Handoff monitored. Hi Clam!
Not sure what's up with that. Sorry, Anon! I'll look into it.
rh negatives represent!
sidenote:
haplogroup Q represent!
Remember that dna-string on the back of Trumps speech paper that one time? ;)
https://www.eupedia.com/europe/Haplogroup_Q_Y-DNA.shtml
I think you might appreciate this
It's a Y-cromosomal (patrilineal) dna group.
>The technical details of M242 are:
Nucleotide change: C to T
Position (base pair): 180
Total size (base pairs): 366
Forward 5′→ 3′: aactcttgataaaccgtgctg
Reverse 5′→ 3′: tccaatctcaattcatgcctc
https://www.eupedia.com/europe/Haplogroup_Q_Y-DNA.shtml
If you're interested in more, feel free to search for it? :)