Anonymous ID: 2ef6f6 Q Research General #25085: Out of Time Edition Feb. 20, 2024, 3:13 p.m. No.20448278   🗄️.is 🔗kun

Welcome to Q Research General

 

We are researchers who deal in open-source information, reasoned argument, and dank memes. We do battle in the sphere of ideas and ideas only. We neither need nor condone the use of force in our work here.

 

"We hold these truths to be self-evident: that all men are created equal; that they are endowed by their Creator with certain unalienable rights; that among these are life, liberty, and the pursuit of happiness."

 

VINCIT OMNIA VERITAS | SEMPER FIDELIS | WWG1WGA | QRESEARCH

 

Q's Latest Posts

>>18284019 Nov. - Dec. 2022

 

Q's Private Board

>>>/projectdcomms/ & Q's Trip-code: Q !!Hs1Jq13jV6

 

Find Q drops here

Qresear.ch/q-posts, Qanon.pub, Qalerts.pub, OperationQ.pub. Qposts.online, 8kun.top/qresearch/, Qalerts.app, Qalerts.net, douknowq.com/134295/Q-Anon-Pub.htm8ku

Q Posts Archives

* Q Map & Mirrors PDF: SCRIBD: https://www.scribd.com/document/419874308/Q-Anon-The-Storm-X-VII?secret_password=55SQ1tCYhuNR8ESzm50u

* Q Posts Archive, Searchable, interactive with user-explanations: qanon.pub qanon.app

* Q Posts Archive + RSS, Searchable, Analytics, Offsite Bread Archive: qanon.news

* Q Raw Text Dumps: q-clock.com/q_raw.txt

* Q Original, full-size images Q has posted: https://postimg.cc/gallery/29wdmgyze/

* Q Research Memo & OIG Report Links: 8kun.top/qresearch/res/426641.html#427188

* Q Research Notables: Archive Board >>>/qnotables/

* Q Adjacent infographs and moar: https://deepstatemappingproject.com/

 

Q Research Board

Key Resources below. Check Dough Resource thread for more: >>17225239

New to QR?

>>17240320 Welcome to Q Research | >>20424387 Board Info

Join Us

>>17322509 LEARN TO BAKE | >>17322518 E-BAKE Instructions

>>20440436 MEME WARRIOR UI 1.2 updated Feb 19, 2024 NEW

Threads

>>17253611 Dedicated Resource Threads

>>17242392 Q Encyclopedia & >>17242386 Q Video by Archive Anon

TOR Access

TOR URL: http://w7m432cocr665kf5tlpcxojwldajr3njd2etcxwhpbrt44eemuxhp7ad.onion/qresearch/catalog.html

TOR Banner: https://www.youtube.com/watch?v=MLCupx1UExg

Anonymous ID: 2ef6f6 Feb. 20, 2024, 3:14 p.m. No.20448281   🗄️.is 🔗kun

International Q Research Threads

>>20092798 ——–——– Australia #34

>>20362754 ——–——– Canada #53

>>16694358 ——–——– France #7

>>19988670 ——–——– Germany #106

>>20187083 ——–——– Japan #21

>>16694250 ——–——– Nederland #10

>>17784579 ——–——– QAJF #1

>>20038152 ——–——– Scotland #9

>>19636057 ——–——– South Africa #12

>>19804572 ——–——– UK #51

 

GLOBALS

Bunker = https://endchan.org/qrbunker/catalog.html

>>20022853 Posting Guidelines

>>19832150, >>19957123, >>19737197 SPAM Removal; >>20184855 Jim W. on spam

>>19089056 Ban lifts, video downloads, Q clock, Joe M's videos, Qagg Download

>>18024378, >>18561054 Updated PROTO Instructions

>>20186509 How to filter namefags

''Bakers:''

>>19089065 Baking Tools & Guidelines - NEW BAKERS, PLEASE READ

>>17322509, >>17322518 How to bake/e-bake

>>17835052 Formatting Q posts

>>20186534 No "Muh Joos" in notes. Discrimination based on race or religion will be removed

Plz sign out clearly when e-baking or ghosting, use RED TEXT

Anonymous ID: 2ef6f6 Feb. 20, 2024, 3:14 p.m. No.20448282   🗄️.is 🔗kun

NOTABLES ARE NOT ENDORSEMENTS

 

#25084 >>20447499

>>20447605, >>20447833, >>20447891 Planefags

>>20447611, >>20447618, >>20447649, >>20447747, >>20447758, >>20447780, >>20447983, >>20448013 Mil tweets

>>20447615 NYC Trump ruling draws strong backlash

>>20447651 IRS Asks Americans to Report Income From 'Illegal Activities'

>>20447659 The ‘Wolf of Wall Street’: Trump ‘will win’ in NY somehow

>>20447663, >>20447664 Famous fossil is really just paint, rocks and a couple of bones, researchers say

>>20447676 The Great Red Dragon: The Foreign Money Power in The United States (1890) L.B. Woolfolk

>>20447684 DJT: Town Hall with Donald Trump and Laura Ingraham tonight @ 7PM EST

>>20447716 Accurate reporting from CNN

>>20447746, >>20447761, >>20447783, >>20447811 Everything You Need To Know About The Motions To Disqualify Fani Willis

>>20447772 A new study has concluded sex change surgeries 'do not have an impact on suicide risk'

>>20447815, >>20447778 New York Moves to Begin Vaccinating Children Without Parental Consent

>>20447860 Growing Trend sees local and state law enforcement facilities listing Black and Hispanic offenders race as White

>>20447909 17 goals were scored between the Minnesota Wild and the Vancouver Canucks - this has not happened in a game since 1982

>>20447926 NSA announces the retirement of Rob Joyce, the Director of Cybersecurity and the Deputy National Manager, National Security Systems

>>20447944 (2023) Elon Musk claims the US government had 'full access' to private Twitter DMs

>>20447949 Kyrsten Sinema has spent over $200k of your money on private jets

>>20447955 A plan by President Joe Biden, called an “extortion attempt,” would shield more criminal illegal aliens from deportation

>>20447978 VTA prepares abandoned fleet for auction to recover taxpayer dollars after NBC Bay Area investigation

>>20447992 Some notes from today's KJP press conference

>>20447998, >>20448091, >>20447956 2 adults are charged with murder in the deadly shooting at Kansas City’s Super Bowl celebration

>>20448000 Donald Trump is Right about NATO

>>20448012, >>20448235 The actual crazy shit: Meryl Nass @ EU Parliament

>>20448014, >>20448057 .@realDonaldTrump is wheels down at Greenville-Spartanburg International Airport, in the Great State of SC…

>>20448025, >>20448092 Red Cross Faces Scrutiny as it Requires COVID-19 Vaccinated to Call Hotline to See if They’re Eligible for Blood Donation

>>20448044 Global operation smashes ‘most harmful cyber crime group’

>>20448051 Judge Engoron Accused of Banging Secretary of Opposing Counsel in Previous Case

>>20448055 Tucker Carlson says Boris Johnson wants "a million dollars" from him to talk about Ukraine

>>20448056 3 KFC locations in Chicago join other businesses leaving due to rampant crime

>>20448065 Stella Assange on Julian Assange’s Hearing today - The Same Country Trying to Extradite him Tried to murder Him

>>20448070 Rep. Eric Swalwell spent millions of dollars in campaign funds on his own childcare costs, Four Seasons steakhouses + moar

>>20448071 Body of missing 11-year-old Audrii Cunningham found in river

>>20448076 Government-Backed Censors Who Rigged The 2020 Election Are Now Stealing 2024

>>20448081, >>20448120 What is a FISA?

>>20448082 Trump Truths the Eighth

>>20448089 Nevada’s Democrat Secretary of State Claims ‘Glitch’ Caused Unmailed Nevada Ballots to Show Up as Counted in Recent Primary

>>20448093 Former Obama CIA Chief Michael Morell Donates To Nikki Haley

>>20448098 "Pay your fair share, unless you're my children" -Joe Biden

>>20448100 ‘The Biggest Loser’ trainer and former boxer launches NY Senate bid to knock out Kirsten Gillibrand

>>20448108, >>20448114, >>20448119 ‘I’m Not Going Anywhere’: Haley Vows to Stay in Presidential Race Regardless of South Carolina Results

>>20448110, >>20448117, >>20448133, >>20448156, >>20448183 Opus Dei

>>20448128 CCP invaders using StarLink to use AliBaba in the jungle of Panama to organize their invasion of America and make financial transactions

>>20448132 E. Jean Carroll's Lawyer Says They're Looking to Sue Trump a 3rd Time

>>20448189 Did You Know Alexandria Ocasio-Cortez Was Elected Thanks To A Casting Call Put Out By Democrats?

>>20448196 The Mayor of City of North Las Vegas announces the city will discriminate against white business owners

>>20448200 French government prepared to arrest those who reject 'medical knowledge'

>>20448213 O'Keefe: The @UUCTucson has completely locked down their website

>>20448253 Video shows brazen broad-daylight NYC Gucci store heist — as bandits make daring getaway with $51K in luxury items

>>20448262 Japan has officially lost its spot as the world's third largest economy to Germany, per Bloomberg

>>20448270 #25084

Anonymous ID: 2ef6f6 Feb. 20, 2024, 3:14 p.m. No.20448284   🗄️.is 🔗kun

#25083 >>20446656

>>20446697, >>20446796, >>20446803, >>20446768, >>20446864, >>20446991, >>20447117 Planefag

>>20446711 Russia making moves in Latin America as FM Sergey #Lavrov paid a visit to #Cuba

>>20446750 Everything You Need To Know About The Motions To Disqualify Fani Willis

>>20446770 Time to Recall Members of Congress

>>20446774, >>20446829, >>20447106, >>20447357 Swamp events

>>20446795, >>20446808, >>20446831, >>20446859, >>20446997, >>20447025, >>20447147, >>20447196, >>20447336 Mil tweets

>>20446819 Timelapse of US foreign aid since 1946

>>20446850 Anthony Sabatini Calls Out Establishment "Sneak Attack" To Implement Runoff Elections In Florida Against Gaetz

>>20446874 The Supreme Court's About To "Erase Half Of Jack Smith's Criminal Charges Against President Trump"

>>20446875, >>20446980 WHO Director-General Tedros pleads his case to the World Jury on the vaccine ''mandates''

>>20446879 Mike Davis: "Democrats Hate Clarence Thomas Because Thomas Escaped The Democrat Plantation"

>>20446897 America's most wanted, Davie Albarran, arrested in Polk County for sexual battery charges on a 12 year old victim

>>20446937 Mexican Army Kills 12 Suspected Cartel Members In Shootout Near Texas Border

>>20446943 State Costs of Illegal Immigration

>>20446955 The Missing Crossfire Hurricane Binder - President Trump Demanded its Contents Be Released

>>20446967 Declassified J6 FBI Emails Reveal Private Emails of Top FBI Agents Discussing Julian Assange’s Trial

>>20446988, >>20447030 Haley mocking Christians?

>>20446971 Paoletta: Democrats Are Attempting To Destroy The Courts Following Conservative Judges' Ascension

>>20446976 'Glitch' on Nevada Secretary of State’s website caused unmailed ballots to show up as counted in the recent primary

>>20446977 Manure Dumped in Front of Pelosi’s San Francisco House as Leftists Torment Former Speaker at Home and in DC Over Support for Israel

>>20446984 Former First Lady of Haiti Indicted in Husband’s Assassination, Prosecutors Claim She Attempted to Take Over Presidency

>>20447004 DJT: Speaker Tim Moore is doing a fantastic job leading the North Carolina House of Representative

>>20447010 Musk Reveals Neuralink's First Human Patient Controls Computer Mouse With Mind

>>20447016 Assange Judge Worked For MI6 & Defense Ministry

>>20447031 Biden announces new "major" sanctions on Russia

>>20447035 Lady Gaga interviewed WikiLeaks founder Julian Assange in 2012

>>20447063 Here’s Bill Gates updated stock portfolio

>>20447078 Could Ronna's Replacement Already Be Involved In Election Fraud?

>>20447087 ‘Israeli apartheid worse than what South Africa endured’: ICJ hearings

>>20447095 Judge Engoron Accused of Banging Secretary of Opposing Counsel in Previous Case

>>20447102, >>20447351 Twitter Suspends Then Unsuspends Navalny’s Widow’s Account

>>20447135, >>20446756 Truckers For Trump and Teamster members are starting the mass boycott of NYC deliveries today

>>20447141, >>20447176 The American Red Cross is now asking blood donors if they ever received the Covid vaccine

>>20447161, >>20447207 Russia takes sexy US hostage for allegedly providing support to Ukraine

>>20447230 Five passenger airplanes reached 800mph after strong winds pushed the planes to insane speeds

>>20447285 NYC shelters shipping migrants to Utah

>>20447286 Douglas Murray Announces New Doxing Database to Keep Critics of Israel From Getting a Job

>>20447307 (14 Feb) CIA helped trigger Trump-Russia probe: Matt Taibbi

>>20447309 Refresher: Biden unaware he's being recorded telling a small child that they're sexy and not to tell Mommy

>>20447344, >>20447454, >>20447349, >>20447044 Realtors are Consider Fleeing NY; a Precedent has been set

>>20447345 Law enforcement disrupt world’s biggest ransomware operation

>>20447350 Republicans ask why 9 boxes of Biden records were omitted in Special Counsel report

>>20447355 Yulia Navalny (Alexei's Widow): I will continue the work of Alexei Navalny to continue to fight for our country

>>20447356 Invasian @ Jacumba, CA

>>20447359 Fluorescent glow in the faces of the vaxxed under UV light

>>20447365 Ben Carson: Excited to be in South Carolina to campaign for our next President, @realdonaldtrump

>>20447378 Israeli army to launch probe into 7 Oct failure

>>20447390 Transcript of Tucker / Mike Benz Interview Regarding AI Tools used to Censor

>>20447400 About 1,600 Nike Employees To Be Laid Off

>>20447445 2 Adults Charged With Murder in Chiefs Super Bowl Parade Shooting

>>20447482 #25083

Anonymous ID: 2ef6f6 Feb. 20, 2024, 3:14 p.m. No.20448285   🗄️.is 🔗kun

#25082 >>20445785

>>20445814 Michigan State is now asking residents to house illegals in their homes. How long until this becomes mandatory?

>>20445832 Capital One and Discover are merging - Will be 6th largest bank in US

>>20445871, >>20445920 turbo cancer and excess deaths - twat and youtube vid Dr campbell

>>20445872, >>20445878 "License To Play God": Physician Group Files Brief Against Biden In COVID

>>20445887 @NYCMayor is giving out debit cards to illegal immigrants up to $10,000 each in taxpayer money with no ID check, no restrictions and no fraud control.

>>20445906 Libs of TikTok w/CAP: Illegals ass*ult NYPD officers in the Randall’s Island migrant housing facility

>>20445941 Elon Musk is nominated for Nobel Peace Prize by Norwegian MP who praises him for being a 'stout proponent of free speech'

>>20445947 Ahoy! The Ship Show & Extra Gravy - 02/20/2024

baker change

>>20445847, >>20446002, >>20446008 DOD contracted injections as 'medical countermeasures', no trials, efficacy, safety

>>20445860, >>20446014, >>20445808, >>20445825, >>20445841, >>20445857, >>20445944, >>20446066, >>20446095, >>20446323, >>20446325 Assange trial LIVE

>>20445862 “NO LIVES WERE SAVED” by the COVID-19 injections, says researcher and scientist @denisrancourt.

>>20445867, >>20446094 ‘Crime of the Century’: Research Raises Horrifying Possibility Covid Patients Were ‘Euthanized’

>>20445876, >>20445881 Ukraine’s AI Drones Seek And Attack Russian Forces Without Human Oversight

>>20445889, >>20446103, >>20446295, >>20446390 Trucker Says Boycotting New York City Is Bigger Than Trump

>>20446020 State Dept. Official on Black Leadership in Foreign Affairs

>>20446028 Lockbit cybercrime gang faces global takedown with indictments and arrests

>>20446029, >>20446038, >>20446042, >>20446045, >>20446271, >>20446284, >>20446302 American ballerina Ksenia Karelina detained 'high treason' in Russia

>>20446034 The Future of Pakistan and U.S.-Pakistan Relations Center for Strategic and International Studies (CSIS)

>>20446068 GoFundMe re calls to shut down DJT fundraiser: This fundraiser is currently within our terms of service

>>20446081 Tucker Carlson Interviews Mike Benz about the surveillance state and censorship

>>20446087, >>20446199 How Chinese Censorship Is Going Global–With Help From US Companies

>>20446100, >>20446200, >>20446245 Sergey Poletaev: 2nd anniversary Russia Ukraine conflict approaches, who has upper hand

>>20446163, >>20446418 Nasa's private IM-1 mission is carrying Hindu guru Pramukh Swami Maharaj to Moon

>>20446185 Per CBP sources, another 208 Chinese nationals apprehended by Border Patrol in San Diego sector yesterday

>>20446196 Joe Biden’s Great-Great Grandfather Pardoned by Abraham Lincoln After Allegedly Committing a Violent Crime

>>20446228 Montana Gov. Greg Gianforte (R) discusses affordable housing challenges event hosted Bipartisan Policy Center

>>20446229 Australia seeks public help to design its 1st moon rover, Roo-ver

>>20446250 Zelensky Complains (Again) that Foreign Aid Delays Are Making Life ‘Very Difficult’

>>20446252 Reflections on Ukraine War W/General Wesley K. Clark, USA (Ret.), the 12th Supreme Allied Commander, Europe

>>20446253 BELARUS TO CRIMINALIZE "LGBTQ PROPAGANDA" AND NOT HAVING CHILDREN

>>20446260, >>20446270 "License To Play God": Physician Group Files Brief Against Biden In COVID

>>20446316 Massive underground laboratory in China joins the quest to find dark matter

>>20446339 Gaetz: ‘I love’ CNN article on cause of ‘brain drain’ in Congress

>>20446378 Pizza Hut worker is arrested for shooting dead manager, 55, over $7,000 inheritance check

>>20446393 The party has 0 infrastructure in place try to register these people..They're going to blow this aren't they?

>>20446508 Daily Press Briefing by Spokesperson Secretary-General, spokesperson President General Assembly UN

>>20446518 Republicans ask why 9 boxes of Biden records were omitted in Special Counsel report

>>20446576 JUST IN - Russia places US Senator Lindsey Graham on 'terrorist and extremist' list

>>20446601 Kim Jong-un receives luxury car as gift from Vladimir Putin?

>>20446644 #25082

 

Previously Collected

>>20445764 #25081

>>20443029 #25078, >>20443831 #25079, >>20444740 #25080

>>20441455 #25075, >>20441317 #25076, >>20442191 #25077

>>20437658 #25072, >>20438526 #25073, >>20439307 #25074

>>20436010 #25069, >>20436126 #25070, >>20436893 #25071

 

Aggregators: https://qresear.ch | https://qnotables.com | https://qproofs.com

Q Research Notables Archive Board >>>/qnotables/

Q Research Notables #21: Purpose >>19961525

Anonymous ID: 8bc9cf Feb. 20, 2024, 3:19 p.m. No.20448318   🗄️.is 🔗kun

Will wokeness ever end? Or is it here to stay 'cause of how the internet works?

I'm re-watching media from the early 2000s and i miss when women were women and it was okay for a woman to be sexy FOR men.

Anonymous ID: 9d9563 Feb. 20, 2024, 3:19 p.m. No.20448319   🗄️.is 🔗kun

>>20448180 LB

 

>if humans were genetically modified into existence in the same way that humans genetically modified the Dog into existence…who created the humans and what purposes do humans serve

 

Don't you see? We did. God does through us.

 

Recognise the signs of the times.

Anonymous ID: 667c26 Feb. 20, 2024, 3:23 p.m. No.20448339   🗄️.is 🔗kun   >>8757

Looking Ahead

 

America can be as free and prosperous as ever if we stand firm on our principles and hew to what has always made America the greatest nation in the history of the world. There is no holding back freedom and American prosperity if we lean on the principles and pillars outlined in this agenda – such as a strong national defense, free markets, traditional values, the right to life, school choice, patriotic education, border security, free, fair, and reciprocal trade, confronting the Chinese Communist party’s aggressive agenda, – and if we keep faith with our Constitution. Securing these pillars is essential to the survival of freedom. The solution to any problem can be found in strengthening American culture, American opportunity, and American leadership. WE, champions of freedom and the Declaration of Independence, are the last line of defense of the Constitution and our American heritage. For our country and our future, for our children and our grandchildren, we must move forward united and with faith in the One who has ever guided the destiny of our land – move forward to ensure that the best days for the greatest nation on earth are yet to come.

Anonymous ID: 0b733c Feb. 20, 2024, 3:25 p.m. No.20448346   🗄️.is 🔗kun

excellent look at migrant crisis in NYC

 

mind blowing - they live in full-service fancy hotels and are paid and provided for, but can't work 7 months after their arrival. they all thank Biden for their circumstance. meanwhile tax-paying Americans continue to struggle and suffer.

Anonymous ID: 99b597 Feb. 20, 2024, 3:28 p.m. No.20448362   🗄️.is 🔗kun   >>8649 >>8715 >>8920 >>9055

"THE AUTHORITATIVE PERSONALITY" Adorno T. W. (1950)

 

Read here: https://archive.org/details/dli.ernet.469826/mode/2up

 

Only 'God's Chosen People' are permitted to have ethnic, religious, racial, social and geographical purity and exclusivity, led by a strong, responsible, loving, patriarchal based, family unit.

For everyone else Equity Diversity and Inclusivity are essential factors in all areas of life with White European Masculinity considered Toxic with a capital T. and must be neutralized.

No more portrayal of 'Masculine White Male Heroes' allowed in your (((their))) media, ask Henry Cavil or any other White Male actor who hasn't been castrated.

Where do all the so called 'Woke' social justice philosophies come from? Certainly not from a grass-roots, fundamental societal (Family) sources.

Anonymous ID: cf489c Feb. 20, 2024, 3:29 p.m. No.20448366   🗄️.is 🔗kun   >>8388 >>8445

>>20448347

maybe the vaxxed have been programmed to reckless behavior that will result in death- like driving into buildings and trees, taking street and big Pharma drugs, more vaxx, suicide, murderous rampages, sacrificing of children, chaos, madness

Anonymous ID: 334c2b Feb. 20, 2024, 3:29 p.m. No.20448367   🗄️.is 🔗kun   >>8376 >>8419 >>8456 >>8649 >>8864 >>8920 >>8953 >>9055

What is Smart Dust?

Smart dust is in the chemtrails. This is why we are seeing a decline in birds and other wildlife. Smart dust has the potential to cause environmental damage. As these sensors are very small and light, they can easily be blown away by wind and end up in rivers or oceans where they are harming wildlife. These are single-use items, and there is no practical way to retrieve them once deployed. Similar to microplastics, smart dust could eventually accumulate in us and the environment and cause irreparable damage.

 

Smart dust is highly intrusive and poses a threat to privacy. Thousands of virtually invisible sensors collecting data on our movements, conversations, and activities without oversight is a significant cause for concern. Fallen into the wrong hands, the data collected by smart dust will be used for nefarious purposes. I assume it already is.

 

https://www.bitchute.com/video/PrxgloqkIduY/

Anonymous ID: 65d375 Feb. 20, 2024, 3:30 p.m. No.20448371   🗄️.is 🔗kun   >>8377

https://youtu.be/Rqacvc9UJfw

Fani Willis HEATED in Disqualification Hearing & Cries Victim At Church

CartierFamily

901K subscribers

2/20/2024

Anonymous ID: 45a5a6 Feb. 20, 2024, 3:32 p.m. No.20448376   🗄️.is 🔗kun

>>20448367

 

>This is why we are seeing a decline in birds and other wildlife

 

Don’t they have seed vaults around the world?

Surely those planners have bird seeds stored.

Anonymous ID: 52b3cc Feb. 20, 2024, 3:32 p.m. No.20448385   🗄️.is 🔗kun   >>8398 >>8479

>>20448055 Tucker Carlson says Boris Johnson wants "a million dollars" from him to talk about Ukraine (PN) Why would anyone want BJ back? Would Nigel actually work with BJ, he's a criminal.

 

10 Dec, 2023 17:21

UK Tories plotting Boris Johnson's comeback – Daily Mail

The ex-British PM is seen by some Tory rebels as being the most formidable opponent to Keir Starmer’s Labour, according to a report

 

Tory rebels are considering a plan to “crash” UK Prime Minister Rishi Sunak’s Conservative government and reinstall Boris Johnson as leader as concerns rise over flagging poll figures and surging support for the opposition Labour Party ahead of an expected general election next year, according to the Daily Mail.

 

Amid the high-profile cabinet departures of former Home Secretary Suella Braverman and Immigration Minister Robert Jenrick, Sunak’s authority over Tory ranks is set to be further tested this week when he faces a pivotal vote over his flagship Rwanda migrant-handling plan.

 

Citing anonymous Conservative MPs, the Daily Mail wrote on Saturday that Tory insiders are urgently attempting to address a growing revolt – with peerages being offered to possible rebels to convince them to toe party lines. The tabloid claims that disgruntled Tories will increasingly seek to “crash” the Sunak government with a series of Commons votes and outspoken interventions, which the newspaper’s sources said is crudely referred to as an ‘Advent calendar of sh*t.’

 

Furthermore, the outlet cites anonymous sources as saying there is a belief within the party that Johnson – who stood down as prime minister in September 2022 – is the only person who possesses the necessary skills to pose a challenge to Labour leader Keir Starmer.

 

The newspaper also notes that the Reform Party, thesuccessor to Nigel Farage’s Brexit Party, is siphoning votes that might otherwise have gone to the Conservatives– with a so-called Johnson/Farage “dream ticket” beingfloated. It also notes that Farage’s appearance on a popular UK reality television series has bolstered support for the Brexit architect.

 

Johnson, who is a columnist for the Daily Mail, did not elaborate on his possible political ambitions when contacted by the newspaper. A spokesperson for Farage, who, like Johnson, is not currently an MP, said that any political alliance between the two would “soon end in tears.”

 

“Reform are going to kill us,” the newspaper cites an anonymous Tory MP as saying. “We have to buy Farage off. The plan is we get him into the Lords, give him some brief like we did with [David] Cameron – maybe even home secretary– then go to the country with the ‘Dream Team.’”

 

Another possibility for a post-Sunak scenario, per the Mail, would be for Johnson ally and former Home Secretary Priti Patel to be appointed as temporary PM while Johnson seeks a ‘safe’ seat in the election – after which he would hypothetically return to Downing Street.

 

Recent polling has indicated that Labour holds a commanding lead over the Tories ahead of the next general election, which must take place before January 2025.

 

https://www.rt.com/news/588843-uk-boris-johnson-tory-rebels/

Anonymous ID: 9111ce Feb. 20, 2024, 3:35 p.m. No.20448396   🗄️.is 🔗kun   >>8410

The jab made people stupid. Moderate thinkers who could still manage critical thinking seem to have gone over to the dark side narrative repetitions after the jabs.

Could the nano particle graphene oxide really have made them antennas to pick up the narratives carried over the wireless airwaves?

seriously? I know that was a theory, but it seems to have borne fruit.

How do we pipe them free thinking again?

Anonymous ID: caf1df Feb. 20, 2024, 3:36 p.m. No.20448402   🗄️.is 🔗kun   >>8412 >>8459

https://jonathanturley.org/2024/02/20/pay-to-play-trump-faces-a-staggering-cost-for-appeal/

 

Trump supposedly has to come up with hundreds of millions of $ just to get an appeal.

 

How is that fair?

Anonymous ID: 94c52b Feb. 20, 2024, 3:38 p.m. No.20448411   🗄️.is 🔗kun   >>8649 >>8920 >>9055

Tucker Carlson - Mass Immigration is Destroying the United States and No One is Doing Anything About ItWhy Journalists are Afraid

 

https://rumble.com/v4eofsi-tucker-carlson-mass-migration-is-destroying-america-and-no-one-is-doing-any.html

Anonymous ID: 7db628 Feb. 20, 2024, 3:42 p.m. No.20448435   🗄️.is 🔗kun

https://twitter.com/WallStreetApes/status/1759948784904126620

 

AOC Is A Political Actor

 

Did You Know Alexandria Ocasio-Cortez Was Elected Thanks To A Casting Call Put Out By Democrats?

 

AOC’s Brother Submitter Her Application & She Was Chosen By The Executive Director of Justice Democrats Out Of 10,000 Candidates

 

It’s All On Camera. Here’s The Story, Watch To The End To See Footage Of AOC & Alexandra Rojas Confirming This On Camera

 

“Alexandria Ocasio Cortez is not really the congresswoman of New York's 14th congressional district.She is essentially an actress. She's merely playing the part of a New York congresswoman.I know this sounds crazy, but bear with me. In 2017, a group called the Justice Democrats held auditions for potential congressional candidates that they would run on their platform for various congressional seats throughout the country.

 

Alexandria Ocasio Cortez's brother Gabriel submitted her for the role. Now I've auditioned for many acting roles in my day. I've also cast many of my own projects. I know how this works. If you find somebody with star power, even if they don't 100% fit the part, you go with it.

 

Obviously, AOC has star power. Just look at her. She's a superstar, the most famous person in Congress, maybe ever. Their casting was perfect. Now I didn't have to go digging for evidence for this because they freely admit it.

 

They brag about it.”

 

Alexandra Rojas Executive Director of Justice Democrats “Back in 2016, we put out a call for nominations. We got over 10,000 nominations. Out of those 10,000 nominations, we found Alexandria.”

 

Alexandria Ocasio-Cortez “My brother told me that he had sent my nomination in the summer, but I was, like, literally working out of restaurant. It's like, there's no way.”

 

“- A casting call. They had a casting call. They cast Alexandria Ocasio Cortez in the role of congresswoman.”

Anonymous ID: 3afed9 Feb. 20, 2024, 3:43 p.m. No.20448439   🗄️.is 🔗kun   >>8536

>>20448401

>>20448401

>Trump can't take credit for Warp Speed

 

surely such fake narratives were anticipated by PDJT well in advance!

 

he knew other people would try to take the credit, and he told everyone at CPAC to never let them!

 

because the Trump Administration is fully responsible for the vaccine, said POTUS at CPAC!

 

AFTER he left office!

vidrel

23:15 begins vaccine review and credits

 

https://youtu.be/9kL9KiUNoZQ

Anonymous ID: 15bc06 Feb. 20, 2024, 3:44 p.m. No.20448443   🗄️.is 🔗kun   >>8649 >>8920 >>9055

The Record From Recorded Future News

@TheRecord_Media

5h

.@TheJusticeDept has unsealed indictments against two alleged members of the #LockBit ransomware group, Artur Sungatov and Ivan Kondratiev, also known as Bassterlord. The Treasury Department also announced sanctions against them.

 

Feb 20, 2024 · 6:27 PM UTC

https://twitter.com/TheRecord_Media/status/1760008351906242654

Anonymous ID: 501cc3 Feb. 20, 2024, 3:45 p.m. No.20448445   🗄️.is 🔗kun   >>8614 >>8629

>>20448366

The social credit system was the driving force behind control over the vaxx and lock downs inside chyna. Now analyse those who complied with vaxx and lockdown measures outside of chyna where no "social credit" app exists (yet) and people still did as thy were told through social manipulation and taking sides with a misguided morals.

Anonymous ID: 21b84f Feb. 20, 2024, 3:46 p.m. No.20448449   🗄️.is 🔗kun   >>8454

>>20448416

I would wager

That Cargill

Stole all their land with the new shipping ports on the Amazon and Congo basins

Then they get counted and given an A number

So that they can borrow on their asses

Just like they did you

Anonymous ID: f25fa7 Feb. 20, 2024, 3:47 p.m. No.20448454   🗄️.is 🔗kun   >>8462

>>20448449

since you have ttwo posts I think you are paid by BEHAVIOUR MATRIX 120 k a year.

 

But still you are really just a VPN piece of shit for the cyber engagement center

 

/filtered

Anonymous ID: 58ddd7 Feb. 20, 2024, 3:52 p.m. No.20448476   🗄️.is 🔗kun

What english accent is this?

 

(Video of a mercenary in Avdiivka)

 

Anon hears two accents, American (calling FUCK, let me get back there for a minute) and Australian (you're OK mate… can you get up, you gonna have to get up)

Anonymous ID: 501cc3 Feb. 20, 2024, 3:52 p.m. No.20448479   🗄️.is 🔗kun   >>8502

>>20448385

I'm just going to nix this in the bud. NO, Bojo is not making a comeback in the Conservative party. He is a remnant of the old tory gang. Cameron is also, but is a different fish (or pig) all together. Eyes need to be on him and Samantha.

Anonymous ID: 3bb96a Feb. 20, 2024, 3:53 p.m. No.20448488   🗄️.is 🔗kun   >>8513

>>20448469

No one is guilting anyone. I forgive you for your projections. You consider forgiveness as weakness when it couldn't be further from the truth. It makes you stronger. God bless you, and thank you for baking.

Anonymous ID: 2aa2d0 Feb. 20, 2024, 3:54 p.m. No.20448490   🗄️.is 🔗kun   >>8512 >>8554 >>8621 >>8649 >>8670 >>8852 >>8920 >>8971 >>9012 >>9055

We all photograph sawdust, dont we ?

 

Hunter Biden’s Lawyers Lash Out at Special Counsel, Claim Photos on iPhone Are Sawdust, Not Crack Cocaine

https://www.thegatewaypundit.com/2024/02/hunter-bidens-lawyers-lash-special-counsel-claim-photos/

 

Hunter Biden’s lawyers lashed out at Special Counsel Dave Weiss and claimed photos on Hunter’s iPhone are sawdust, not crack cocaine.

 

The Justice Department last Tuesday released photos from Hunter Biden’s iPhone showing his use of cocaine, crack cocaine, and drug paraphernalia.

 

Last year, Hunter Biden was indicted on federal gun charges. He faced indictment in a Delaware court on three counts relating to his possession of a firearm while using drugs.

 

These charges include one count of making a false statement in the purchase of a firearm, one count of making a false statement related to information required to be kept by a federal firearms licensed dealer, and one count of possession of a firearm by a person who is an unlawful user of or addicted to a controlled substance.

 

The Gateway Pundit reported back in October 2020 that his then-lover and deceased brother’s widow, Hallie Biden, tossed the gun in the trash. Hunter admitted this in an online conversation with his family when they accused him of inappropriate conduct in front of a child.

 

Five years after Hallie Biden discarded his firearm in a trash can behind a Delaware grocery store, the weapon underwent further examination by FBI officials, according to the New York Post.

 

According to a court filing by Special Counsel David Weiss, FBI agents retrieved the sealed Colt Cobra 38SPL revolver from a state police vault. They photographed the weapon and noticed white powder on the pouch that contained the firearm.

 

The DOJ released photos from Hunter Biden’s iPhone showing his illicit drug use to prove he was addicted to drugs while he lied about it on a federal firearm form.

 

Hunter’s lawyers attacked the special counsel in a court filing on Tuesday.

 

“Mistaking sawdust for cocaine sounds more like a storyline from one of the 1980s Police Academy comedies than what should be expected in a high-profile prosecution by the U.S. Department of Justice,” Hunter Biden’s lawyer said in a court filing.

Anonymous ID: f25fa7 Feb. 20, 2024, 3:55 p.m. No.20448497   🗄️.is 🔗kun

commie marxist socialist globalist terrorist nazi leninist maoist fascist eugenicist pedoist zionist and identity fraud who hold government office are stealing money and putting the blame for war crimes on us when we can't control the US government anymore.

 

These fucking trans national war criminals have conspired to KILL EVERY AMERICAN.

 

The SHERIFF PROTECTS THESE MOTHERFUCKERS!!!

https://www.youtube.com/embed/8leaZ7GzjmM

Anonymous ID: 31d6f5 Feb. 20, 2024, 3:56 p.m. No.20448499   🗄️.is 🔗kun   >>8507

>>20448463

kek

They thought he was one of them.

That's why they hate him so much because he knows all of their dirty tricks, and is always several steps ahead of them.

Anonymous ID: 2029b0 Feb. 20, 2024, 3:56 p.m. No.20448501   🗄️.is 🔗kun

‘Don’t touch the kids,’ Putin tells gays

 

Adults can live and let live, but children are off limits, the president warned

 

Russia is actually tolerant of people with non-traditional sexual orientations, so long as they don’t target children or flaunt their preferences, President Vladimir Putin said on Tuesday.

 

The president made the remarks while addressing visitors to the ‘Strong Ideas for a New Time’ forum, a yearly event organized by Russia’s state-backed Agency of Strategic Initiatives.

 

“We are quite tolerant towards people with non-traditional sexual orientations. We just don’t flaunt it, and we don’t believe it’s right to flaunt it. Let everyone live – the adults – as they want. Nobody limits them in anything,” Putin stated, explaining that, basically, there are only a handful of rules which limit the LGBTQ community in the country.

 

As for children, I have already said many times: ‘Don’t touch the children.’ That’s it. This is the first one. And the second one is, we are, first and foremost, a state that is guided by traditional values.

 

Over the past few years, Russia has gradually tightened its legislation aimed at countering the spread of what it calls “LGBT ideology.” The drive began in 2013, when the dissemination of said propaganda was outlawed among minors.

 

The ban was reinforced in December 2022, when new legislation introduced major fines for anyone found guilty of promoting “non-traditional sexual relations,” pedophilia, and transgenderism among minors and adults alike.

 

Late last year, the Supreme Court of Russia outlawed the “international LGBT public movement,” designating it as extremist. The ban stemmed from a lawsuit filed by the Russian Justice Ministry, which asked the top court to do so, arguing that the movement has been involved in “incitements of social and religious discord” as well as exhibiting unspecified “extremist traits.”

 

The extremist designation has been harshly criticized by multiple rights groups in the West, which have argued that it is “absurd” and vague, and that it has had a “catastrophic” effect on the LGBTQ community in Russia. The inclusion of any group in Russia’s “extremist organizations” list effectively bans all of their activities and outlaws all of their associated symbols.

 

https://www.rt.com/russia/592788-gays-welcome-putin-says/

Anonymous ID: 312af8 Feb. 20, 2024, 3:57 p.m. No.20448505   🗄️.is 🔗kun   >>8739

Wow, just tried to red-pill someone on Trump's goodness by using the whole Trump Sneaker thing. I thought if they actually knew someone who got in on buying the sneakers that they would say “Oh, if it worked for you then there must be something to it.” Nope, nothing. He just kept saying “no one is making money on these sneakers.” I say, “Sure they are look on eBay.” He says, “eBay has all kinds of scams, you won’t receive the sneakers or the money.” Told friend that I was one of a thousand people in America who bought them! I didn't get a congratulations or a raised eyebrow, ZERO curiosity. Not a single question. He just shook his head saying you're going to get ripped off. He's FOOLED you!" Why wouldn't he say “how did you do it? Was it all online, when do you get them, can I see them, what do you mean they are selling for $5,000?” Not a single question, he just said I gotta go. And I said “do you want me to tell you next time this happens?” The answer was “it won't happen again, Trump's trying to rip you off, I gotta go.” He wouldn't accept that the money is not going to Trump and looked upset. I said "Why are you upset, I'm telling you I just won the freakin' lottery?" and he said "You haven't won anything, you are being taken advantage of and I gotta go."

I pray in the name of Jesus that they wake up and see the Light. Strange thing is these are REALLY good, generous, considerate, Jesus loving people, but they are completely blind to the good in what Trump is doing. Keep on praying for these people, please. Don't write them off. They're not all bad, there are still A LOT of good people who are 100% blind to Trump. Do not give up on them, please. Prayer works. Thank you for your prayers, Patriots.

 

"The Lord is not slow in keeping his promise, as some understand slowness. Instead he is patient with you, not wanting anyone to parish, but everyone to come to repentance." 2 Peter 3:9

Anonymous ID: 47b43c Feb. 20, 2024, 3:58 p.m. No.20448507   🗄️.is 🔗kun

>>20448499

>That's why they hate him so much because he knows all of their dirty tricks, and is always several steps ahead of them.

Retard, half of his family are Yids, the other part are Kikes!

Anonymous ID: f25fa7 Feb. 20, 2024, 3:58 p.m. No.20448508   🗄️.is 🔗kun

Owned by 6 corps

and 272 execs

 

bla bla bla it's WRONG!

 

THIS IS FUKING Feb 20, 2024

 

FCC + BBG are tainted and controlled by the color of laws.

18 USC 1001b

smith mundt modernization act

ndaa

patriot act

aumf

cog

Anonymous ID: 2029b0 Feb. 20, 2024, 3:58 p.m. No.20448510   🗄️.is 🔗kun   >>8521 >>8649 >>8920 >>9055

Leader of drug trafficking organization imprisoned for international cocaine distribution scheme

 

https://www.justice.gov/usao-sdtx/pr/leader-drug-trafficking-organization-imprisoned-international-cocaine-distribution

Anonymous ID: 31d6f5 Feb. 20, 2024, 3:59 p.m. No.20448514   🗄️.is 🔗kun

>>20448495

Once all of the non-Jewish White people are gone, the White Jews will stick out like a sore thumb and will be slaughtered in the streets.

They are eliminating their camouflage by getting rid of the non-Jewish Whites.

Did they think this thru all the way?

Anonymous ID: 6d54ad Feb. 20, 2024, 3:59 p.m. No.20448517   🗄️.is 🔗kun   >>8693

>>20448472

>>20448474

If the reasons for deletion or banning were made into a well-written formula, it might reduce the number of deletions.

 

I'm pretty sure you could state in red text that you were banned or why, right?

 

Like this person was banned for this reason.

Is that what should do instead of deleting?

 

It might also eliminate mistakes.

But then would get spam and mold all over the place, wouldn't ?

What should do?

Balance of freedom?

Anonymous ID: 21b84f Feb. 20, 2024, 4 p.m. No.20448522   🗄️.is 🔗kun

So

Sanctions on the countries with a viable currency

Only thing that gets me

They can say this shit with a straight face

Bastards deserve Emmy

Anonymous ID: 17bbd5 Feb. 20, 2024, 4:01 p.m. No.20448529   🗄️.is 🔗kun

I listened to her speech today and it sounded like a little girl Karen sing songing that she was not quitting…yah,yah,yah, yah, yah!

Wanted to slap the bitch!

Anonymous ID: 2029b0 Feb. 20, 2024, 4:01 p.m. No.20448530   🗄️.is 🔗kun

Israel has the same Western support as Hitler – Maduro

 

The president of Venezuela backed the assessment of the Gaza conflict made by his Brazilian counterpart Lula da Silva

 

Modern Israel enjoys “the same encouragement, the same funding, and the same support” of the collective West like Adolf Hitler’s Nazi Germany before the World War II, Venezuelan President Nicolas Maduro has said.

 

The president made the remarks on his own TV program With Maduro Plus, backing the assessment of the situation in the Middle East provided recently by his Brazilian counterpart Lula da Silva.

 

“Powerful family names in the US, Europe and London supported and celebrated Hitler’s arrival to power in 1933. They encouraged him and allowed him to persecute my Jewish ancestors,” Maduro stated. The president made public his Jewish ancestry back in early 2010s, revealing his grandparents were Sephardic Jews who converted to Catholicism.

 

The Western elites “kept quiet because they were preparing Hitler for him to launch his military power against the Soviet Union,” Maduro explained, stressing that, ultimately, Hitler was “a construct, a monster” created by the collective West.

 

Modern Israel has turned into the very same thing, the president asserted, urging Jewish people who are still true to their roots to end the ongoing “massacre” of the Palestinians.

 

“The criminal military apparatus of the State of Israel also has the same encouragement, the same funding, and the same support” of the West, Maduro stressed. “As President Lula da Silva said, the Israeli government is doing the same thing [to the Palestinians] that Hitler did to the Jewish people.”

 

Brazil’s da Silva delivered the explosive remarks over the weekend, describing Israel’s military action against Hamas militants in Gaza as “genocide” and “slaughter.”

 

https://www.rt.com/news/592798-israel-hitler-comparison-maduro/

Anonymous ID: 58ddd7 Feb. 20, 2024, 4:02 p.m. No.20448533   🗄️.is 🔗kun   >>8534

US and EU are not the only ones suffering an invasion crisis. Australia is quietly right up there and with a population of only 25 mil, will be gobbled up by Muslims in short time.

Anonymous ID: 3958d2 Feb. 20, 2024, 4:02 p.m. No.20448536   🗄️.is 🔗kun   >>8566

>>20448439

That's part of the fun

PDJT says take the vaxx, lefties hate everything PDJT likes, so no vaxx

Lefties steal election, sheeple already scared by MSM, so not only do lefties say "take the vax" but go to mandate the shit or you go to the camps

Now it's time to play the "no, we never wanted the vax, it was all Orange Man" when there's so much video and shit out there proving them liars

Old timey "damned if you do, damned if you don't"

Anonymous ID: 2029b0 Feb. 20, 2024, 4:04 p.m. No.20448555   🗄️.is 🔗kun   >>8575 >>8578 >>8602 >>8649 >>8652 >>8758 >>8920 >>9055

US To Hit Moscow With New "Major Sanctions Package" Over Navalny's Death

 

Russia has already been subject of the most steadily applied US and EU sanctions regimen on earth over the last two years due to the Ukraine war. But in the wake of Alexei Navaly's reported death in a far northern Russian prison, which Western officials are blaming "dictator" President Putin for, Washington is about to roll out with… more sanctions – which it should be noted are "major".

 

US National Security Council spokesperson John Kirby on Tuesday previewed what he's calling a "major sanctions package" targeting Moscow in response to Navalny's death.

 

The new sanctions, to be formally unveiled Friday, will "hold Russia accountable for what happened to Mr. Navalny, and quite frankly, for all its actions over the course of this vicious and brutal war that has now raged on for two years."

 

An course the administration hasn't missed the opportunity to tell House Republicans they must pass Biden's massive $60 billion for Ukraine defense aid bill.

 

"One of the most powerful things that we can do right now to stand up to Vladimir Putin, of course, is to, again, pass the bipartisan national security supplemental bill and support Ukraine as they continue to fight bravely and assess their country," Kirby continued in his remarks to reporters on a conference call.

 

The White House is talking about various 'options' in terms of consequences for the Russian opposition activist's death in custody:

 

In 2021, Biden told reporters that if Navalny died, the consequences for Russia would be “devastating.” Asked directly about that on Friday, the president said his remark was three years ago, and they’ve faced “a hell of a lot of consequences” since then.

 

Biden directly blamed Russia for Navalny’s death and said: “We’re contemplating what else can be done,” adding, “We’re looking at a whole number of options.”

 

In Europe, various governments' embassies have been summoning the resident Russian ambassador to condemn Navalny's death and gain answers. Poland was the latest to summon the Russian ambassador Tuesday.

 

Meanwhile, Navalny's widow, Yulia Navalnaya, has quickly become spokesperson for her husband's cause, having addressed the Munich Security Council over the weekend. While she's relatively unknown, over the past days since her husband's death Western media has been highlighting her words of denunciation aimed at Putin and Moscow. Putin "killed the father of my children," she's told press briefings.

 

https://www.zerohedge.com/geopolitical/us-hit-moscow-new-major-sanctions-package-over-navalnys-death

Anonymous ID: 451bf7 Feb. 20, 2024, 4:06 p.m. No.20448567   🗄️.is 🔗kun   >>8571 >>8590

>>20448296

> Donald Trump and Laura Ingraham

 

The energy here in Greenville, South Carolina is electric! You can feel the anticipation in the air for tonight’s Town Hall with Donald Trump. Tune in to

@FoxNews

at 7 PM sharp.

6:21 PM · Feb 20, 2024

·

42K

Views

 

https://twitter.com/IngrahamAngle/status/1760082364858827142

 

:17

Anonymous ID: f25fa7 Feb. 20, 2024, 4:08 p.m. No.20448580   🗄️.is 🔗kun

It was the Israel Sheriff's that protected against the HAMAS Tunnels and Baby raping head cuttin (p[ropaganda/lies) by shooting thru their own people to get them.

 

Now 3300 American sheriffs just got GAZA GENOCIDE TRAINING…

WHAT DO THEY PLAN TO DO NEXT?

Anonymous ID: 451bf7 Feb. 20, 2024, 4:08 p.m. No.20448581   🗄️.is 🔗kun

Trumps Daily Attacks Won’t Stop

6:11 PM · Feb 20, 2024

·

13.9K

Views

https://twitter.com/THEUNITEDSPOT_/status/1760079882669945202

Anonymous ID: 971bdd Feb. 20, 2024, 4:08 p.m. No.20448583   🗄️.is 🔗kun   >>8604 >>8798

Interesting the speech contents…they touch on what to do with the migrant issue…caused by the democratic opposition…the timing is so…with Our.. The Plan.

 

We are just continuing their plan..script…proofs here that we are so on target…COZY

Anonymous ID: 447a0d Feb. 20, 2024, 4:08 p.m. No.20448586   🗄️.is 🔗kun   >>8608 >>8649 >>8920 >>9055

>>20448557

Well that sucks bro, just watch the video then and you will see why papaya are turing PCR c-19 tests positive

 

btw this is just 2 of the first non-spike primer sequence I looked into that they possibly use and there might already be a problem..

Anonymous ID: 6d54ad Feb. 20, 2024, 4:09 p.m. No.20448589   🗄️.is 🔗kun   >>8617

>>20448472

>>20448474

If the reasons for deletion or banning were made into a well-written formula, it might reduce the number of deletions.

 

I'm pretty sure you could state in red text that you were banned or why, right?

 

Like this person was banned for this reason.

Is that what should do instead of deleting?

 

It might also eliminate mistakes.

But then would get spam and mold all over the place, wouldn't ?

What should do?

Balance of freedom?

 

If were to state the reason for each and every deletion, we would have to increase the BV.

Well, in other words, are these anons trying to say that there is a problem with the criteria for deleting BOs and BVs here?

That was the point?

Anonymous ID: 447a0d Feb. 20, 2024, 4:10 p.m. No.20448598   🗄️.is 🔗kun

>>20448557

They have an entire crew on twitter fucking with antiv c-19 vax peeps and these people don't know much about this video I posted.

 

It would be fucking aweseome to get someoen to actually talk sense

Anonymous ID: e9b6c6 Feb. 20, 2024, 4:10 p.m. No.20448602   🗄️.is 🔗kun

>>20448555

As long as your against Russia

Biden will forgive your sins

Even a Nazi Sympathizer

 

meanwhile an American Journalist dies in a Ukraine Jail

Not a Peep

Anonymous ID: f25fa7 Feb. 20, 2024, 4:11 p.m. No.20448612   🗄️.is 🔗kun

if there's ever a new government, I say one line that could have stopped all this non-violently is a new law and oath….

 

Old oath wasn't bad but the founders missed the new threats commie marxist socialist globalist terrorist nazi leninist maoist fascist eugenicist pedoist zionist or identity fraud

 

  • so help you god

 

now make the LAW go with it.

Anonymous ID: 3bb96a Feb. 20, 2024, 4:13 p.m. No.20448632   🗄️.is 🔗kun   >>8653 >>8675

>>20448582

>>20448582

Justice is irrelevant to forgiveness. You can get justice with totally getting even then afterwards you're faced with a choice to harbor resentment or otherwise forgive. You forgive to let go of the negativity. You choose not to forgive to maintain the negativity. I can easily get even with with sub par intellect when it comes to these discussions then very incredibly easily forgive you for all of it. You should try it sometime. God bless you.

Anonymous ID: 2ef6f6 Feb. 20, 2024, 4:15 p.m. No.20448649   🗄️.is 🔗kun

Notes ~315

 

#25085 >>20448296

>>20448595, >>20448571 Trump live for Town Hall with Laura Ingraham

>>20448345 Planefag

>>20448362 The Authoritative Personality (1950), Adorno T. W.

>>20448367 What is Smart Dust?

>>20448411 Tucker Carlson - Mass Immigration is Destroying the United States and No One is Doing Anything About It… Why Journalists are Afraid

>>20448443, >>20448493 @TheJusticeDept has unsealed indictments against two alleged Russian members of the #LockBit ransomware group

>>20448490 Hunter Biden’s Lawyers Lash Out at Special Counsel, Claim Photos on iPhone Are Sawdust, Not Crack Cocaine

>>20448510 Leader of drug trafficking organization, Francisco Rene Luna, imprisoned for international cocaine distribution scheme

>>20448515, >>20448586, >>20448608 Understanding PCR

>>20448555 US To Hit Moscow With New "Major Sanctions Package" Over Navalny's Death

>>20448585 Dog comms: 13 pit bulls euthanized after deadly mauling in Compton

#25085

Anonymous ID: 3958d2 Feb. 20, 2024, 4:16 p.m. No.20448652   🗄️.is 🔗kun   >>8920 >>9005 >>9055

>>20448555

Distraction needed, sanctions won't mean much soon

Remember the discussion last year about the death of the petrodollar once it was not a currency of international trade?

 

Cairo Officially Ditches American Greenback for Trade

February, 17, 2024

 

TEHRAN (Tasnim) – In a sign of an unfolding BRICS de-dollarization plan, Egypt has officially started ditching the US dollar in trade.

 

The country was one of five nations to accept an invitation to join the alliance at its 2023 summit.

 

The BRICS expansion was the first time the alliance grew since 2001 and had massive geopolitical implications. Alongside Egypt, Iran, Saudi Arabia, the United Arab Emirates (UAE), and Ethiopia have joined the bloc. Now, Egypt has already expressed its desire to move away from the greenback in trade.

 

Egypt has decisively severed its reliance on the US dollar, aligning itself with the BRICS bloc's strategic move towards de-dollarization.

 

For much of the last year, BRICS made countless headlines for its activities and initiatives. Those actions were defined by its desire to decrease the international prevalence of the US dollar and to grow its ranks. Subsequently, both of those goals coincide with a development that occurred this week.

 

Indeed, now part of the BRICS alliance, Egypt is set to ditch the US Dollar in its trade activity, watcher. guru reported.

 

Specifically, the country’s Ministry of Foreign Affairs stated its intention earlier this week. The country assured that it will work to urge countries it trade within national currencies to lessen the burden of the rising cost of utilizing foreign currencies for settlements.

 

Furthermore, Egypt said that the decision was a result of a global economic shift. As a matter of fact, they noted the “international crises over the past four years,” as a major development in its decision. Subsequently, it is likely the change in trade currency is rooted in similar factors that have pushed the same action in many of the BRICS nations.

 

https://www.tasnimnews.com/en/news/2024/02/17/3040570/cairo-officially-ditches-american-greenback-for-trade

 

More sauce:

Egypt Abandons US Dollar for International Trade

Joy Onuorah 4 days ago

https://businesselitesafrica.com/2024/02/16/egypt-abandons-us-dollar-for-international-trade/?v=7516fd43adaa

 

Egypt starts getting rid of the US Dollar

Osama Ali Published February 16th, 2024 - 07:49 GMT

https://www.albawaba.com/business/egypt-starts-getting-rid-us-dollar-1553378

 

Egypt Stops Use Of US Dollar For Trade

By Lucy Adautin February 16, 2024

https://www.theheritagetimes.com/egypt-stops-use-of-us-dollar-for-trade/

Anonymous ID: a674ae Feb. 20, 2024, 4:16 p.m. No.20448653   🗄️.is 🔗kun   >>8664

>>20448632

you are forgiving so many anons in your latest psyop slide you must be about to run out

how about you forgive yourself just before you neck yourself?

post livestream when you kys

Anonymous ID: 447a0d Feb. 20, 2024, 4:16 p.m. No.20448654   🗄️.is 🔗kun   >>8662 >>8681

TTACAAACATTGGCCGCAAA

GCGCGACATTCCGAAGAA

 

Screenshot attached has some of their other sequences.

 

I have to double-check them I might have mistyped into my computer one given night but they should be horrible.

 

These sequences are for regions other than spike.

 

https://blast.ncbi.nlm.nih.gov/Blast.cgi (site to search when you realize this is a problem to be focused on)

Anonymous ID: 451bf7 Feb. 20, 2024, 4:17 p.m. No.20448656   🗄️.is 🔗kun   >>8687

https://twitter.com/simonateba/status/1760030827935633577

 

BREAKING: President Biden just successfully boarded Air Force One after nearly tripping twice. In the end, the 81-year-old President made it safely to the finish line. CONGRATULATIONS Mr. President. WATCH

Anonymous ID: 8b47b6 Feb. 20, 2024, 4:17 p.m. No.20448659   🗄️.is 🔗kun   >>8723

>>20448609

>>20448628

you could wait for the autopsy

before you dispute the autopsy

 

Occam's Razor could be of help too:

why publicize an execution?

why do it less than a month before elections?

 

and

how many Americans even know who Navalny is?

this tempest is not organic, and is being pushed hard by the family that smokes sawdust

Anonymous ID: 75e8da Feb. 20, 2024, 4:18 p.m. No.20448663   🗄️.is 🔗kun

>>20448646

 

copyright shit ya know

can not photograph offending foods

food disparagement laws

you can find 39% roadkill or euthanized pets in the meat

and

it may be 100% true

but if you SAY IT

you will be sued for "food disparagement"

Anonymous ID: 726079 Feb. 20, 2024, 4:19 p.m. No.20448677   🗄️.is 🔗kun   >>8920 >>9055

https://thehighwire.com/news/ny-bill-would-allow-children-to-consent-to-medical-procedures/

 

NY BILL WOULD ALLOW CHILDREN TO CONSENT TO MEDICAL PROCEDURES

Anonymous ID: 32eca6 Feb. 20, 2024, 4:20 p.m. No.20448678   🗄️.is 🔗kun

The documentary delves into the complex and often controversial topic of the depiction of violence by Yahweh, the God of the Bible, and its implications for those seeking moral guidance from the sacred text. Featuring insights from Dr. Joshua Bowen and other preeminent scholars, it meticulously examines the instances where divine commands and actions in the Bible are fraught with violence, raising serious ethical and theological questions. The documentary highlights the lengths to which believers might go to reconcile these narratives with a moral framework, including employing hyperbole or finding justifications for divine decrees that appear morally questionable by contemporary standards. This exploration sheds light on the profound challenges and dilemmas faced by individuals trying to align their faith with modern ethical principles, illustrating the complexities of interpreting ancient religious texts in a modern context.

 

https://youtu.be/RO_EuhPDdBg

Anonymous ID: 59dc47 Feb. 20, 2024, 4:20 p.m. No.20448683   🗄️.is 🔗kun

>>20448669

Oh, I'm sorry. I wouldn't want to offend someone by calling them a crackhead when they're a methhead, or vice versa. Who's the idiot now, fuckface? In the filter. Like I said, I don't care enough between the difference to acknowledge the difference. It's a self-destructive hole with those two.

Anonymous ID: 24eefd Feb. 20, 2024, 4:22 p.m. No.20448693   🗄️.is 🔗kun   >>8706 >>8730

>>20448517

If the reasons for filtering or filtering were made into a well-written formula, it might reduce the number of filterings.

I'm pretty sure you could state in red text that you were filtered or why, right?

Like this person was filtered for this reason.

Is that what should do instead of filtering?

It might also eliminate mistakes.

But then would get spam and mold all over the place, wouldn't ?

What should do?

Balance of freedom?

Or simply scroll on by?

Anonymous ID: 861f29 Feb. 20, 2024, 4:24 p.m. No.20448715   🗄️.is 🔗kun   >>8920 >>9055

>>20448362

Adorno is "Frankfurt" scholl

Tavistock

Study of Marxism.

Home of "Critical Theory"

https://en.wikipedia.org/wiki/Frankfurt_School

Adorno is said to have written all the songs of the Beatles

Social Engineering project by Marxist and neo-Marxists

Anonymous ID: 9111ce Feb. 20, 2024, 4:27 p.m. No.20448739   🗄️.is 🔗kun

>>20448505

Its truly bad out there in this regard. We seem to be at 'awakened saturation' point. I'm hoping we get an 'I told you so' moment in the near future to break the bottleneck.

Anonymous ID: 6e6468 Feb. 20, 2024, 4:28 p.m. No.20448743   🗄️.is 🔗kun

>>20448702

I mean if she didn't have that nasally annoying voice it wouldn't be so bad but it's like a knife in anon's brain that takes the focus off anything Trump is saying.

Anonymous ID: af132c Feb. 20, 2024, 4:30 p.m. No.20448752   🗄️.is 🔗kun   >>8783

they get away with all of it because it's a world wide pyramid scheme and they at the top are too big to fail. follow the money. they don't care. to fight the system is suicide [for you] while they live on eternal

Anonymous ID: 3958d2 Feb. 20, 2024, 4:30 p.m. No.20448754   🗄️.is 🔗kun   >>8788 >>8801

>>20448617

>>20448641

The "deletion issue" has been a favorite of the shills and schizos trying to throw shade on the BO and BVs

halfmind, VD, last-fag-standing whine about deletion frequently

 

Behold:

General Research #23139 >>18851346

 

Not going to work anymore. The cycles are becoming clearer. Gore and cp to test the defenses, then cycle through tons of muh joo, then racist/white supremacy, then some slide like "RRN is legit" and then when the garbage gets tossed, scream "muh censorship"

Bitch about BO and BVs and the truly retarded among you bitch about bakers deleting stuff all you want, not going to work, not going to change anything.

The Fuckitol has taken effect. The continuous bombardment of all the playbook shit has finally done the same thing as the pussyhats screaming nazi, or racist. Overused to the point of uselessness. Game Over shill bois. You have induced "Fuckwad Fatigue" and become nothing but noise to be easily tuned out. Like a dog with fireworks, every now and then, flash and bang and Fido cowers. But this was Fourth of July Finale shit basically 24/7 for six years. You turned Fido into a Cavalry Horse, the shit simply no longer matters. It's "oh, this shit again" and every angle is known.

Anonymous ID: 5eff94 Feb. 20, 2024, 4:31 p.m. No.20448757   🗄️.is 🔗kun

>>20448339

>WE, champions of freedom and the Declaration of Independence, are the last line of defense of the Constitution and our American heritage

 

Excellent discourse.

Anonymous ID: f25fa7 Feb. 20, 2024, 4:31 p.m. No.20448761   🗄️.is 🔗kun

My sheriff is a good sheriff. bla bla bla.

Ya sure about that? Have you TESTED the theory lately?

 

I thought the same thing.

Do yourself a favor, TEST.

 

Remember See something say something.

well they seem to want to fuck the people REPORTING THINGS UP.

 

Yes tell us the GPS coordinates of your house Sir or Mam so we can send the 2K LB bom I mean Help..

Anonymous ID: f25fa7 Feb. 20, 2024, 4:33 p.m. No.20448775   🗄️.is 🔗kun   >>8792

Voting is DANGEROUS because there are SECRET INDIVIDUAL CODE MARKINGS ON YOUR BALLOT THAT MATCH YOU. WHO EVER CONTROLS THIS METADATA COULD FEED IT TO MOLFAR AND HAVE YOU ELIMINATED OFF PLANET EARTH.

 

THIS IS WHY TRANSPARENCY IS IMPORTANT

 

THIS IS WHY THE SECRETARY OF STATE OF CALIFORNIA IS THE MOST DANGEROUS PERSON IN THE UNITED STATES

Anonymous ID: cefe2e Feb. 20, 2024, 4:33 p.m. No.20448777   🗄️.is 🔗kun

https://rumble.com/v4el4p9-young-black-man-schools-old-black-man-on-how-to-do-for-self.html

 

https://rumble.com/embed/v4bzuv6/?pub=9ikqh

I can't get a rumble vid to embed to save my life….

Anonymous ID: 99b597 Feb. 20, 2024, 4:35 p.m. No.20448798   🗄️.is 🔗kun   >>8870

>>20448583

Notice his numerous recorded speeches, both audio and film, are never, never translated or subtitled to English, or other languages for that matter, on the History Channel or other Western Programming, to hear first-hand what is being said.

Only ever snippets of those sentences that serve to propagandize and indoctrinate the audience are permitted.

It was always going to be 'Six Million'. New York Times Friday October 18, 1918 Page 12.

Anonymous ID: 526863 Feb. 20, 2024, 4:37 p.m. No.20448804   🗄️.is 🔗kun   >>8845 >>8920 >>9055

biggest fundraiser in SC for Trump, $6.5 million. Bannon: "Trump's Representing The American People, He's Putting You First"

 

Birdbrain will hang on forever.

 

7:31

 

https://rumble.com/embed/v4c303r/?pub=4

Anonymous ID: 152579 Feb. 20, 2024, 4:39 p.m. No.20448816   🗄️.is 🔗kun   >>8920 >>8933 >>9055

https://twitter.com/rawsalerts/status/1760086751484219554

 

🚨#BREAKING: Confirmed Explosion at a shopping center lockdowns and evacuation in place

 

📌#Tustin | #California

 

Currently, numerous law enforcement officers, including the Bomb Squad, are on the scene. As Officials have confirmed that there was an explosion in the Tustin Legacy shopping center or near the Bank of America in Tustin, California. Evacuations and lockdowns are in place, and the FBI is involved as the loud boom could be heard from miles away. It is not immediately known if anyone was hurt this is still developing

Anonymous ID: 32eca6 Feb. 20, 2024, 4:39 p.m. No.20448820   🗄️.is 🔗kun

hunter biden photo that was dropped fucked shit up my guess. Do not see people talking about on pol as stated and appeard to be choke fucking natalie at least that was what I think was implied.

Anonymous ID: e9b6c6 Feb. 20, 2024, 4:39 p.m. No.20448821   🗄️.is 🔗kun

Will show the face and Name of a man that is suspected of killing a child

Won't show the face of the men that fired into a crowd at a parade

 

So weird