Anonymous ID: e9b66c July 23, 2018, 1:44 a.m. No.2250022   🗄️.is 🔗kun   >>0046

>>2249957

rh negatives represent!

sidenote:

haplogroup Q represent!

Remember that dna-string on the back of Trumps speech paper that one time? ;)

 

https://www.eupedia.com/europe/Haplogroup_Q_Y-DNA.shtml

Anonymous ID: e9b66c July 23, 2018, 1:57 a.m. No.2250070   🗄️.is 🔗kun   >>0084

>>2250046

It's a Y-cromosomal (patrilineal) dna group.

>The technical details of M242 are:

Nucleotide change: C to T

Position (base pair): 180

Total size (base pairs): 366

Forward 5′→ 3′: aactcttgataaaccgtgctg

Reverse 5′→ 3′: tccaatctcaattcatgcctc

 

https://www.eupedia.com/europe/Haplogroup_Q_Y-DNA.shtml

If you're interested in more, feel free to search for it? :)