╣╢╢▓▓█████▌╣░░░

╫▓▓▓▓███████████▓▓▓▓▓▓▓▓▓▓▓▓▓▓█████████▓▓╣╢╣▒╢╣▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒╢╢▓▓█████╢▒░░

▓▓▓▓▓██████████▓▓▓▓▓▓▓╫▓▓▓▓▓▒▒▒▒▀▀▓█▓▓▓▓▓▓▓▓▒▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓▓▓▒╢╢▓█████╣▒▒▒

▓╣▓▓▓█████████▓▓▓▓▓▓▓▓▓▓╢╣╢▒▒▒▒▒▒▒▒╢╢╢▓▓▓▓▓▓╣▒▒▒▒▒▒▒▒▒╢▓▓▓▓▓▓▓▓███▓▓▓╣╢▓████▓▒▒▒

▓▓▓▓▓████████▓▓▓▓╣▓▓▓▓╣╢╢╣╣╢╢╢▒▒╢╢▒╢╢╢▓▓▓▓▓╣╢▒▒▒▒▒▒▒▒▒╢▓▓▓▓▓▓▒▒▒▒▒░╙▓▓▓▓████╢╢╢╢

▓▓▓▓▓▓███████▓▓╢╢╢╢╢╢╢╢▓▓▓▓▓▓██████▓▓▓▓▓▓▓▓▓╣╣▒▒▒▒▒▒▒▒▒╢╢╢╢╣▒▒▒▒▒▒▒░░╠▓▓███▓▓▓▓▓

▓▓▓▓▓▓▓█████▓▓╣╢╢╢╣╢╢╣▓▓▓████▀▓▓▄▒╙▀▓▓▓▓╣╢▓▓▓╣▒▒▒▒▒▒╢▓▓▓╢╢▓▓▓▓▓▓▓▓▓▒▒▒▓▓██▓▓▓▓▓▓

▓╢▓╣╫▓▓▓▓▓██▓╣╣╢╢╣╣╣▓▓▓▓▓█▓╣▒█████▓ ▀▓▓▓╣▓▓▓╣╣▒░░▒╢╣╣╢▓▓▓▓▓▓▀▀▀███▓▓╣╢▓█▓▓▓▓▓▓▓

▓╣╢╫▓▓▓▓▓▓██▓╣╢╢╢╢╢╢╢▓▓▓▓▓▓▓▓▓████▀,░▒▓▓▓╢╢╢╢╣╣▒▒▒▒╢╢╢▓▓▒▓████▌ '▓██▓▓╣▓▓▓▓▓▓▓▓▓

▓▓╣▓▓▓▓▓▓▓▓▓▓╣╢╢╢╢╢╢╢╢╢╢╢╢▓▓▓▓▓▓▓▓▓▓╣╢▒╢╢╢╢╢╣╣╣▒▒▒▒▒▒▒╫▓▓▓█████░╥▓▓▓▓╣▒▓▓▓▓▓▓▓▓▓

▓▓╣▓▓▓╣╣▓▓▓▓▓▓╣╣╢╢╢╢╢╢╢╢╢╣╢╢╢╢╣╣╢╣╣▒▒▒▒╢╢╢╢╢╢╢╣▒▒▒▒▒▒▒▒▒╢▓▓▓▓▓▓▓▓▓▓▓▒▒▒▐▓▓▓▓▓▓▓▓

▓▓╣╣╢▓▓▓╣▓▓▓▓▓▓╣╢╢╢╣╢╢▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒╢╢╢╢╢╢╢▒▒▒▒▒▒▒▒░░▒▒╢╢▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓▓▓

▓▓▓╢▓╣╢▓▓╢▓▓▓▓▓╣╢╢╣╢╣╣╣▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒╢╢╢╢╢╢╣▒▒▒▒▒▒▒░░░░▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓▓▓

▓▓▓▓╢╢╣▓▓▓▓▓▓▓▓╣╢╢╢╣╢╢╢╢╢╣╢▒▒▒▒▒▒▒▒▒▒▒▒╢╢╢╣╢╢╢╣▒▒▒▒▒▒▒░░░░░░░░░░░░░░▒▒▓▓▓▓▓▓▓▓▓▓

▓▓▓▓▓▓╣╢╢▓▓▓▓▓▓▓╣╢╢╢╢╢╢╢╣╢╣▒▒▒▒▒▒▒▒▒╢▓▓▓▓▓▓▓╣╢╣╣▒▒▒▒▒▒▒░░░░░░░ ░░░▒▒╫▓▓▓▓▓▓▓▓▓▓

▓▓▓▓▓▓▓██████▓╣╣╣╢╢╢╢╢╢╢╢╢╢╣▒▒▒▒▒╢╫▓▓▓▓▓▓╢╢╢╢╢▒▒▒▒▒▒▒▒▒▒▒░ ░░░░░▒▒▒▒▓▓▓▓▓▓▓▓▓▓▓

▓▓▓▓▓▓▓██████▓╣╣╢╢╢╢╢╢╢╢╢╢╢╢╣▒▒▒▒╢╢▓▓▓▓▓▓██▓▓▓▓╢╣╣╢▓▓▓▓╫╣▒░░░░ ░░▒▒▒╫▓▓▓▓▓▓▓▓▓▓▓

▓▓▓▓▓▓████████╣╢╢╢╢╢╢╢╢╢╢╢╢╢╢╣▒▒▒▒╢╢╢╢▓▓▓▓▓▓╢▓▓▓▒▒▒╫▓╣▒╢▒▒░░░░░░░▒▒▒▓▓▓▓▓▓▓▓▓▓▓▓

▓▓▓▓██████████╣╢╢╢╢╣╢╢╢╢╢╣╣╣╢╣╣▒▒▒╢╣╢╣╣╣╣╣╣╣▒╢▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓▓▓▓▓▓▓

▓████▓▓▓▓▓▓▓█▓▓╢╢╢╢╢╢╢╢╢╣╣╣╣╣╢╢╢╢╢╢╣╢╢╣╢╣▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓▓▓▓▓▓▓

▓▓██▓▓▓▓▓▓▓▓██▓╢╢╢╢╢╢╢╢╢╢╢╣▓▓▓▓╣╣╣╣╣╣╢╣╢╣╢╣╢╢▒╢▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓▓▓▓▓▓▓▓

▓██▓▓▓▓▓▓▓▓▓▓██▓╣╢╢╢╢╢╢╣╣╣▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓╣▒▒▒▒▒▒▒▒▒▒▒▒▒╫▓▓▓▓▓▓▓▓▓▓▓▓▓▓

▓██▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓╣╣╣╢╢╣╣▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▒╢╣▒▒▒▒▒▒▒▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

▓██▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓╣▓▓▓▓▓▓▓▓▓▓▓▓▓▓╣╬▓▓▓▓╢╢╢╢╣▒▒▒▒▒▒▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

▓▓█▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓╣╢╢╣▒▒▒╢╣▒▒▒▒▒▒▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓

▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓╣╢╢▓▓▓▓▓▓▓▓▓▓▓▓╣╣╢▒▒╢╣▒▒▒╢╢╢╢╫▓█████▓▓▓▓▓▓▓▓▓▓▓▓

▓▓▓▓▓▓▓▓▓▓▓▓▓████▓▓▓▓▓▓▓▓▓▓▓▓▓▓╣╣╣╣╣╢╢╢╢╢╢▓▓▓╣╣╣▒▒▒▒▒▒▒▒╢╢╢╫▓▓▓▓▓█████████████▓▓

▓▓▓▓▓▓▓▓▓██████▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓╣╢╢╢╢╢╣▒▒▒▒▒▒▒▒▒▒▒▒▒▒╢╢╢╢╣▓▓▓▓▓▓██████████████

█████████████▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓╣╢╢╢╢╣▒▒▒▒▒▒▒▒▒▒▒▒╢╢╢╢╣╢╢╫▓▓▓▓▓██████████████

████████████▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓╣╣╣╢╢╢╣╣▒▒▒▒╢╢╣╣▒▒╢╢╢╣▓▓▓▓▓██████████████

███████████▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓╣╣╢╣╣▒▒▒╢╢╢╢▓▓▓▓██████████████

▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀╩╩╩╩╩╩╩╩╩╩╩╩╩╩▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀▀

Anonymous ID: 2ef6f6 Feb. 20, 2024, 4:45 p.m. No.20448861 🗄️.is 🔗kun >>8872

Prob cuz Hunter pics are dropping.

>>20448855

Anonymous ID: c7cf6c Feb. 20, 2024, 4:45 p.m. No.20448863 🗄️.is 🔗kun >>8869

they worry about vengeance

Anonymous ID: ebf9d8 Feb. 20, 2024, 4:45 p.m. No.20448864 🗄️.is 🔗kun >>8875

>Similar to microplastics, smart dust

Looks like I was right about this dust being nano particulates of plastics and nylons but there is more to it than this. There are nano particles of soft metals, bio-agents like larva, nematoads, and germ warfare admixtures depending on the illness and disease that the DS is looking to cause; think of each of these as dials. Trump later called this dust "China dust" at a rally after I asked the Q team to come take samples from in front of my house as saboteurs were spraying liquids that dry into this dust. This is why I always said, Covid is/was local from chemical knitters. I asserted that this is the number one cause of illnesses, disease, and deaths worldwide; and one day I will be proven 100% correct on this. This didn't start with Covid, but as far back as specialized children hospitals and their specialized drives to raise funds for them by the rat pack.

Logical Thinking…

>>20448841

probably that bitch

going with youtube for now since it shows an image

Anonymous ID: a58f5c Feb. 20, 2024, 4:45 p.m. No.20448866 🗄️.is 🔗kun >>8874

>>20448854

Anonymous ID: e9b6c6 Feb. 20, 2024, 4:46 p.m. No.20448868 🗄️.is 🔗kun >>8877

>>20448858

I Still Haven’t Found What I’m Looking For

>>20448863

About what?

Anonymous ID: 3958d2 Feb. 20, 2024, 4:46 p.m. No.20448870 🗄️.is 🔗kun >>8924

>>20448798

I noticed your shit is old and boring like it's been for the last six years

United Airlines flight #UA354, a Boeing 757-224, diverted to Denver International Airport, Colorado, USA, after pieces from the inner leading edge slat of the right-hand wing had broken off.

https://twitter.com/AviationSafety/status/1759994913800818896

>>20448861

anon's "Fire Fauci" was the last image seen on this end

American people are so stupid they don't even know their country is usurped….lmao

>>20448866

Anonymous ID: 674f04 Feb. 20, 2024, 4:46 p.m. No.20448875 🗄️.is 🔗kun >>9016

>>20448864

I I I me me my shill is at it again.

Anonymous ID: e0114c Feb. 20, 2024, 4:46 p.m. No.20448876 🗄️.is 🔗kun >>8884

Fuck you bitch

Anonymous ID: 6d54ad Feb. 20, 2024, 4:47 p.m. No.20448877 🗄️.is 🔗kun >>8894

>>20448868

What do you want?

Trump has big feet!

Great understanding!

Sounds like some people don't like winning.

another day into Black History month and nothin

>>20448847

Hey I don't have a TV what's going on did Trump walk out

>>20448873

ching chang chong

Anonymous ID: 68b06f Feb. 20, 2024, 4:48 p.m. No.20448883 🗄️.is 🔗kun >>8898

>>20448867

love it! thank you anon!

>>20448876

Causation exists.

>>20448855

Old skool tactics! Top Kek!

Anonymous ID: 676f0e Feb. 20, 2024, 4:48 p.m. No.20448886 🗄️.is 🔗kun >>8890

Stupid people who like Trump’s policies but not him

How ignorant

>>20448801

Kinda early for your projection, but screw it I need something to chuckle at until somebody gives the image server a kick

Anonymous ID: 91ae33 Feb. 20, 2024, 4:48 p.m. No.20448888 🗄️.is 🔗kun >>8943

>>20448788

>If so, who would you nominate?

on a board that decries any form of self identification, how to identify an anon to serve as BO?

Anonymous ID: 49200f Feb. 20, 2024, 4:48 p.m. No.20448889 🗄️.is 🔗kun >>8913

>>20448871

>>20448886

cap your post

for posterity keks

>>20448705

https://usnewson.com/watch/fox-news-live

>>20448881

>Hey I don't have a TV

You have internet ….

https://streamfare.com/foxnews

Anonymous ID: f25fa7 Feb. 20, 2024, 4:48 p.m. No.20448893 🗄️.is 🔗kun >>8940

>>20448873

don't you have some blm to kneel to or some illegals to load on a flight or bus?

Anonymous ID: e9b6c6 Feb. 20, 2024, 4:49 p.m. No.20448894 🗄️.is 🔗kun >>8916

>>20448877

Beautiful Day

>>20448844

wind the clock on device this is not rocket scientists appliances salesman

Anonymous ID: 676f0e Feb. 20, 2024, 4:49 p.m. No.20448896 🗄️.is 🔗kun >>8907

Laura, shut up after you ask him a question

Anonymous ID: 75e8da Feb. 20, 2024, 4:49 p.m. No.20448897 🗄️.is 🔗kun >>8904

MY REVENGE WILL BE SUCCESS

Anonymous ID: 68b06f Feb. 20, 2024, 4:49 p.m. No.20448898 🗄️.is 🔗kun >>8917

>>20448883

sorry liked the original better. had muted listening to POTUS. I rescind my previous comment

is this website broken again?

Anonymous ID: 526863 Feb. 20, 2024, 4:50 p.m. No.20448900 🗄️.is 🔗kun >>8963

Bannon: "The Invasion Is Full On". Re Ukraine: We are not doing $60 billion, because its just going to kill more Ukrainians and arm them more to destroy themUkrainians are fleeing from the country, because they know they are being sent to Charnel House of death. And the EU wants that with a war they started.

9:55

Bafomet and Moloch must be fed

https://rumble.com/embed/v4c3345/?pub=4

After every number they would pass the hat

Anonymous ID: 676f0e Feb. 20, 2024, 4:50 p.m. No.20448903 🗄️.is 🔗kun >>8929

Laura gonna have highest viewership this week and she’s trying to show how smart she is. Which she isn’t

>>20448897

>>20448899

no change clock time manually on device.

>>20448896

Laughing Apu smoking cig png

Indeed!

>>20448899

>>20448803

QR is where trillions in propaganda machine gets jacked up by memes and the morans can't figure out what to do about it

Anonymous ID: e45293 Feb. 20, 2024, 4:51 p.m. No.20448910 🗄️.is 🔗kun >>8915

Top 3 VP picks

Anonymous ID: 189b16 Feb. 20, 2024, 4:51 p.m. No.20448912 🗄️.is 🔗kun >>8930

>>20448828

oh

you mean Hunters line of coke?

>>20448889

>>20448871

DIVERSITY SHITBALLS NEED TO BE REMOVED FROM ALL AREAS OF THE MANUFACTURING INDUSTRY

Anonymous ID: e9b6c6 Feb. 20, 2024, 4:51 p.m. No.20448914 🗄️.is 🔗kun >>9074

Lotta Tictok is good Commericals

ICYMI

Ticktok is A China Weapon to destroy our youth

>>20448910

POTUS will never tell her

Anonymous ID: 6d54ad Feb. 20, 2024, 4:52 p.m. No.20448916 🗄️.is 🔗kun >>8923

>>20448894

the best is yet to come？

Anonymous ID: 68b06f Feb. 20, 2024, 4:52 p.m. No.20448917 🗄️.is 🔗kun >>8932

>>20448898

>sorry liked the original better. had muted listening to POTUS. I rescind my previous comment

>>20448867

got the original without the music?

Q Research: the glowing epitome of government agency incompetence

Anonymous ID: 2ef6f6 Feb. 20, 2024, 4:53 p.m. No.20448920 🗄️.is 🔗kun >>9007

Notes ~580

#25085 >>20448296

>>20448595, >>20448842, >>20448571 Trump live for Town Hall with Laura Ingraham

>>20448345 Planefag

>>20448362, >>20448715 The Authoritative Personality (1950), Adorno T. W.

>>20448367 What is Smart Dust?

>>20448411 Tucker Carlson - Mass Immigration is Destroying the United States and No One is Doing Anything About It… Why Journalists are Afraid

>>20448443, >>20448493 @TheJusticeDept has unsealed indictments against two alleged Russian members of the #LockBit ransomware group

>>20448490 Hunter Biden’s Lawyers Lash Out at Special Counsel, Claim Photos on iPhone Are Sawdust, Not Crack Cocaine

>>20448510 Leader of drug trafficking organization, Francisco Rene Luna, imprisoned for international cocaine distribution scheme

>>20448515, >>20448586, >>20448608 Understanding PCR

>>20448555 US To Hit Moscow With New "Major Sanctions Package" Over Navalny's Death

>>20448585 Dog comms: 13 pit bulls euthanized after deadly mauling in Compton

>>20448652 Egypt Stops Use Of US Dollar For Trade - Joins BRICshitters

>>20448677 NY Bill would allow children to consent to medical procedures

>>20448804 Bannon: Trump's Representing The American People, He's Putting You First - Biggest fundraiser in SC for Trump, $6.5 million

>>20448816 Tustin, California: Confirmed Explosion at a shopping center lockdowns and evacuation in place

>>20448871 United Airlines flight #UA354, a Boeing 757-224, diverts after pieces from inner leading edge slat of right-hand wing broke off

#25085

Anonymous ID: b0c7e1 Feb. 20, 2024, 4:53 p.m. No.20448921 🗄️.is 🔗kun >>8925

did the truckers blockade NYC?

>>20448916

THE BEST IS YET TO COME!

>>20448870

Wow, the best you got. You're right though, this shit is 2000 years old.

>>20448921

Did Tater trip up the stairs today?

refresh we're back up

>>20448731

Frankfurt School and Tavistock use mind Control techniques for Cultural engineering.

https://archive.schillerinstitute.com/new_viol/cybmindcontrol_js0400..html

Enjoy Chem Trail Rain

The SHERIFF Protects Chem trails. They protect the Airport from you snooping to find out about the Chemtrails.. THEY ARE WITH THEM

>>20448903

Fox seeded the audience with scripted and rehearsed questions. Especially the women who asked: Can you convince the 'undecideds' without seeking revenge? DJT gave a tremendous answer which force Laura to give herself away.

>>20448912

Haha that took a long time! But no, it was about seeing images here. I didn't see anything, but it's coming back.

Anonymous ID: f60158 Feb. 20, 2024, 4:56 p.m. No.20448932 🗄️.is 🔗kun >>8935

>>20448917

o7

>>20448816

Is it too late or can I enter the Betting Pool with "Meth Lab goes boom?"

Anonymous ID: ed5760 Feb. 20, 2024, 4:57 p.m. No.20448934 🗄️.is 🔗kun >>8941

>>20448881

Laura Ingraham admits women are the problem.

>>20448932

much appreciated

>>20448933

dubs and trips chekt! kek!

trump doesn't have confidence in election process either after a stolen election was proven, so what game are we playing by voting

>>20448933

bookmaker is offering 1-9 odds on that

not worth it

Anonymous ID: b0caa5 Feb. 20, 2024, 4:57 p.m. No.20448940 🗄️.is 🔗kun >>8948

>>20448893

Old bitch shut your hole.

>>20448934

kek

Laura Ingraham doesn't know who Virginia Benassi is.

Anonymous ID: f88cf8 Feb. 20, 2024, 4:58 p.m. No.20448943 🗄️.is 🔗kun >>8976

>>20448888

nora the bugz no

lo WHO do they want for VP?

Torture or quick trial.

Anonymous ID: f25fa7 Feb. 20, 2024, 4:59 p.m. No.20448948 🗄️.is 🔗kun >>8952

>>20448940

how about some more of that goot ol pro-active policing

That way I can tell if you are doing your job.

Hey that fuckers looking at me!

GOOD hes doing his job

I'm not a fed.

Anonymous ID: 386368 Feb. 20, 2024, 5 p.m. No.20448950 🗄️.is 🔗kun >>8954

Laura Ingraham looks desperate to be number one and she wants her old time slot back from Jessie Watters.

qpost #4515

Feb 2019

[ing] error

ingraham / img

Anonymous ID: b0caa5 Feb. 20, 2024, 5 p.m. No.20448952 🗄️.is 🔗kun >>8958

>>20448948

Old fat lesbian shut the hell up~

Started the dust programs in 92

By 2015 they admitted to this

Mission impossible thingies

https://www.news.xerox.com/news/PARC-extends-contract-with-DARPA-for-DUST-Technology

Anonymous ID: ed5760 Feb. 20, 2024, 5:01 p.m. No.20448954 🗄️.is 🔗kun >>8959

>>20448950

Ingraham jumped the shark when she left AM Radio. She's lost her edge.

>>20448937

>what game are we playing

the only game in town anon

Anonymous ID: f25fa7 Feb. 20, 2024, 5:02 p.m. No.20448958 🗄️.is 🔗kun >>8973

>>20448952

/filtered

cyber engagement center wasting my time

Anonymous ID: 4efaa2 Feb. 20, 2024, 5:02 p.m. No.20448959 🗄️.is 🔗kun >>8968

>>20448954

Never could stand her. That voice and demeanor in general are annoying af

Anonymous ID: 2ef6f6 Feb. 20, 2024, 5:02 p.m. No.20448960 🗄️.is 🔗kun >>9055

Qpost #4515

Feb 2019

[ing] error

ingraham / img server

Anonymous ID: 0fed43 Feb. 20, 2024, 5:03 p.m. No.20448961 🗄️.is 🔗kun >>8969

>>20448949

this place is irregular blend in

>>20448900

> themUkrainians are fleeing from the country, because they know they are being sent to Charnel House of death. And the EU wants that with a war they started.

Who would want all white people eliminated?

EU?

America?

Anonymous ID: a8aec8 Feb. 20, 2024, 5:03 p.m. No.20448964 🗄️.is 🔗kun >>8993

>>20448928

stolen elections suck

meanwhile our sheriff is raiding vape shops with massive militarized task force looking for delta anything

and small foreign childrenand fentanyl flows freely

https://ibb.co/HpxxFbP

Anonymous ID: 3afed9 Feb. 20, 2024, 5:04 p.m. No.20448966 🗄️.is 🔗kun >>8992

>>20448949

how did you end up on a fed board?

So is the continued posting, knowing the image server has shit the bead, part of that "pre-packaged five prong injection" thing or do I just need to take a pot to see the images again?

Anonymous ID: 0c538d Feb. 20, 2024, 5:04 p.m. No.20448968 🗄️.is 🔗kun >>8973

>>20448959

Some anon filter Ingraham!

>>20448961

You see it?

Anonymous ID: f25fa7 Feb. 20, 2024, 5:04 p.m. No.20448970 🗄️.is 🔗kun >>8977

Laura Ingram is successful because she don't ask certain things. If you are listening to Laura Ingram you'll miss the schwang wu filters an Johnson controls

Anonymous ID: 0c318e Feb. 20, 2024, 5:04 p.m. No.20448971 🗄️.is 🔗kun >>8972

Stardust showers or sawdust crack pipes. Glorious - classic. Drywall dust is not for cry babies

>>20448971

kek

Anonymous ID: b0caa5 Feb. 20, 2024, 5:04 p.m. No.20448973 🗄️.is 🔗kun >>8984

>>20448968

>>20448958

WTF with images again?

Anonymous ID: 659cbf Feb. 20, 2024, 5:05 p.m. No.20448975 🗄️.is 🔗kun >>8985

>>20448963

>Who would want all white people eliminated?

lol….

you know the answer

next asking questions is going to get anons deleted

wait for it…

>>20448943

Anonymous ID: 4efaa2 Feb. 20, 2024, 5:05 p.m. No.20448977 🗄️.is 🔗kun >>8994

>>20448970

Give it a rest already

>>20448974

they borked it cause POTUS tonight

Anonymous ID: 21b84f Feb. 20, 2024, 5:06 p.m. No.20448979 🗄️.is 🔗kun >>8997

Putting a ton of dust in the air

▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒

▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒░░░░░░░░░░▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒

▒▒▒▒▒▒▒▒▒▒▒▒▒░░░░░░░░░░░░░░░░░░░▒▒▒▒▒▒▒▒▒▒▒▒

▒▒▒▒▒▒▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░▒▒▒▒▒▒▒▒▒

▒▒▒▒▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░░░▒▒▒▒▒▒▒

▒▒▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░▄░░▒▒▒▒▒

▒▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░██▌░░▒▒▒▒

▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░▄▄███▀░░░░▒▒▒

▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░█████░▄█░░░░▒▒

▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░▄████████▀░░░░▒▒

▒▒░░░░░░░░░░░░░░░░░░░░░░░░▄█████████░░░░░░░▒

▒░░░░░░░░░░░░░░░░░░░░░░░░░░▄███████▌░░░░░░░▒

▒░░░░░░░░░░░░░░░░░░░░░░░░▄█████████░░░░░░░░▒

▒░░░░░░░░░░░░░░░░░░░░░▄███████████▌░░░░░░░░▒

▒░░░░░░░░░░░░░░░▄▄▄▄██████████████▌░░░░░░░░▒

▒░░░░░░░░░░░▄▄███████████████████▌░░░░░░░░░▒

▒░░░░░░░░░▄██████████████████████▌░░░░░░░░░▒

▒░░░░░░░░████████████████████████░░░░░░░░░░▒

▒█░░░░░▐██████████▌░▀▀███████████░░░░░░░░░░▒

▐██░░░▄██████████▌░░░░░░░░░▀██▐█▌░░░░░░░░░▒▒

▒██████░█████████░░░░░░░░░░░▐█▐█▌░░░░░░░░░▒▒

▒▒▀▀▀▀░░░██████▀░░░░░░░░░░░░▐█▐█▌░░░░░░░░▒▒▒

▒▒▒▒▒░░░░▐█████▌░░░░░░░░░░░░▐█▐█▌░░░░░░░▒▒▒▒

▒▒▒▒▒▒░░░░███▀██░░░░░░░░░░░░░█░█▌░░░░░░▒▒▒▒▒

▒▒▒▒▒▒▒▒░▐██░░░██░░░░░░░░▄▄████████▄▒▒▒▒▒▒▒▒

▒▒▒▒▒▒▒▒▒██▌░░░░█▄░░░░░░▄███████████████████

▒▒▒▒▒▒▒▒▒▐██▒▒░░░██▄▄███████████████████████

▒▒▒▒▒▒▒▒▒▒▐██▒▒▄████████████████████████████

▒▒▒▒▒▒▒▒▒▒▄▄████████████████████████████████

████████████████████████████████████████████

████████████████▀████████████████████████████████████████

█▄─▀█▄─▄█▄─▄█─▄▄▄▄█─█─█─▄─▄─███─▄▄▄▄█─█─█▄─▄█▄─▄▄─█─▄─▄─█

██─█▄▀─███─██─██▄─█─▄─███─█████▄▄▄▄─█─▄─██─███─▄█████─███

▀▄▄▄▀▀▄▄▀▄▄▄▀▄▄▄▄▄▀▄▀▄▀▀▄▄▄▀▀▀▀▄▄▄▄▄▀▄▀▄▀▄▄▄▀▄▄▄▀▀▀▀▄▄▄▀▀

Anonymous ID: 659cbf Feb. 20, 2024, 5:07 p.m. No.20448981 🗄️.is 🔗kun >>8999

>>20448928

> THEY ARE WITH THEM

time for them to die with them?

it was just a bit o' pixie dust

Baby sitter looking for work.

867-5309

in theory there are more stings in effect this round.. its like when someone keeps eating your sandwich out of the fridge at work, so you keep making it and keep storing it in the fridge but start jizzing in it at home before taking it in

How do Anons feel about buying power tools from pawn shops as opposed to top dollar and new?

Homeowner renovations. Not commercial use.

Anon admits it. Anon loves Chuck Norris (no homo). He came up in conversation, so looked things up not really knowing anything about him, personally. Had only surmised he’s generally a “conservative” badass. Found a GREAT piece he wrote in 2020: Top 15 accomplishments of Trump's presidency Exclusive: Chuck Norris meets his match trying to narrow down scores of achievements By Chuck Norris Published November 2, 2020 at12:54pm

https://archive.is/jyOKl

However, he writes: You can knock Trump for his character flaws, but here are what we see as the top 15 accomplishments for which we all – Republican, Democrat and Independent – should be grateful and proud. America, the world and our lives are better for them.

Oh fuck, yet another one with the same tired SMEAR. WHY?

OK Chucky, since you just had to get that in, please elaborate on your findings? Certainly Melania, Eric, Barron, etc. would be happy to confirm your astute observations, since you’ve apparently lived with him, being close enough to know such things because (UNLIKE yourself, Joh. & Di., of course): Trump was married to Ivana from 1977 until 1990; Didn’t marry Marla until 1993, after which Tiffany was born… so it can’t be “OMG!divorced!”), can it?

Ahhh!!! You must mean the pussy tape!!! when he mocked gold-digging groupies in a PRIVATE man-on-man conversation! And/OR how about when he mocked treasonous (<— Understatement of the Ages) noname on TV? You served our Country. Look into noname and how many Navy soldiers’ (among countless others’) blood is on his hands, why don’t you. Is it really a “character flaw” to NOT speak like a scripted, limp-wristed PUSSY, as ALL entrenched “conservative” politicians happen to BE? Apparently so!

He continues: Whether or not we accept it, it's the truth: Trump has done more in 47 months then Joe Biden did in 47 years as a senator and vice president. With 47 years of attempts, hasn't Biden been given enough time to clean and change the D.C. swamp? 47 years? Time's up! https://www.wnd.com/2020/11/top-15-accomplishments-trumps-presidency/

If CN’s gonna bring up “character flaws” (avoiding MUCH WORSE), THIS would have been the time to do it. All the KNOWN TREASON w/china,ukraine, ETC. aside here, Ashely’s Diary with the SHOWERS was confirmed back in fucking OCTOBER of 2020, and the footage of bidan fondling very young and very obviously uncomfortable children and even pinching one little girl’s NIPPLE (VID1) were well-known for YEARS prior (via the Internet and on OAN)… So are you saying that biden’s “ineptitude” is the worst thing about him, Chucky?

fucking “conservatives” can’t do anything sans the usual unwarranted SMEAR. It’s much worse when somebody of the VERY few respected and admired does it. Infuriating. Stopped watching (the Divorced) Dan Ball for the same fucking reason - “Trump has sinned!” Fucking assholes. You don’t KNOW “sinned” until looking into the likes of noname, the bushes, and even (the Divorced) Red ronnie, the “great communicator” Gold Standard, LOL (SEE VID2 as you observe the COMMUNIST COUNTRY you presently reside in). STOP comparing President TRUMP to these emasculated bastards.

funny the way people can't see the chemtrails for the anomaly they are.

only the old people can remember what the skies used to look like, should look like, and the old people are the number one group slated for extermination

They don't like what we named their ancestors.

Those FALLEN sure are a grumpy bunch. Sheesh, Lizards have bad tempers.

>>20448990

WTF with pics?

>>20448966

We are fucked!

Anonymous ID: f25fa7 Feb. 20, 2024, 5:10 p.m. No.20448993 🗄️.is 🔗kun >>9004

>>20448964

I can sympathize with the sheriff situation. Maybe they help one business over another or maybe they are just retarded ass.

I have never said the elections are stolen. I am gona be an echo and be clear about this again. I said there are BAD people on the Ballot as a choice. and this is because of the national security background checks and I guess broken oaths. 70 years of it in different forms.

>>20448977

don't you have some blm to kneel to or some illegals to load on a flight or bus?

Anonymous ID: 56ae9d Feb. 20, 2024, 5:10 p.m. No.20448995 🗄️.is 🔗kun >>9039

Haley is waiting for her chance?

What does she know?

>>20448979

Wonder if Hunter ever smoke this dust.

>>20448990

call them pigs

Comparing animal rights and the Holocaust

Naomi Pfefferman

October 10, 2012

On Oct. 2, Alex Hershaft, a Holocaust survivor and founder of the nonprofit Farm Animal Rights Movement (FARM), sat on the ground with some 100 other protesters in front of the Farmer John pig slaughterhouse in Vernon, Calif., blocking the entrance from two bi-level trucks carrying 200 pigs that had arrived to be slaughtered that day. In the next 24 hours, the pigs would be among 6,000 animals that would be stunned by electrical shock, hoisted up by their hind legs and their necks slit in the plant, which is the largest pig slaughterhouse on the West Coast.

The demonstration was just one of more than 100 such protests held across the United States and in other countries commemorating FARM’s annual World Farm Animals Day.

“You could hear the pigs on the trucks crying,” Hershaft, 78, said quietly in a phone interview from his Bethesda, Md., home several days later. “Despite my advanced age, I made the trip to Vernon and risked arrest, because, as a Holocaust survivor, I am honor-bound to call public attention to this ongoing tragedy.”

As a 5-year-old in the Warsaw Ghetto, Hershaft witnessed brutal beatings and shootings and saw Jews dying of typhus in the streets. After being smuggled out of the ghetto by a family maid, he survived the war by passing as an Aryan. Upon liberation, he learned that his father had died following internment in a German slave labor camp, and that most of his other relatives had also perished…https://jewishjournal.com/mobile_20111212/108867/

>>20448981

/filtered

God bless this board.

Anonymous ID: 17020f Feb. 20, 2024, 5:11 p.m. No.20449001 🗄️.is 🔗kun >>9009

>>20448585

13

>>20448994

Are you retarded? You sound retarded.

Usually it's because someone forgot to update the certificate or somesuch administrative nonsense.

Anonymous ID: 3afed9 Feb. 20, 2024, 5:11 p.m. No.20449004 🗄️.is 🔗kun >>9006

>>20448993

>I have never said the elections are stolen.

well what the fuck is wrong with you?

>>20448652

>>20449004

/filtered

no childish discussion. I ain't playing that shit,

next bread title?

"My Revenge Will Be Success"

>>20448920

Anonymous ID: f03823 Feb. 20, 2024, 5:12 p.m. No.20449008 🗄️.is 🔗kun >>9030

Anon just roll with it easy..a lil choppy water while board's under attack.

>>20449001

if it is all over and done with, why are you still here?

https://health.mo.gov/living/wellness/immunizations/pdf/ClinicalUseandBenefitsofStateIIS.pdf

What are Immunization Information Systems (IIS)?

Quote: "All US states, territories and even some large cities (e.g. Chicago, NYC, LA, DC) have IIS"

This looks like a whole lot of information could get connected together about each person.

Anonymous ID: 843384 Feb. 20, 2024, 5:13 p.m. No.20449012 🗄️.is 🔗kun >>9024

Yeah- my brother went to rehab for “sawdust” addiction

Join or 404 this going to go for 1 1/2 days again

Better question: How is it I can post again?

Jesus Fox i just ate.

Anonymous ID: 41f0cb Feb. 20, 2024, 5:13 p.m. No.20449016 🗄️.is 🔗kun >>9049

>>20448875.

Wrong, understand what dialed in means, I said these things to further the investigations as one ingredient was confirmed; not to hear you cry. I said the #1 killer in the world, go do some work instead of mouthing off.

>>20449013

fuck it

Giant Meteor incoming

>>20448974

powers out

don't flush the turlet

>>20448987

threat plan middle eastern pawn shop owner recycles American and Canadian nuildimg contractors 2wice. first on stollel vehicles then recycle the retards tools win both ends. truck dealership

Anonymous ID: 526863 Feb. 20, 2024, 5:14 p.m. No.20449020 🗄️.is 🔗kun >>9042

Natalie Winters On Russia Being Called Our Main Enemy: "Community Service For The CCP". She spells it out why Ukraine, why congress got away with sending billions over seas for decades with no accountability. And exactly why they are freaking out, the American people are saying NO MORE money to Ukraine. This whole thing us being pushed and used by CCP warfare against the US

13:05

https://rumble.com/embed/v4c3a53/?pub=4

you keep saying the election is stolen

A little thing about REALITY anons.

STOP SAYING IT WAS STOLEN

(say bad people were on the ballot as a choice!)

https://www.youtube.com/watch?v=Rbeq2-CCFmE

Anonymous ID: 9c9844 Feb. 20, 2024, 5:14 p.m. No.20449022 🗄️.is 🔗kun >>9048

It is exactly this.

Cert expired.

Anon discovered after posting imaginary meme last post.

>>20449003

Bernie bitching about the cost of living while we ship shekels overseas.

Anonymous ID: 6b7289 Feb. 20, 2024, 5:14 p.m. No.20449024 🗄️.is 🔗kun >>9031

>>20449012

⠀⠀⢠⣿⣿⣶⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣶⣿⣿⡄⠀⠀

⠀⢠⣾⣿⣿⡿⠉⢿⣿⣿⣿⣿⣿⣿⡿⠉⢿⣿⣿⣷⡄⠀

⠀⠘⢿⣿⣿⣇⣠⣿⡿⠛⠉⠉⠛⢿⣿⣄⣸⣿⣿⡿⠃⠀

⠀⠀⣼⣿⣿⣿⣿⡋⠀⠀⠀⠀⠀⠀⢙⣿⣿⣿⣿⣧⠀⠀

⠀⣸⣿⣿⣿⣿⣿⣿⣾⣇⣀⣀⣸⣷⣿⣿⣿⣿⣿⣿⣇⠀

⣰⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣆

⣿⣿⣿⣿⣿⣿⠿⠟⠛⠉⢸⡇⠉⠛⠻⠿⣿⣿⣿⣿⣿⣿

⢻⣿⣿⣿⣿⣿⡇⠀⠀⠀⢸⡇⠀⠀⠀⢸⣿⣿⣿⣿⣿⡟

⠀⠻⣿⣿⣿⣿⣿⡀⠀⠀⢸⡇⠀⠀⢀⣿⣿⣿⣿⣿⠟⠀

⠀⠀⠈⠻⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⣿⠟⠁⠀⠀

⠀⠀⠀⠀⠈⠙⠻⢿⣿⣿⣿⣿⣿⣿⡿⠟⠋⠁⠀⠀⠀⠀

>>20448994

Would I sound mean if I said LaGuardia is kinda out because weather and trucks don't deliver to the Rotten Apple anymore?

Anonymous ID: 59f738 Feb. 20, 2024, 5:15 p.m. No.20449026 🗄️.is 🔗kun >>9040

>>20449017

deploy the fuck reeeeeeeee meme png.

>>20449007

Romans 12:19

Anonymous ID: c63c9e Feb. 20, 2024, 5:15 p.m. No.20449028 🗄️.is 🔗kun >>9040

>>20449017

it's our only chance

Anonymous ID: 94d11b Feb. 20, 2024, 5:15 p.m. No.20449029 🗄️.is 🔗kun >>9040

>>20449017

That'll fix it for sure

>>20449008

>>20449000

>>20449024

wood

https://apnews.com/article/prison-to-plate-inmate-labor-investigation-c6f0eb4747963283316e494eadf08c4e

Prisoners in the US are part of a hidden workforce linked to hundreds of popular food brands

Quote: "Intricate, invisible webs, just like this one, link some of the world’s largest food companies and most popular brands to jobs performed by U.S. prisoners nationwide, according to a sweeping two-year AP investigation into prison labor that tied hundreds of millions of dollars’ worth of agricultural products to goods sold on the open market."

>>20449013

Fuck off.

Who needs images on an image board anyway

Whatever you say bub

Anonymous ID: fdd8e4 Feb. 20, 2024, 5:16 p.m. No.20449035 🗄️.is 🔗kun >>9038

>>20448994

BEGONE!

>>20449007

I was thinking moar dramatic along Qpost delta lines for next one and image server stuff. White Squall.

(o)(o)

▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒

▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒░░░░░░░░░░▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒

▒▒▒▒▒▒▒▒▒▒▒▒▒░░░░░░░░░░░░░░░░░░░▒▒▒▒▒▒▒▒▒▒▒▒

▒▒▒▒▒▒▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░▒▒▒▒▒▒▒▒▒

▒▒▒▒▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░░░▒▒▒▒▒▒▒

▒▒▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░▄░░▒▒▒▒▒

▒▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░██▌░░▒▒▒▒

▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░▄▄███▀░░░░▒▒▒

▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░█████░▄█░░░░▒▒

▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░▄████████▀░░░░▒▒

▒▒░░░░░░░░░░░░░░░░░░░░░░░░▄█████████░░░░░░░▒

▒░░░░░░░░░░░░░░░░░░░░░░░░░░▄███████▌░░░░░░░▒

▒░░░░░░░░░░░░░░░░░░░░░░░░▄█████████░░░░░░░░▒

▒░░░░░░░░░░░░░░░░░░░░░▄███████████▌░░░░░░░░▒

▒░░░░░░░░░░░░░░░▄▄▄▄██████████████▌░░░░░░░░▒

▒░░░░░░░░░░░▄▄███████████████████▌░░░░░░░░░▒

▒░░░░░░░░░▄██████████████████████▌░░░░░░░░░▒

▒░░░░░░░░████████████████████████░░░░░░░░░░▒

▒█░░░░░▐██████████▌░▀▀███████████░░░░░░░░░░▒

▐██░░░▄██████████▌░░░░░░░░░▀██▐█▌░░░░░░░░░▒▒

▒██████░█████████░░░░░░░░░░░▐█▐█▌░░░░░░░░░▒▒

▒▒▀▀▀▀░░░██████▀░░░░░░░░░░░░▐█▐█▌░░░░░░░░▒▒▒

▒▒▒▒▒░░░░▐█████▌░░░░░░░░░░░░▐█▐█▌░░░░░░░▒▒▒▒

▒▒▒▒▒▒░░░░███▀██░░░░░░░░░░░░░█░█▌░░░░░░▒▒▒▒▒

▒▒▒▒▒▒▒▒░▐██░░░██░░░░░░░░▄▄████████▄▒▒▒▒▒▒▒▒

▒▒▒▒▒▒▒▒▒██▌░░░░█▄░░░░░░▄███████████████████

▒▒▒▒▒▒▒▒▒▐██▒▒░░░██▄▄███████████████████████

▒▒▒▒▒▒▒▒▒▒▐██▒▒▄████████████████████████████

▒▒▒▒▒▒▒▒▒▒▄▄████████████████████████████████

████████████████████████████████████████████

████████████████▀████████████████████████████████████████

█▄─▀█▄─▄█▄─▄█─▄▄▄▄█─█─█─▄─▄─███─▄▄▄▄█─█─█▄─▄█▄─▄▄─█─▄─▄─█

██─█▄▀─███─██─██▄─█─▄─███─█████▄▄▄▄─█─▄─██─███─▄█████─███

▀▄▄▄▀▀▄▄▀▄▄▄▀▄▄▄▄▄▀▄▀▄▀▀▄▄▄▀▀▀▀▄▄▄▄▄▀▄▀▄▀▄▄▄▀▄▄▄▀▀▀▀▄▄▄▀▀

>>20449035

/filtered

one word wonder.

Anonymous ID: 3958d2 Feb. 20, 2024, 5:17 p.m. No.20449039 🗄️.is 🔗kun >>9055

>>20448995

She knows that 15K wasn't worth it

Democrats: Nikki Haley “Sold Out Port” For $15K

September 16, 2013

Charleston, SC — This morning, Vice President Joe Biden, Charleston Mayor Joe Riley, Congressman Jim Clyburn and other leaders who have long-understood the importance of the Port of Charleston for South Carolina’s economy, held an event at the Port to talk about the need for deepening. Governor Nikki Haley, who sided against the Port in exchange for campaign contributions in 2011, also took the stage and said “This has to happen” in a stunning display of hypocrisy.

“Nikki Haley raised the bar on her own personal record on hypocrisy talking about the Port in Charleston today – and that’s saying a lot,” said Kaye Koonce, First Vice Chair of the South Carolina Democratic Party and a Charleston resident. “Now that the cameras are on, Nikki Haley suddenly cares about deepening the Port of Charleston but when push came to shove, she sold us out for 20 pieces of silver.”

“Nikki Haley could have supported dredging at the Port of Charleston in 2011 and brought jobs and an economic boost to our state,” Koonce continued. “Instead, Nikki Haley gave the competitive edge to Savannah in order to raise money for her reelection campaign. Well, fool us once, shame on you – and no matter how hard Nikki Haley tries the people of South Carolina won’t be fooled again.”

Haley Received $15K from a Georgia fundraiser prior to port deal that gave Savannah an edge over Charleston and hurt the state’s economic future. “Gov. Nikki Haley faces increasing questions over her role in a decision that helped Savannah gain a competitive advantage over the Port of Charleston, the state’s main economic engine. New concerns arose over two recent events: Haley’s refusal to attend a Senate hearing next week on the matter, and revelations that she raised $15,000 at a Georgia fundraiser 13 days before the S.C. Department of Health and Environmental Control approved dredging Savannah’s harbor. That Nov. 10 approval came about six weeks after the agency denied the request over water-quality issues the dredging would cause.” [Post & Courier, 11/24/11]

Haley Sold Charleston Port Down River. “Last week, Georgia Gov. Nathan Deal put out a statement to thank our own Nikki Haley ‘and others’ for helping out with the expansion of the Savannah port. That sure was nice of him. Of course it’s the least he could do, seeing as how our governor and “others” — her hand-picked Department of Health and Environmental Control board cronies — sold out South Carolina and the Charleston port for him. The DHEC board recently approved a controversial permit to dredge the Savannah River, a move that literally will put the river on life support and could cost this state billions.” [Post & Courier, 11/20/11]

Pay to Play Politics at its Worst. “An investigation has uncovered plane rides and large campaign contributions that some say show a cozy relationship between Gov. Haley and the DHEC board….Gov. Haley attended a fundraising event in Georgia just two weeks before DHEC approved the Georgia dredging permit. The event raised money from Georgia businesses to fund Gov. Haley’s 2014 re-election campaign. Before Gov. Haley appointed them to the DHEC board, campaign records show that Kenyon Wells and his family gave the governor $50,000, while DHEC Chair Allen Amsler gave $3,000. A third DHEC board member and Gov. Haley-appointee gave the governor $570 in 2010.” [WIS, 11/30/11]

Opposition from Democrats & Republicans. “Republican and “South Carolina House Republicans and Democrats alike blasted Gov. Nikki Haley on Tuesday for vetoing their resolution expressing displeasure with a state agency’s move to clear the way for the deepening of Georgia’s Port of Savannah. The House overrode Haley’s veto of that resolution by a 111-to-1 vote. ‘This is a political ploy,’ state Rep. Jim Merrill, R-Berkeley, said of Haley’s veto. ‘Once again, (Haley) is working more on behalf of Georgia, when it comes to this permit and this issue, than she is on South Carolina.’” [The State, 2/28/12]

https://www.fitsnews.com/2013/09/16/democrats-nikki-haley-sold-out-port-for-15k/

>>20449026

>>20449028

>it's our only chance

>>20449029

>That'll fix it for sure

>>20449020

Navalny’s wife is a psyop, is he really dead? She doesn’t care. She is a terrorist and she wants to destroy Russia for a color revolution

Anonymous ID: b25592 Feb. 20, 2024, 5:17 p.m. No.20449043 🗄️.is 🔗kun >>9052

>>20449037

I see what you did there…nobody asked for them anon.

>>20448937

Remember, I have a prototype of an election/recall system that is replayable. Hope PDJT will give some support, because we will need it one way or another.

>>20449011

Another quote: “At the population level, an IIS provides aggregate data on vaccinations for use in surveillance and program operations, and in guiding public health action with the goals of improving vaccination

rates and reducing vaccine-preventable disease.”

>⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄

>⠄⠄⠄⢀⣀⣀⣀⣀⣀⣀⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄

>⠄⢀⢴⢫⢪⢪⢪⢪⢪⢪⢳⢦⡀⣠⢖⢏⢏⢏⢏⢗⢦⢄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄

>⡰⡏⡎⡎⡎⡎⡎⡎⡎⡎⡎⡖⡽⣕⢕⢕⢕⢕⢕⢕⢕⢭⢣⡀⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄

>⡫⡪⡪⣪⡪⡞⡎⡎⡏⡏⡏⡏⡎⡳⡣⣧⢧⢗⢗⢗⢗⢧⢧⣳⡆⠄⠄⠄⠄⠄⠄⠄⠄⠄⠄

>⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡻⣜⢜⢜⢜⢜⢜⢌⢗⢦⡀⠄⠄⠄⠄⠄⠄⠄⠄

>⡪⡪⡪⡪⡪⣪⣪⣪⣪⣪⠮⡮⣮⡮⡮⡮⣎⣧⡣⡣⡣⡱⡱⣱⣱⣱⣹⣆⠄⠄⠄⠄⠄⠄⠄

>⡪⡪⡪⣚⣮⢗⢗⢕⢕⢜⢜⢜⢜⠾⣝⣜⢮⡹⣮⡪⡪⡪⡾⣳⢵⢵⠵⣕⣟⢶⠄⠄⠄⠄⠄

>⡪⡪⡪⡷⢧⣗⠓⠓⣳⡷⢷⣷⣷⣿⠚⠛⠓⡽⣖⣗⢍⣧⣿⣷⣷⣷⠫⣎⡳⣽⠄⠄⠄⠄⠄

>⡪⡪⡪⡪⡪⡪⣫⢳⢿⣿⣹⣇⣠⣿⠄⠄⠄⢸⢼⢎⠞⣸⣷⢾⣏⣹⡇⠄⢨⣿⠄⠄⠄⠄⠄

>⡪⡪⡪⡪⡪⡪⡪⡝⡾⣼⣪⣫⣻⣳⢲⡲⡺⣝⢞⢕⢝⣝⡝⡝⡟⣟⣝⣝⡵⠁⠄⠄⠄⠄⠄

>⡪⡪⣪⡎⡎⡎⡎⡎⡎⡆⡇⡇⡇⡝⡍⣏⡟⡕⡕⡕⡕⡝⡻⣝⢭⢪⠾⡪⡻⣆⠄⠄⠄⠄⠄

>⡪⣪⢮⢮⢎⢎⢎⢪⢪⠪⡪⣪⣪⢮⢞⢕⢕⢕⢕⢕⢕⢕⢝⢜⢗⢕⢍⢎⢎⢾⣦⠄⠄⠄⠄

>⡪⡻⣝⣮⣯⢟⣞⢾⢼⡼⣜⣜⡜⡜⡜⡜⡜⡜⡜⡜⡜⡜⡜⡜⡜⡜⡜⣜⣼⣳⠝⠄⠄⠄⠄

>⡪⡪⡪⡳⣯⣻⢽⣻⢷⣯⣗⣗⣯⣯⣯⣳⣳⡳⣞⣞⣞⡮⡮⣮⢼⢞⣞⣽⡮⡏⠄⠄⠄⠄⠄

>⡪⡪⡪⡪⡪⡪⡻⡺⡽⢮⣗⡯⣗⣗⡯⡯⣷⣻⢷⣳⢷⣻⢟⡾⣻⣻⢾⢽⡽⠏⠄⠄⠄⠄⠄

>⡪⡪⡪⡪⡪⡪⡪⡪⡪⡣⡫⡝⡗⡗⡿⡽⢾⠾⡽⡾⡽⡾⡽⡽⢷⢽⢝⢏⡇⠄⠄⠄⠄⠄⠄

>⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡣⡫⡪⡪⡪⡪⣪⢾⢳⢳⣧⠗⠁⠄⠄⠄⠄⠄⠄

>⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⣪⡪⣪⣪⡺⡱⡱⣱⣑⢎⢷⢤⢀⡀⠄⠄⠄⠄

>⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⣞⢕⢽⣪⣲⣫⣮⢺⡙⣹⡵⡻⡸⡸⡹⡆⠄⠄⠄

>⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⣳⡱⡱⡹⣕⡮⣪⡜⡏⡇⡇⣇⢇⢇⢏⢦⠄⠄

>⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡗⡕⡕⡟⡴⣇⢇⢇⣗⢏⢎⢎⡮⡪⡪⡣⡄

>⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⡪⢫⡪⡪⡪⡪⡪⡳⣻⡪⡪⣪⡞⡕⡵⡏⡎⡻

>>20448987

the dealerships bank 3 times. 1 America canadian retards sign loan. dealerships wins 1. pass address to cartel. sell to middle east. suburban retards feed it.

.

Anonymous ID: 24eefd Feb. 20, 2024, 5:19 p.m. No.20449048 🗄️.is 🔗kun >>9066

>>20449022

>It is exactly this.

>Cert expired.

>Anon discovered after posting imaginary meme last post.

>>20449003

clear cache reboot browser

Anonymous ID: 674f04 Feb. 20, 2024, 5:19 p.m. No.20449049 🗄️.is 🔗kun >>9076

>>20449016

You should rail some up.

>>20449046

Indeed!

Anonymous ID: f25fa7 Feb. 20, 2024, 5:19 p.m. No.20449051 🗄️.is 🔗kun >>9073

[MISSING CRYING BABY FOOTAGE]

kek

>>20449043

(0)(0)

this one means eyes

>>20449037

Have IRL, just a quick post re image server. Have left message for site admin, hope we're up and running with images soon.

o7

FINAL

#25085 >>20448296

>>20448595, >>20448842, >>20448571 Trump Town Hall with Laura Ingraham

>>20448345 Planefag

>>20448362, >>20448715 The Authoritative Personality (1950), Adorno T. W.

>>20448367 What is Smart Dust?

>>20448411 Tucker Carlson - Mass Immigration is Destroying the United States and No One is Doing Anything About It… Why Journalists are Afraid

>>20448443, >>20448493 @TheJusticeDept has unsealed indictments against two alleged Russian members of the #LockBit ransomware group

>>20448490 Hunter Biden’s Lawyers Lash Out at Special Counsel, Claim Photos on iPhone Are Sawdust, Not Crack Cocaine

>>20448510 Leader of drug trafficking organization, Francisco Rene Luna, imprisoned for international cocaine distribution scheme

>>20448515, >>20448586, >>20448608 Understanding PCR

>>20448555 US To Hit Moscow With New "Major Sanctions Package" Over Navalny's Death

>>20448585 Dog comms: 13 pit bulls euthanized after deadly mauling in Compton

>>20448652 Egypt Stops Use Of US Dollar For Trade - Joins BRICshitters

>>20448677 NY Bill would allow children to consent to medical procedures

>>20448804 Bannon: Trump's Representing The American People, He's Putting You First - Biggest fundraiser in SC for Trump, $6.5 million

>>20448816 Tustin, California: Confirmed Explosion at a shopping center lockdowns and evacuation in place

>>20448871 United Airlines flight #UA354, a Boeing 757-224, diverts after pieces from inner leading edge slat of right-hand wing broke off

>>20448960 [ing] error

>>20449011 What are Immunization Information Systems (IIS)?

>>20449039 (2013) Nikki Haley “Sold Out Port” For $15K

#25085

>>20448987

In PA it’s worth fifty cents

ty BO

Cheers BO

o7

WOT?

>>20449048

tried already

to no avail

>>20449046

Nice.

I guess I can poast when the cert is expired.

>>20449048

>clear cache reboot browser

Just for fun? Because that will do nothing.

>>20448282

>>>20447909 17 goals were scored between the Minnesota Wild and the Vancouver Canucks - this has not happened in a game since 1982

Dean Radin at IONS showed how there was a measurable effect of collective consciousness that showed awareness of 9/11 before it happened.

The more we push "17", the more we manifest it.

>>20449067

best to zip it, tho, right?

>>20449051

[If you're going to lament to the wall, I feel like constructive lamenting would be better, don't you?]

>>20448914

General Research #23075 >>18802004

TIKTOK: CHINESE “TROJAN HORSE” IS RUN BY STATE DEPARTMENT OFFICIALS

https://www.mintpressnews.com/tiktok-chinese-trojan-horse-run-by-state-department-officials/284353/

Amid a national hysteria claiming the popular video-sharing app is a Chinese Trojan Horse, a MintPress News investigation has found dozens of ex-U.S. State Department officials working in key positions at TikTok. Many more individuals with backgrounds in the FBI, CIA and other departments of the national security state also hold influential posts at the social media giant, affecting the content that over one billion users see.

While American politicians demand the app be banned on national security grounds, try to force through an internet surveillance act that would turn the country into an Orwellian state, make clueless statements about how TikTok is dangerous because it connects to your Wi-Fi, it is possible that TikTok is already much closer to Washington than it is to Beijing.

STATE DEPARTMENT-AFFILIATED MEDIA

>>20449067

Always be prepared

>⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀

>⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡤⠘⠁⠀⠀⠈⠉⡦⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀

>⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡤⡾⠛⠋⠙⠻⠛⠾⡯⠀⠀⠀⡤⡴⠒⠂⠉⠙⠿⡿⡾⡤⡀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀

>⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡴⠋⠀⠀⠀⡤⠾⠚⠚⠚⠛⡛⠪⡀⠀⠠⡮⠀⠨⠈⠀⡄⡖⠚⠉⠻⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡀⠀⠀⠀⠀⠀⠀⠀

>⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡸⠁⠀⠀⠚⠁⠀⠀⠀⡀⠀⠐⠠⡀⠀⡩⠶⣬⠦⠁⠰⡯⡿⡋⠀⡦⠾⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠠⠟⡆⠀⠀⠀⠀⠀⠀⠀

>⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡏⠀⠀⠀⠀⠀⠀⡤⠈⠀⠀⡤⡾⡭⡤⡀⠀⡀⡀⡤⡼⠀⠛⠋⡩⠿⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡿⡸⠀⠀⠀⠀⠀⠀⠀

>⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠠⠠⠀⠀⠀⠀⡈⠉⡠⡴⠛⠁⡿⡿⠀⡾⠀⡿⠛⠀⠀⡀⡠⡤⠚⠑⠦⡄⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠸⠰⠁⠀⠀⠀⠀⠀⠀⠀

>⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡰⠏⠇⠀⠀⠀⠀⠀⠀⠙⡻⡿⡿⠿⠿⠛⡩⠾⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠐⡿⡄⠀⠀⠀⠀⠀⠀⠠⡾⡄⠀⠀⡀⡤⡴⡶⡦⠀⠀⠀⠀⠀⠀⠀

>⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡇⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠙⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡀⡴⡿⡿⡿⠀⠀⠸⡿⠶⡤⡈⡿⡿⠿⡩⡴⡿⠿⠋⠀⠀⠀⠀⠀⠀⠀⠀

>⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠠⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡀⡀⡠⡴⡾⡿⡿⡿⡿⡿⡿⡇⠀⠀⠀⠉⡿⡶⡙⡿⡿⡶⡾⡏⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀

>⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠸⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡤⡶⡾⡿⡿⡿⡿⡿⡿⡿⡿⡿⡿⡿⡿⡿⡿⠟⠁⠀⠀⠀⡿⡶⡿⠀⠻⡴⡶⡥⡛⡉⡻⡄⠀⠀⠀⠀⠀⠀⠀⠀⠀

>⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡇⠀⠀⠀⠀⠀⠀⠀⠀⠠⡿⡿⡿⡿⡿⡿⡿⡿⠿⠿⠻⠛⠛⠉⠀⠈⡴⠉⠀⠀⠀⠀⠀⠀⠀⠀⡤⡿⡇⠀⡀⡍⡅⡉⠸⡄⠀⠀⠀⠀⠀⠀⠀⠀

>⠀⠀⠀⠀⠀⠀⠀⠀⡀⡀⡤⡤⡴⡶⡶⡾⡾⡾⡾⡿⡿⡿⡾⡾⡾⡶⡿⡀⠀⠀⠀⠀⠀⠀⠀⡀⠙⠛⠛⠉⠀⠀⠀⠀⠀⠀⠀⠀⡤⡶⠚⠀⠀⠀⠀⠀⠀⠀⠀⠀⠸⠀⠿⠀⡏⡿⠋⠀⡒⠀⠉⡤⡦⠀⠀⠀⠀⠀⠀⠀

>⠀⠀⠀⡴⡾⠀⠀⠿⠻⠫⠩⡉⠑⠉⠉⠉⠛⡿⠀⡿⡿⡿⡿⡿⡿⠀⠀⠀⡄⠀⠀⠀⠀⠀⠀⠀⠉⠉⠀⠀⠀⡀⡰⡤⠤⠚⠈⠁⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡏⠘⠀⡿⡅⠴⠀⡿⡯⡽⡿⠁⠀⠀⠀⠀⠀⠀⠀

>⡠⡾⠿⠻⡿⡿⡿⡿⡦⠀⠀⠀⠀⠙⡤⠀⠀⠀⠀⠀⡻⠀⡟⠉⡄⠀⡀⠿⡤⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡤⠀⡄⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡿⡸⡼⡿⠀⡾⠉⡀⡀⡷⠋⠀⠀⠀⠀⠀⠀⠀⠀

>⡿⡃⠀⠀⠀⠙⡿⡿⡿⡷⠀⠀⠀⠀⠀⠉⠀⡠⠐⠻⡠⡤⡿⡿⠀⠈⡧⡀⠉⠻⡶⡤⡀⠀⠀⠀⠀⠀⠀⡸⠀⠛⡇⠙⡿⡶⡤⡀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠘⡿⡿⠀⠀⠰⡍⡾⠿⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀

>⡿⡁⠀⠀⠀⠠⠈⠿⡿⡿⡦⠀⡀⠔⡠⠶⡧⡾⠀⡿⡿⡿⡿⡿⡿⡿⡄⠻⡶⡀⠀⠀⠉⠻⡿⡾⡶⡶⡿⠀⠀⠀⠻⠄⠀⠀⠀⠉⠻⡶⡄⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡸⠀⠁⠀⠠⠿⡿⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀

>⡿⡧⠀⠀⠀⠀⠀⠀⠹⡿⡿⠺⡀⡾⠉⠉⠀⠀⠀⡤⡶⠀⠀⡿⡿⡿⡧⡤⡈⠻⡿⡤⡘⠀⠀⠀⠀⡠⡿⡿⡶⡄⠀⡿⠀⠀⠀⠀⠀⠀⠈⠁⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡇⠻⡦⡀⠋⠦⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀

>⠿⡿⠀⠀⠀⠀⠀⠀⠀⠈⠻⡮⡿⠀⡀⠀⠀⠀⠀⠀⠀⠉⠉⠉⠉⠉⠙⠻⡿⡿⡤⡀⠙⠿⡦⡤⡾⡋⡿⡿⡿⠀⠿⠉⠀⠀⠀⠀⠀⠀⠀⠀⠻⡦⠀⠀⠀⠀⠀⠀⠠⡾⡧⡾⠀⠛⠿⠀⡿⡶⡀⠀⠀⠀⠀⠀⠀⠀⠀⠀

>⠘⡿⡷⠀⠀⠀⠀⠀⠀⠀⠀⡿⡿⡿⡿⡶⡀⠀⠀⠀⠀⠀⠀⠀⡀⠀⠀⠀⠀⠀⠉⠻⠀⡿⡶⡤⡤⡤⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠠⠀⠀⠙⡷⠀⠀⠀⠀⠀⠸⡿⠈⠻⠶⡤⡀⠂⠀⡼⠁⠀⠀⠀⠀⠀⠀⠀⠀⠀

>⠀⡿⡿⠀⠀⠀⠀⠀⠀⠀⠸⡿⡏⠀⠈⡻⡿⡦⡈⠈⠛⠿⡦⡄⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠿⡦⡀⠹⠀⠀⠀⠀⠀⡸⡿⡆⠈⠸⠀⠀⠀⠀⠀⠸⡆⠀⠀⠀⠀⠀⠀⠀⠀

>⠀⠸⡿⡇⠀⠀⠀⠀⠀⠀⠸⡿⡇⠀⠀⠈⠻⡿⡿⡦⠀⠀⠈⠀⡿⡶⡀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡀⠀⠹⠀⡀⠀⠠⠀⡿⠁⠀⠉⠻⠀⡿⠀⡿⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀

>⠀⠀⠀⡿⡄⠀⠀⠀⠀⠀⠀⠀⡇⠀⠀⠀⠀⠈⠻⡿⡿⡄⠀⠀⠙⡿⡿⡄⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠹⡇⠀⠀⠹⡿⡦⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡿⠀⠀⠀⠀⠀⠀⠀⠀

>⠀⠀⠸⡿⠀⠀⠀⠀⠀⠀⠀⠹⡿⡄⠀⠀⠀⠀⠀⠠⠀⠁⠀⠀⠀⠀⠻⡿⡀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡀⠤⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡤⡿⡿⠀⠀⠀⠉⡿⠟⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡼⡿⠀⠀⠀⠀⠀⠀⠀⠀

>⠀⠀⠀⡿⡿⡇⠀⠀⠀⠀⠀⠀⠻⡿⡀⠀⠀⠀⠀⠀⠀⡶⡶⡤⡀⠀⠀⠙⡿⡄⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠈⠿⡿⠀⠀⠀⡿⠏⠀⠀⠀⠀⠀⠀⠀⠀⠀⠠⡾⡿⡿⠀⠀⠀⠀⠀⠀⠀⠀

>⠀⠀⠀⠘⡿⠀⠀⠀⠀⠀⠀⠀⠀⠻⡿⡦⠀⠀⠀⠀⠀⠀⠙⡿⡿⡿⡿⡦⡬⡿⠀⡦⡀⠀⠀⠀⠤⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠙⠀⡷⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡿⡿⠁⠀⠀⠀⠀⠀⠀⠀⠀

>⠀⠀⠀⠀⠿⡿⡿⠀⠀⠀⠀⠀⠀⠀⠻⡿⡶⠀⠈⠀⠀⠀⠀⠀⠀⠉⠙⠛⠻⠛⠛⠻⡿⠀⡿⡶⡤⡤⡀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠹⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠘⡿⡿⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀

>⠀⠀⠀⠀⠀⡿⡿⡆⠀⠀⠀⠀⠀⠀⠀⠿⡿⠀⡄⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠉⠛⠀⡿⠀⡿⡶⡦⡤⡤⡤⡤⡤⡤⡶⡶⡦⠀⠀⠀⠀⡆⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡿⡿⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀

>⠀⠀⠀⠀⠀⠹⡿⡿⡀⠀⠀⠀⠀⠀⠀⠀⠿⡿⡿⡀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠉⠛⠛⡻⠀⠀⠛⠛⠻⠀⠀⡦⡤⡀⠠⡿⡿⠀⠀⠀⠀⠀⠀⠀⡠⡀⡠⠀⡿⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀

>⠀⠀⠀⠀⠀⠀⠿⡿⠀⡀⠀⠀⠀⠀⠀⠀⠀⡿⡿⠀⡀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡤⡶⡿⡿⠿⠟⠿⡶⡤⡶⡿⡿⡟⠻⠿⠿⡿⠀⠀⡶⡄⠀⠀⠀⠀⠀⠀⠀⠀

>⠀⠀⠀⠀⠀⠀⠈⡿⡿⡧⠀⠀⠀⠀⠀⠀⠀⠻⡿⡿⡧⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠼⠛⠉⠀⡤⡿⡿⠀⠀⠋⠀⡀⠀⠀⠀⠀⠉⡿⠀⠀⠀⠀⡿⡶⡄⠀⠀⠀⠀⠀

>⠀⠀⠀⠀⠀⠀⠀⠹⡿⡿⡤⠀⠀⠀⠀⠀⠀⠘⡿⡿⡿⡄⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⡀⠀⠀⠀⠀⠀⠀⠀⠈⠈⡶⡰⡾⡿⡿⡷⡁⣬⡶⡦⡤⠀⠀⠁⠀⡟⠀⠀⠀⡿⠀⡿⠀⡷⡤⡀⠀⠀⠀

>⠀⠀⠀⠀⠀⠀⠚⠻⠿⠿⠀⡿⠀⠀⠀⡿⠀⠀⡿⡿⡿⡧⡄⡀⡠⡀⡀⠀⠀⠀⠀⠀⠀⠀⠀⠠⠰⠲⡒⡠⡤⡤⡤⡴⡶⡶⡶⡾⡾⡿⠷⠋⠉⠉⠉⠉⠉⠛⠛⠿⡛⠛⠛⠛⠻⠻⠻⠻⠿⠿⠿⠛⠛⠛⠛⠛⠛⠻⠺⠚

>⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠉⠉⠛⠛⠀⠀⠿⠿⡿⡿⡿⠀⠀⠀⠿⠿⠿⠻⠛⠛⠉⠉⠉⠁⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀⠀

>>20449049

Stupid, smart dust having plastic was my find. and I extrapolated on more ingredients that need to be investigated. You need to do work instead of being a smart alec.

WHITE SQUALL

>>20449071

FRESH

>>20449075

because board larps and personas don't need no fucking certificate

Kirk Cameron Warns Of Marxist Infiltration: If You Break Up The Family, "You Control The Future"

Religion is a sickness now and its related to J6. They link every wild conspiracy theory.Much worse than our theories that we prove

10:15

https://rumble.com/embed/v4c0jyh/?pub=4

>>20449076

I I I me me my shill continues.

Otay way to get on it! Tanks

>>20449000

449

>>20449048

>clear cache reboot browser

What a fucking retard I am.

Now, all my filters are gone and I am actually worse off.

Thanks bro

sarchasm.png

https://ascii-generator.site/

https://fsymbols.com/text-art/

░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░

░░░░░░░░░░░░░░░░░░░░░░░░░░▒▒▒▒▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░

░░░░░░░░░░░░░░░░░░░░░▒▓▓▓▒▓▓▓▓▓▓▓▓▒▒▓▓▓░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░

░░░░░░░░░░░░░░░░░░░░░░▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░

░░░░░░░░░░░░░░░░░░░░░░▒▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▒░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░

░░░░░░░░░░░░░░░░▒▒▒▒▒▓▓█████▓█▓█▓█████▓▒▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░

░░░░░░░░░░░░░░░░░░▒▒▒▓▓▓████▓▓▓▓▓████▓▓▒▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░

░░░░░░░░░░░░░░░░░░░░▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▒▒▒▒▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░

░░░░░░░░░░░░░░░░░░▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░

░░░░░░░░░░░░░░░░░░▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░

░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░▒▒▒▒▒▒▒▒▒▒▒▒▒░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░

░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░▒▒▒▒▒▒▒▒▒░░░░░░░░░░▒░░░░░░░░░░░░░░░░░░░░░░

░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░▒▒░▒▒▒▒▒▒▒▒▒▒░░░░░░░░░▒▒▒▒░░░░░░░░░░░░░░░░░░░

░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░░▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒░░░░░░░▒▒▒▒░░░░░░░░░░░░░░░░░░

░░░░░░░░░░░░░▒▒▒▒▒▒▒▒▒▒▒▒▒░░░░░░▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒░░░▒▒▒▒▒░░░░░░░░░░░░░░░░░

░░░░░░░░░░▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▓▒▒▒▒▒░░░░░░░▒▒▓▒░░░░░░░░░░░░░░░░

░░░░░░░░░░▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒░▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒░░▒░░░░░░▒▒▒▒░░░░░░░░░░░░░░░░

░░░░░░░░░▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒░░░░░▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓▓▒░░░░░░░░░░░░░░░░

░░░░░░░░▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▒▒▒▒░▒▒▒▓▓▓▓▓▓▓▓▓▓▓▓▒▒▒▓▓▒▓▓▓▓▓▓▓▓▓▓▓▓▒░░░░░░░░░░░░░░░

░░░░░░░░▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓████▓▓▓▓░░░░░░░░░░░░░░░

░░░░░░░░▒▒▒▒▒▒▒▒▓▓▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓█▓████▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▒▒▓▓▓▓░░░░░░░░░░░░░░░

░░░░░░░▒▒▒▒▒▒▒▒▒▒▓▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓▒▓▓▓▓███████▓▓▓▓▓████▓▓▒▓▒▒▓▓▓▒░░░░░░░░░░░░░░

░░░░░░▒▒▒▓▓▒▒▒▒▒▒▓▒▒▓▓▓▓▓▓▓▓▓▓▓▓▓▒▒▒▓▓██████▓▓▓▓▓▒▒▓▓████▓▓████▓▓▒░░░░░░░░░░░░░░

░░▒▓▓▒▒▒▒▓▓▓▓▒▒▒▒▓▒▒▒▓▓▓▓▓▓▓▓▓▓███▓▓███████▓▒▒▒▓▓▒▒▒▒▓█▓▓▓▓▓▓▓▓▒▒▒░░░░░░░░░░░░░░

░░████▓▒▒▒▒▓▓▓▒▒▓▓▒▒▒▒▓▓▓▓▓▓▓▒▒▒▓▓▓▓▓▓▓▓▓█▓▒▒▒▒▒▒▒░░░░▒▓██▓▓▓▓▓▒▒░░░░░░░░░░░░░░░

░░██▓▓▓▓▓▓▓▓▒▓▓▒▓▓▓▓▓▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓▓▒▒▒▒▒▒▒░░░░░░░▒▒▓▓▓▓▒▒░░▒░░░░░░░░░░░░░

░░▓▓▒▒▓███▓▒▒▓▓▓▓▓▓▓▒▒▒▒▒▒░░░░▒▒▒▒▒▒▓▓▒▒▒▒▒▒▒▓▓▒▒░░░░░░░░▒▒░░░░░▒▒▒░░░░░░░░░░░░░

░░▒▓▓▓▓▓██▓░▒▒▓▓▓▓▓▒▒▒▒▒▒▒▒▒▒░░░░▒▒▒▒▒▒▒▒▒▓▓▓▒▒░░░░░░░░░░▒░░▒░░░░▒▒░░░░░░░░░░░░░

░░░▒▓▒▓▓▓▓▒▒▓▓▓▓▓▓▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▓▒▒░░▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒░░░░░░░░░░░░░

░░░░▒▓▒▒▒▒▒▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓███▓▓▓▓▒▒▓▓▓▓▒▒▒▓▓▒▒▒░░░░░░░░░░░░░

░░░░░▒▓▓░░░░▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▒▒▒▒▒▒▒▒▒▓▓▒▒▒▓▓▓▓▓▓███████▓▓▒▒▒▒▒▓▓▓▓▒░░░░░░░░░░░░

░░░░░░▒▒▒▓▓▓▓▓▓▓█▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▒░░░░░▒▒▒▒▓▓▓██████▓▓▒▒▒▒▓▓▓▓░░░░░░░░░░░░

░░░░░░░░▒▒▒▒▒▓█▓▓██▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▒▒▒▒▒▒▒▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▒▓▓▓░░░░░░░░░░░░

░░░░░░░░░▒▓▓▓▓██▓████▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▒▒▒▓▓▓▓▓███▓▓▒▒▒▒▒▒▒▒░░▒▒██▓▓▓▓░░░░░░░░░░░░

░░░░░░░░░░░▒▒▓██▓▓█████▓▓▓▓▓▓▓▓▓▓██▓▓▓▓▓████▓▓▒▒░▒▒▓▓▓▓▓▓▓▓▓▒▒▒███▓█░░░░░░░░░░░░

░░░░░░░░░░░░▒▓▓█▓▓▓████████████████▓▓█████▓▓▓▒▒▒▒▓▓▓▓▓▓█▓▓▓▓▒▒▒▓██▓▓░░░░░░░░░░░░

░░░░░░░░░░░▒▒▒▓█▓▓███████████████████████▓▓▓▓▓▓▓▓▓▓▓▓▓▓█▓▓▓▓▓▓▓████▓░░░░░░░░░░░░

░░░░░░░░░░░▒▒▒▓▓▓▓▓█████████████████████▓▓▓▓▓▓▓▓▓▓▓▓▓▓███▓▓▓▓▓▓████░░░░░░░░░░░░░

░░░░░░░░░░▒▒▒▒▒▒▓▓▓██████████████████████████▓▓▓██▓▓▓█████▓▓██████░░░░░░░░░░░░░░

░░░░░░░░░░▒░▒▒▒▒▓▓▓█████████████████████████▓▓▓█████████████████▓░░░░░░░░░░░░░░░

░░░░░░░░░░░░░▒▒▒▓▓▓▓███████████████████████████████████████████▓░░░░░░░░░░░░░░░░

░░░░░░░░░░░░░░▒▒▒▓▓▓▓█████████████████████████████████████████▒░░░░░░░░░░░░░░░░░

░░░░░░░░░░░░░░░▒▓▓▓▓▓█████████████████████████████████████▓▓▒░░░░░░░░░░░░░░░░░░░

░░░░░░░░░░░░░░░░▒▒▓▓▓▓▓███████████████████████████████▓▓▒░░░░░░░░░░░░░░░░░░░░░░░

░░░░░░░░░░░░░░░░░░░▒▓▓▓▓▓████████████████████████████▓░░░░░░░░░░░░░░░░░░░░░░░░░░

░░░░░░░░░░░░░░░░░░░░░▒▓▓▓▓███████████████████████▓▓▓█▓░░░░░░░░░░░░░░░░░░░░░░░░░░

░░░░░░░░░░░░░░░░░░░░░░░░▒▓▓▓▓▓██████████████████▓▓▒▓█░░░░░░░░░░░░░░░░░░░░░░░░░░░

░░░░░░░░░░░░░░░░░░░░░░░░░░░▒▓▓▓▓███████████████▓▓▓▓▒░░░░▒░░░░░░░░░░░░░░░░░░░░░░░

╣╢╢╢╣╣╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╣▒▒╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢

╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╣╣╢╢╢╢╢╢▓▓▓▓▓╢╢╢╢╢╢╢╣╢╣╣╢╢╣╣╣╣╣╣╣╣╣╢╣╣╣╣╣

╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╣╢╢╢╣╣╢╢╢╣╢╢╣╣╣╣╢╣╢╣╣╢╢╣▒▓▓▓▓▓▒╣╣╣╣╢╣╣╣▒╣▒╣▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒

╢╢╢╢╢╢╢╢╢╢╢╢╢╣╢╣╣╢╣╣╢╢╢╢╢╢╣╣╣╣╣╣╣╣╣╣╢╢╢╣▒▒▒▒▓▓▓▓▓▓▓▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒

╢╢╣╢╢╣╣╣╣╣╣╣╣╢╣╣╣╢╣▒▒▒▒▒▒▒▒▓▓▓▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒

╣╣╣▒╣╣▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▀███▒▒▒▒▓▓▒▒▒▒▓▓▓▓▓▓▓▓▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒

▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▀▓██▓▓▓▓▒▒▓▓▓▓▓▓▓▓▓▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒

▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒█▓▓▓▓▓▒▓▓▓▓▓▓▓▓▓█▓▓▓▓▓▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒

▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓█████████▄▄▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒

▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓███████▓▓▓▓▓▓▓▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒

▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓█▓▓▓▓▓▓█████░▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒

▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▀▀▓▓▄▄▄▒▄▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓▓████▀▀▀▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒

▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒█████▓▓▓▓▓▓▓▓▓▓▓▓▓██████▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒

▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▓▓▓▒▓▓▓▓▓▓▓▓▓▓▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒

╣╣╣╣▒▒▒▒╢▒▒▒▒▒▒▒▒▒▒▒▒▒▓▓▓▒▒▓▓▓▓▓▓▓▓▓▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒

╢╣▒╢▒▒▒▒▒╢╢▒╢▒▒▒╢▒▒▒▓▓▓▒▒▒▓▓▓▓▓▓▓▓▒▒╣▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒

╢╢╢╢╢╢╢╣╣╢╣╢╢▒╢╣▒╢▒▒▒▒▒╢▓▓▓▓▓▓▓▓▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒╣▒▒▒▒╢▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒

╢╢╢╢╢╢╢╢╢╢╢╣╢╢╢╣╣╣╣╣╢╣▒▓▓▓▓▓▓▒╣╢╣╣╣╣╣╢╣╣╣▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒

╢╢╢╢╢╢╢╢╣╣╢╣╢╢╢╢╢╢╢╣╢▓▓▓▓▓▓▒╣╢╢╣╣╢╣╢╢╣╢╣╣╣╣╢╣▒╢▒╣╣▒╣╢▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒▒

╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢▒▓▓▓▓╢╢╢╢╢╢╢╣╢╣╣╣╢╢╣╣╣╣╣╣╣╢╣╣╣╣╣╣╣╣╣╣╣╣╣╣╣╣╣╢╢╣╢╢╢╢╣╣▒╣╣▒╢▒▒▒

╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢╢▒▒▒▒╢╢╢╢╢╢╢╢╢╢╢╢╢╣╣╢╢╢╣╣╢╢╢╢╣╢╢╣╢╣╣╢╣╣╣╢╣╣╣╣╣╣╣╣╣╣╢╣╣╣╣╣╢╣╣╢╢

>>20449077

>>20449086

>Now, all my filters are gone and I am actually worse off.

CLASSIC Q RESEARCH OUTCOME

>>20448392

no text.

no sauce

nothing