Anonymous ID: fe9082 Q Research General #2836 Iran's Weak Reply to POTUS Edition July 23, 2018, 12:27 a.m. No.2249666   πŸ—„οΈ.is πŸ”—kun   >>9731 >>9959 >>0395

Welcome To Q Research General

 

We hold these truths to be self-evident: that all men are created equal; that they are endowed by their Creator with certain unalienable rights; that among these are life, liberty, and the pursuit of happiness.

 

IntegrityΓ’β‚¬β€œfor in Truth lies Victory.

 

VINCIT OMNIA VERITAS

 

SEMPER FIDELIS

 

WWG1WGA

 

Welcome to Q Research (README FIRST, THEN PROCEED TO LURK) https://8ch.net/qresearch/welcome.html

Our Best of the Best Q Proof Bread >>1552095, >>>/qproofs/49 SEE FOR YOURSELF

Discussion and Refinement bread for our Best Q Proofs Sticky >>1739215, >>>/qproofs/130

100+ Q Proof Graphics download qproofs.com

Q Plan to Save the World - Video introduction to the Q plan - https://youtu.be/6cYZ8dUgPuU

 

HIGHLIGHTED Q POST

 

Q !UW.yye1fxo ID: 27d57d No.594016 Γ°ΕΈβ€œΒ

Mar 8 2018 19:55:52 (EST)

Anonymous ID: 576924 No.593959 Γ°ΕΈβ€œΒ

Mar 8 2018 19:53:28 (EST)

nov14.png Ò¬‑

 

>>593825

>>593959

Thank you Kim.

Deal made.

Clowns out.

Strings cut.

We took control.

Iran next.

Q

 

Q's Recent Posts

We are aware of the issue with an accelerated pattern of some breads being 404'ed from /qresearch/.

 

Q's Private Board >>>/patriotsfight/ | Qs Tripcode: Q !CbboFOtcZs

 

FIND ALL Q POSTS AT: qanon.pub , qmap.pub/ , qanonmap.bitbucket.io/ , qanon.news/posts.html

 

Backup Q Posts (those still on the board) at https://8ch.net/qresearch/qposts.html or >>>/comms/226

 

Previous Q Posts

If qanonmap ever goes down, the mirrors are: qntmpkts.keybase.pub & qanonmap.bitbucket.io

* Spreadsheet: https://docs.google.com/spreadsheets/d/1Efm2AcuMJ7whuuB6T7ouOIwrE_9S-1vDJLAXIVPZU2g/edit?usp=sharing

* Q Raw Text Dump: pastebin.com/3YwyKxJE

 

Dealing with Clowns & Shills

>>2117975, How To Quickly Spot A Clown >>1838738, Freedom of Speech >>2064946 Useful Filters

Anonymous ID: fe9082 July 23, 2018, 12:27 a.m. No.2249671   πŸ—„οΈ.is πŸ”—kun   >>0225

Notables

are not endorsements

 

GLOBAL

>>2174695 ; >>2174831 FULL VIDEO: President Trump and President Putin Helsinki Summit Press Conference

 

#2835

>>2248944 More legalized theft from the US government (that's us, people)

>>2248981 POTUS tweet again. Baker just can't see this enough

>>2249043 Pompeo's speech on Iran (at Reagan Library 7/22/18)

>>2249184 All Q Mentions of Iran (screen capture)

>>2248968, >>2249379 The Clintoons and Iranian & NK fuckery

>>2249434 Iran replies to POTUS tweet

>>2249441 Many Anons and Twatters are enjoying POTUS's recent Iran tweet

>>2249599 SpaceX Telstar Launch

>>2249637 Mueller past work history dig

>>2249661 #2835

 

#2834

>>2248144, >>2248177, >>2248307, >>2248791 Wolfe and Watkins and FISA Docs, oh my!

>>2248429 Added as notable again, just because I like it so much

>>2248525 Summary Graphic of "Iran is Next"

>>2248570, >>2248629, >>2248713, >>2248802 James Woods getting the most out of Twitter

>>2248839 #2834

 

#2833

>>2247620, >>2247641 Peter Strzok's Wife Blocked FBI Investigations on Clinton

>>2247610 Compilation of Secretary Pompeo Tweets to Iranian People

>>2247342 The NYT is the Iranian State Media (Graphic)

>>2247270 EPIC & BADASS Trump Twat to Rouhani of Iran /ourpresident/

>>2247966 #2833

 

#2832

>>2247102 The money plane. Planes full of cash, sound familiar? Browder...

>>2247096 Trump Talking About "Lights Out" in Video (Around 1:20 Mark)

>>2246903 Rainn Wilson Pedo Twats (ARCHIVE OFFLINE ANONS)

>>2246788 George Eliason Twat

>>2246782 Pimco Executive Bill DeLeon Resigns After Allegations of Inappropriate Behavior.

>>2246836 Remember the Cryptic Flynn Tweet "Dgfffcf"?

>>2246787 These Aspen Security Forum Transcripts Should be Interesting

>>2246727 Caleb Hull Twats Brennen Account only Has 45 Posts??? Where Did the Posts Go???

>>2246675 Bear Strikes Anagram

>>2246498, >>2246561, >>2246517, >>2247153 SoÒ€¦Ò€¦ Hitlery met with PUTIN ALONE - No way??

>>2246491 Oh My, This is Either A Sting -OR- The Most Corrupt U.S. Dept of Justice in History

>>2246480 Pompeo Tweet to the Iranian People (Also Translated toEnglish)

>>2247217 #2832

 

#2831

>>2246370 Disaster For Theresa May: Brits Overwhelmingly Reject New Brexit Plan; Turn To Boris, Farage

>>2246165 ClockFag Update for the Clockfags

>>2246157 Putus Schedule Tweet

>>2246146 Robert "Tosh" Plumlee Tweet (Who is this Guy?)

>>2246100 Carter Page & Jason Bourne Mentioned by 2 different People in Same Sentence on News Tonight

>>2246027 Planefag Updates

>>2245885, >>2245978, >>2246191 Tying the Clintons to Harvey Weinstein (Moar Sauce)

>>2245827 Rouhani Warns Trump About "Mother of all Wars"

>>2245760 House Intel (GOP) Wants POTUS To DECLASS FISA Application

>>2246451 #2831

 

#2830

>>2245420 why perp walking Weinstein is so critcal to this whole operation

>>2245146 Planefag update

>>2244874 Bill Browder is CIA agent, recruited Navalny.

>>2244962 Japan Inc. frets about a possible 'Bank of Amazon'

>>2244920 Dan Harmon pedo thread. (graphic)

>>2245048 Interesting theory on Trump Jr. and Stormy Daniels.

>>2245058 Corporations working to undermine Trump's tariffs.

>>2245420 , >>2245472 Tying the Clintons to Harvey Weinstein.

>>2246560 #2830

 

#2829

>>2244142 Mr. Roboto = RINO?

>>2244269 US launches campaign to erode support for Iran's leaders.

>>2244220 FBI hints at parallel construction.

>>2244745 How the FISA application papers support Nunes' February memo.

>>2246555 #2829

 

#2828

>>2243269 U.S. DoD Tweet - Shoot. Move. Communicate. 18th Security Forces Squadron in Japan

>>2243318 Italy and Libya Reject EU's Latest Migrant Crisis Plan

>>2243334 FISA Judges Dig

>>2243402 RT tweet regarding Furniture being removed from Equadorian Embassy

>>2243507 Small, low wing aircraft intercepted by a F16 near Trump's resort.

>>2243680 Pedophile psychiatrist busted by the DOJ for child porn possession.

>>2246545 #2828

 

Previously Collected Notables

>>2242308 #2827, >>2241485 #2826, >>2246530 #2825

>>2239163 #2822, >>2239965 #2823, >>2246391 #2824

>>2237286 #2819, >>2241994 #2820, >>2238353 #2821

>>2236331 #2816, >>2236344 #2817, >>2236370 #2818

>>2236323 #2815, >>2236272 #2814, >>2236254 #2813

 

Best Of Bread: https://8ch.net/qresearch/notables.html

Archives of Notables >>>/comms/225 ; >>>/comms/1536

Anonymous ID: fe9082 July 23, 2018, 12:28 a.m. No.2249677   πŸ—„οΈ.is πŸ”—kun   >>0395

War Room

WHO IS #QAnon FIRE THE CANNONS

#WalkAway Redpill the patriots trapped under the dark delusion of neoliberalism see THE LIGHT of patriotism and conservatism

 

Tweet Storm: THE WAVE: hit them with everything you got! THINK MOAB BABY!

[1] #QAnon ON EVERY twat/reply/quote/post: This is how newbies & normies can find our twats'

[2] Throw in ANY EXTRA hashtags you want! Trending: #FakeNews, #MOAB #InternetBillOfRights #IBOR #MAGA, #Treason WHATEVER YOU WANT!

[3] Meme and Meme and Meme some MOAR! Your memes are what's waking up the normies.

Hit them hard, from all angles, with every meme you have, RT others tweets. KEEP GOING!

Be your own tweet storm army.

Useful twat hints on war room info graphs

CURRENT EXPOSURE #QAnon: 40 Γ’β‚¬β€œ 70 MILLION EXPOSURES/DAY!

Best Times to TWEET:

10-11 AM EASTERN /// AFTER 6 PM EASTERN

Wanna (re)tweet ~~LASERFAST?~~ Use TWEETDECK.com on laptop or PC

 

Anon Research Tools

>>974637 How to archive a website offline

 

Threads & Research Section

>>1552095 – Q Proofs Thread - Proofs of Q's Validity

>>1254488 – QBoard Questions (testing/ questions about how to post/italic/bold/etc)

>>1121104 – Q Questions Thread (post your Questions to Q here!)

>>1667382 β€” META

>>1215912 – Letters of Gratitude II

>>870846 β€” The Letter Q

>>1606439 – Notable Resignations Thread

>>32223 —– Qs Chess Game

>>256741 β€” Alien, UFO, Advanced/Hidden Technology, Antigravity, DUMBs, etc.

>>1420554 – Biblefags vs Unleavened Bread #2

>>618758 β€” Merkel research thread

>>1796608 – Human Sex Trafficking

>>911014 β€” Occult Music and Pop Culture

>>957083 β€” No Name Research Thread

>>1940204 – Nimrod World Order Research Thread

>>1844122 – A Place to Ponder Questions for the upcoming Q & A

>>2006252 – The 'BE HEARD' Project Thread: A huge choice of graphics and ideas for creating your own Q materials

>>2089271 – New chat bread to try to take burden off QResearch off-topic discussion >>2089312

>>2178691 – NEW Executive Summaries on Each Q Subject Thread - Project

 

Q Graphics all in GMT

Q Graphics all in GMT #01-#05 >>>/comms/486 , >>>/comms/487 , >>>/comms/488

Q Graphics all in GMT #06-#10 >>>/comms/488 , >>>/comms/489 , >>>/comms/490

Q Graphics all in GMT #11-#15 >>>/comms/491 , >>>/comms/545 , >>>/comms/950

Q Graphics all in GMT #16-#20 >>>/comms/951 , >>>/comms/952 , >>>/comms/953 , >>>/comms/987 , >>>/comms/1103

Q Graphics all in GMT #21-#25 >>>/comms/1119 , >>>/comms/1156 , >>>/comms/1286 , >>>/comms/1288 , >>>/comms/1303

Q Graphics all in GMT #26-#30 >>>/comms/1307 , >>>/comms/1462 , >>>/comms/1466, >>>/comms/1489, >>2033995

 

Q Graphics all in EST

Most recent compilation β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€” >>>/comms/1269

Qmap_graphic_2018-05-14_patriotsfight/80-81-82 β€”β€”β€”β€”β€”β€”β€”β€”-—————– >>>/comms/1189

Qmap_graphic_2018-05-04_patriotsfight/TRIPUPDATE/58 + full thread captures >>>/comms/1194

Qmap_graphic_2018-04-21_2018-04-22)Earth Day.jpg ——————————– >>>/comms/968

Qmap_graphic_2018-04-17_2018-04-21_They think they are clever).jpg β€”β€”β€”β€” >>>/comms/967

Qmap_graphic_2018-04-10_2018-04-16_TheWHERE-TheWHY).jpg β€”β€”β€”-——– >>>/comms/966

Anonymous ID: fe9082 July 23, 2018, 12:28 a.m. No.2249680   πŸ—„οΈ.is πŸ”—kun

QPosts Archives in All Formats

* Q Clearance Archive: irc.qclearancearchive.net browsable versions of /thegreatawakening/ from before the purge, image archives, resignations, sex trafficing arrests,

* Spreadsheet Q&A and all images backup: docs.google.com/spreadsheets/d/1Efm2AcuMJ7whuuB6T7ouOIwrE_9S-1vDJLAXIVPZU2g/

* Spreadsheet Timestamps/Deltas: docs.google.com/spreadsheets/d/1OqTR0hPipmL9NE4u_JAzBiWXov3YYOIZIw6nPe3t4wo/

* QPosts Archive and More at qmap.pub features All Q Posts/ Players in the Game/ Analytics on Q posts (top tags, players, posts per month)/ All Resignations: https://www.resignation.info >>1606439

* Searchable, interactive archive with user-explanations: qanon.pub (Backup: qntmpkts.keybase.pub & qanonmap.bitbucket.io)

'''* QMap PDF (Version 9.5.0 '''[updated 6/25]) >>122807

* QAnonProofs.com

* Q Proofs https://www.qproofs.com/home.html

* Q Raw Text Dump: pastebin.com/3YwyKxJE

* Expanded Q Text Drops: pastebin.com/dfWVpBbY

* QMap zip: enigma-q.com/qmap.zip

 

* Full JSON Q archive: qanon.news/Archives (~135MB/~817MB Unzipped) [Updated: 4/20/2018]

* Search by post number: http://qanon.news/posts.html for printing crumbs, sorted by timestamp

* https://commandandcontrol.center/ aggregation of twitter feeds, Qanon.pub, meme making/archiving/research tools

* Original, full-size images Q has posted: https://postimg.cc/gallery/29wdmgyze/

* API Q posts: https://qanon.news/help

*Book of Q Proofs https://mega.nz/#F!afISyCoY!6N1lY_fcYFOz4OQpT82p2w

 

Tweet Tools

* Deleted Trump Tweets: https://factba.se/topic/deleted-tweets

* POTUS' Tweet Archive: trumptwitterarchive.com

* Merge QT - Awesome archive of Q Posts and POTUS Tweets in Chronological order: https://anonsw.github.io/qtmerge/

* All My Tweets: Archive/Scan any Twatter account in text form: https://www.allmytweets.net/

 

Other Tools

* Q Happenings Calendar of 2018: https://mega.nz/#F!KPQiBJiY!dK3XRe4RYoXgWq_85u4-yg

* Qcode Guide to Abbreviations: pastebin.com/UhK5tkgb

* Redpill Flag / Printable Q Cards with QR Link: >>1556905

* Stock Movement Scraper: http://qest.us (for seeing LARGE movements of $)

* Memo & OIG Report Links: 8ch.net/qresearch/res/426641.html#427188

* Legal News: www.justice.gov/usao/pressreleases

* WebAlert App: can be used to create alerts for Qanon.pub

* Federal Procurement Data System: https://www.fpds.gov/fpdsng_cms/index.php/en/

* Sealed Indictment Master: https://docs.google.com/spreadsheets/d/1kVQwX9l9HJ5F76x05ic_YnU_Z5yiVS96LbzAOP66EzA/edit#gid=1525422677

Research Section Backup >>>/comms/220 (updated 5.5.18)

* Behold A Pale Horse: >>>/pdfs/6157

* Resignation Posts Search Tool: https://www.resignation.info/scripts/8chan/search.php

* Advanced Google Search Operators: https://ahrefs.com/blog/google-advanced-search-operators/

 

Q Research Graphics Library

https://mega.nz/#F!XtNhURSb!1Mdrvt-Y_onBw5VlFDRdCQ

22,500+ memes and infographs, keyword searchable, partially organized by topic

 

Advanced Graphics

>>1842783 Advanced Graphics, Proofs, Maps, Side-by-Sides, Good Memes

 

Meme Ammo Stockpiles

26, >>2163922, Templates >>113884

Meme Generator kek.gg/draw/

 

Archives

MasterArchivist ------------------------ qarchives.ml | masterarchivist.github.io/qarchives/

Supplement to MasterArchivist ---- main spreadsheet, 2nd tab (labeled) --- https://docs.google.com/spreadsheets/d/1M2AzhZKh2PjL7L7GVPN42Em0hZXKWMdhGnj59ZQ3YcQ/

Germanarchiveanon ------------------ https://mega.nz/#F!LPZxEIYJ!N5JwCNoxOxOtAoErKdUgvwa

QAnon.news anon --------------------- https://qanon.news/Archive (~260MB/~1.5GB Unzipped) [Updated: 6/08/2018]

 

Learn To Bake!

Aspiring Bakers Report To Class and/or >>>/comms/154

Read the Simple Instructions https://pastebin.com/aY5LyDPY

New Bakers Required Read this --->>2172540

[m4xr3sdEfault]*******,=,e οΌΌοΌΏγƒΎ(α–β—ž ) ID: ad01da July 23, 2018, 12:36 a.m. No.2249727   πŸ—„οΈ.is πŸ”—kun

Malapropism: incorrect usage of a word by substituting a similar-sounding word with different meaning

"Trust"

"Plan"

Anonymous ID: 408ac7 July 23, 2018, 12:37 a.m. No.2249729   πŸ—„οΈ.is πŸ”—kun   >>9755 >>9769 >>9934

when SHIA LABEOUF comes out and admits he was rapped as a youngster and is coming back to take down pedowood…

 

They never thought Even Stevens had it in him.

 

LABEOUF OR BUST.

 

or last hope..

 

ever wonder why he's been distancing himself from hollywood so much whilst self crucifying himself?

 

He's about to drop the hammer.

Anonymous ID: fa085a July 23, 2018, 12:37 a.m. No.2249730   πŸ—„οΈ.is πŸ”—kun   >>9737

>>2249663

You post too much…your a jew mossad JIDF type. FΓΌck off. Your Jew tricks do not work here. Dan will be innocent or guilty on facts. Facts that we will know soon enough.

 

This is likely an attempt to stop season 4 of Rick and Morty. This is a limited hangout attempt. JUST LIKE WITH DONALD TRUMP. The Jews created the MeTOO movement to create a ground swell of women crying out for justice. They assumed with their Jew media they could make it into a hurricane of sorts. They began to knee jerk fire people in Hollywood to build the momentum…..all to build for the press conference with the women saying Trump was a molester. METOO was not started by brave women…the women are still acting. This is hollywood. They were a weapon aimed at TRump.

 

Attacking Dan Harmon is another fucking Mossad trick to break a TV show that is amazingly popular and has shown they will mock anything and redpill like crazy.

 

Fucking think moron.

Anonymous ID: b33ac9 July 23, 2018, 12:39 a.m. No.2249739   πŸ—„οΈ.is πŸ”—kun

>>2249669 (lb)

I like the ideas you say he's working towards, and admit mostly ignorant about this guy.

Will dig.

Michael C. Ruppert said something to the effect of, "Until you change the way money works, nothing changes."

Anonymous ID: 09138b July 23, 2018, 12:40 a.m. No.2249745   πŸ—„οΈ.is πŸ”—kun   >>9752 >>9767 >>0026

>>2249554 lb

If this is important to you, I would get in touch with GermanAnon. If any of those recent breads still exist, he could probably get them archived. Could the early breads be on one of the other archive sites? I guess they have not been maintained for some time. If not, maybe other anons might have them in a personal archive.

 

>>2249563

Link is 404.

Anonymous ID: 59fe22 July 23, 2018, 12:41 a.m. No.2249747   πŸ—„οΈ.is πŸ”—kun   >>9774

>>2249685 LB

 

>Someone said Stealth Jeff was part of the Reagan Battalion and a Never Trumper

>True?

 

could be true, but he has doxed himself and is writing a book how he left the darkside after seeing what GEOTUS was accomplishing.

[m4xr3sdEfault]*******,=,e οΌΌοΌΏγƒΎ(α–β—ž ) ID: ad01da July 23, 2018, 12:42 a.m. No.2249748   πŸ—„οΈ.is πŸ”—kun

Anaphora: A scheme in which the same word or phrase is repeated at the beginning of successive phrases, clauses, or sentences. Example: "I will fight for you. I will fight to save Social Security. I will fight to raise the minimum wage."

Anonymous ID: 7d0147 July 23, 2018, 12:42 a.m. No.2249753   πŸ—„οΈ.is πŸ”—kun   >>9766

>>2249712

And I'm aware that normies aren't supposed to be here. I don't give them direct links. Rather, I give them something to edit if they know the site and board. One of the things I've been doing on my site is providing better context for posts. If they go to a Q post, for instance, they can see the context chain going back 3 or 4 posts or more–as many as there are in that context. It's amazing how much the meaning can clear up just doing that. My site was originally built as a tool to build posts for the blog that's at the front end of the site. It's been a while since I've updated that, but I'll probably do it eventually. I'll create posts by auto-generating them. A Q post or a notable is the heart of the blog post. Context is shown with it. It's more for the normies, perhaps.

Anonymous ID: 9cd91d July 23, 2018, 12:42 a.m. No.2249754   πŸ—„οΈ.is πŸ”—kun   >>9762 >>9850 >>0257 >>0459

>>2249386 lb

 

Above comment contained the AP version of the Trump Tweet story about Iran. Attached pics show the Bloomberg and the UPI coverage of the President's tweet plus the prior speech of Secretary of State Pompeo in California and Iranian President Rouhani in Tehran. This background info helps put matters into perspective as to what led up to the tweet as well as capturing the articles before they get changed.

Anonymous ID: ae7b0b July 23, 2018, 12:43 a.m. No.2249760   πŸ—„οΈ.is πŸ”—kun   >>9791

I don't know if this has been covered, but there is a doctoral candidate compiling stats for missing Native American and Indiginous Canadian women.

The interesting thing is that there was a bill called Savannah's Act introduced by Senator Heidi Heitkamp (and also Tester, Franken, Warren, Heinrich, and Merkley) on 5 October 2017, and last action on it was taken on 25 October 2017 (three days before Q's first post).

 

The purpose of the bill was:

>To direct the Attorney General to review, revise, and develop law enforcement and justice protocols appropriate to address missing and murdered Indians, and for other purposes.

>This bill requires the Department of Justice (DOJ) to update the online data entry format for federal databases relevant to cases of missing and murdered Indians to include a new data field for users to input the victim's tribal enrollment information or affiliation.

 

I'm guessing there hasn't been any "action" on this bill in the because it is being handled re: the human trafficking crackdown.

 

https:// www.npr.org/2018/07/21/627567789/doctoral-student-compiles-database-of-indigenous-women-who-ve-gone-missing?utm_source=twitter.com&utm_medium=social&utm_campaign=npr&utm_term=nprnews&utm_content=20180722

https:// www.congress.gov/bill/115th-congress/senate-bill/1942/text

Anonymous ID: 9cd91d July 23, 2018, 12:43 a.m. No.2249762   πŸ—„οΈ.is πŸ”—kun   >>0257 >>0459

>>2249754

 

Sauce for screencaps:

 

https://www.upi.com/Top_News/World-News/2018/07/22/Irans-president-warns-Trump-of-mother-of-all-wars-if-provoked/9991532267432/?utm_source=sec&utm_campaign=sl&utm_medium=12

 

https://www.bloomberg.com/news/articles/2018-07-23/trump-warns-iran-s-rouhani-to-never-ever-threaten-the-u-s

 

https://www.bloomberg.com/news/articles/2018-07-22/iran-president-warns-trump-not-to-threaten-country-s-oil-exports

Anonymous ID: fa085a July 23, 2018, 12:45 a.m. No.2249772   πŸ—„οΈ.is πŸ”—kun

>>2249715

Dan is a drunk. He does not know how to keep a woman. But this is old news.

 

This Megan Ganz is a woman who is being manipulated into attacking Dan now. To destroy a Red Pill show that appeals to younger people.

 

METOO was not started organically. It was an attempt by Jews to create a ground swell against sexual predatory men not to help the women but to create momentum to take Donald Trump out of office.

 

You remember all that? You remember Weinstein saying "he was picked to start a new era in sexual rights" or some shit like that. The Jew sacrificed Weinstein to help take out Trump. You remember when Trumps own UN Indian Bitch said basically Trump should step down?

 

This is planned.

[m4xr3sdEfault]*******,=,e οΌΌοΌΏγƒΎ(α–β—ž ) ID: ad01da July 23, 2018, 12:46 a.m. No.2249773   πŸ—„οΈ.is πŸ”—kun

Antanaclasis – is the stylistic trope of repeating a single word, but with a different meaning each time. Antanaclasis is a common type of pun, and like other kinds of pun, it is often found in slogans

 

"Trust plan" "trust plan" "trust plan"

Anonymous ID: 09138b July 23, 2018, 12:47 a.m. No.2249780   πŸ—„οΈ.is πŸ”—kun   >>9808

>>2249718 lb

 

Apologies anon. I tagged wrong post.

I disagree with your assessment that bakers do whatever willy nilly feels good. In fact, I don't see what your issue is. The Qlinks are broken because they can't link to an active bread. That is something everyone seems to understand, but you. If you want regular q links, then you need to talk to Q about that since he hasn't posted in 19 days and probably 200 breads ago.

Demanding things are the way you want them isn't going to be very effective around here, but feel free to try, if you like.

Anonymous ID: 9cd91d July 23, 2018, 12:47 a.m. No.2249782   πŸ—„οΈ.is πŸ”—kun   >>0257 >>0459

The suicides …

 

https://apnews.com/cee3a7acb0544bd4b81fe1cf336fc182/Prominent-S-Korea-politician-found-dead-in-possible-suicide

 

Prominent S Korea politician found dead in possible suicide

By HYUNG-JIN KIM

Today

 

SEOUL, South Korea (AP) β€” A prominent liberal South Korean lawmaker embroiled in a corruption scandal was found dead on Monday, police said, in what appeared to be one of the country’s highest-profile suicides in recent years.

 

Three-term lawmaker Roh Hoe-chan of the small opposition Justice Party was found dead near a Seoul apartment building on Monday morning. Paramedics tried to resuscitate him before he was pronounced dead, police said.

 

South Korean media including Yonhap news agency reported Roh leapt to his death from the building after leaving a suicide note saying he feels sorry to his family.

 

Police said they couldn’t immediately confirm the report.

 

Roh faced an investigation over an allegation that he received money from an associate of an influential blogger jailed over an online opinion-rigging scandal. The allegation tarnished Roh’s clean and reform-minded image.

 

The independent counsel investigating the rigging scandal, Huh Ik-bum, told a televised briefing that he feels distressed with the β€œtragic news” of Roh’s death. Huh said he personally β€œrespects” Roh and will pray for his soul.

 

South Korea has one of the highest suicide rates among developed countries. A string of business executives, K-pop stars and other celebrities have killed themselves.

 

If Roh’s death is determined as a suicide, he would be the highest-profile politician who killed himself or herself since former President Roh Moo-hyun jumped to his death in 2009 amid a corruption scandal involving his family.

Anonymous ID: fa085a July 23, 2018, 12:49 a.m. No.2249789   πŸ—„οΈ.is πŸ”—kun   >>9799

>>2249737

Rick and Morty is a tool for US. It uses genius humor and clever jokes to show the insanity of the world.

 

It is a weapon in OUR arsenal.

 

If the Jew liked Dan Harmon they would not have fought so hard to not sign them for season 4.

 

Now they want to kill it. LIke the Jew killed Roseanne.

Anonymous ID: 16bb98 July 23, 2018, 12:49 a.m. No.2249794   πŸ—„οΈ.is πŸ”—kun   >>9807 >>9825

>>2249640 (pb)

It's not a joke.

If you think it's a joke there's something wrong with you . It's social conditioning to think "fucking children" jokes are funny.

No one is stopping him from whatever he wants to do or say. But we are also allowed to call it out, if he is full of shit; unfunny, And deserves to have a smaller audience.

I don't give a fuck if he is mentally ill, so are a lot of people who don't have broadcast contracts. (Paranoids, for one, tend to be funny as hell when they are on a roll? since they often tell the truth for the surprise factor [OMG factor], for example.) Maybe he was trying to tell the truth with his sick jokes - and this was the only way he knew how? But it seemed more he was glorifying it. He wasn't mocking pedos. He was mocking people who who thought it wasn't alright to say what he was saying. It was defiant, not revelatory. I'm not his boss. I don't pay him. I have no idea who he is, either, other than seeing his sick jokes. And truly I don't want to know more. And I hope he loses his job.

(I don't like Cernovich either. They [media personalities] "famefags" one way or another, are all a bad lot.)

>"One episode had the Characters begging a Trump stand-in to KILL anyone who refused to give up power. "

Have no idea why writer would claim this to be a Red Pill? Really

>"So the over the top doll rape scene shows his lack of understanding of the nature of the Jewish fetish of raping kids."

What? Did I really spend so much time responded to this ridiculous post? I'm a sucker.

Let's all defend pedo "jokes".. Wow.

(Image I picked for this post matches the number of this thread)

[m4xr3sdEfault]*******,=,e οΌΌοΌΏγƒΎ(α–β—ž ) ID: ad01da https://en.m.wikipedia.org/wiki/Syllogistic_fallacy July 23, 2018, 12:49 a.m. No.2249795   πŸ—„οΈ.is πŸ”—kun

Syllogistic fallacies are formal fallacies that occur in syllogisms. They include:

 

Any syllogism type (other than polysyllogism and disjunctive):

 

fallacy of four terms

Occurring in categorical syllogisms:

 

related to affirmative or negative premises:

affirmative conclusion from a negative premise

fallacy of exclusive premises

negative conclusion from affirmative premises

existential fallacy

fallacy of the undistributed middle

illicit major

illicit minor

fallacy of necessity

Occurring in disjunctive syllogisms:

 

affirming a disjunct

Occurring in statistical syllogisms (dicto simpliciter fallacies):

 

accident

converse accident

Anonymous ID: 4fd2d2 July 23, 2018, 12:51 a.m. No.2249802   πŸ—„οΈ.is πŸ”—kun   >>9809 >>9832 >>9898 >>0026 >>0055

Baker & All Anons

 

the note at the top is nice but not sufficient, especially not for the New Arrivals which Q mentioned.

 

please use the regular formatting for the next bread, to fully address the problem:

 

(i have provided you the links here, which are all working, altho i'm sure you can copy paste from the previous correctly formatted bread header)

 

Q's Latest Posts

 

Q's Private Board >>>/patriotsfight/ | Qs Tripcode: Q !CbboFOtcZs

 

 

Wednesday 07.04.18

 

>>2029255 β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€” Independence Celebration ←———–put the notice HERE.

 

 

Tuesday 07.03.18

 

>>2022737 https://8ch.net/qresearch/res/2022006.html#2022737 rt >>2022584 https://8ch.net/qresearch/res/2022006.html#2022584 β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€” Who do you see?

 

>>202258 4https://8ch.net/qresearch/res/2022006.html#2022584 β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”- United 747 (Retired) Through Blinds at SFO Global First Lounge

 

>>2022398 https://8ch.net/qresearch/res/2022006.html#2022398 rt >>2022233 https://8ch.net/qresearch/res/2022006.html#2022233 β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€” Trolling is Fun. Hussein/Trump interior = identical minus small changes.

 

>>2021248 https://8ch.net/qresearch/res/2020479.html#2021248 rt >>2019981 https://8ch.net/qresearch/res/2019727.html#2019981, >>2021248 https://8ch.net/qresearch/res/2020479.html#2021248, >>2020544 https://8ch.net/qresearch/res/2020479.html#2020544 Do 'reflections' violate NAT SEC rules?

 

>>2018075 https://8ch.net/qresearch/res/2017360.html#2018075 β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”- Divide they try. Fail they will.

 

>>2017327 https://8ch.net/qresearch/res/2016598.html#2017327 rt >>2016766 https://8ch.net/qresearch/res/2016598.html#2016766 β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”- WelcomeAboard.png (Picture from inside AF1)

 

>>2014318 https://8ch.net/qresearch/res/2014292.html#2014318 β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”- Add another to the list

 

>>2014158 https://8ch.net/qresearch/res/2013512.html#2014158 rt >>2013625 https://8ch.net/qresearch/res/2013512.html#2013625 β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€” Matters of National Security

 

 

Previous Q Posts

 

Backup Q Posts (those still on the board) at https://8ch.net/qresearch/qposts.html or >>>/comms/226

 

Find All Q Posts At: qmap.pub/ qanonmap.bitbucket.io/ qanon.pub

 

If qanonmap ever goes down, the mirrors are: qntmpkts.keybase.pub & qanonmap.bitbucket.io

 

  • Spreadsheet: https://docs.google.com/spreadsheets/d/1Efm2AcuMJ7whuuB6T7ouOIwrE_9S-1vDJLAXIVPZU2g/edit?usp=sharing

 

  • Q Raw Text Dump: pastebin.com/3YwyKxJE

Anonymous ID: c90222 July 23, 2018, 12:51 a.m. No.2249803   πŸ—„οΈ.is πŸ”—kun   >>9812

What if the man in Q's picture is Prince William?

 

Hear me out before you all laugh. Many of us believe that Julian Assange is no longer at the Ecuador embassy. It would take very high level individuals within the UK to make it possible for Assange to escape. What if William helped him get out? Q has let us know that JFK jr was in fact murdered. A few years prior to that, princess Diana was also murdered. We always assumed that the Queen had Diana killed, at least that's what all of the conspiracy theories lead to. But what if it's deeper than that. Q told us that North Korea had been taken over by cabal. What if the Royal Family has been blackmailed strong armed too. It doesn't matter how terrible someone might be, if you harm their mother, there will be hell to pay! William lost his mother and would probably love to bring those responsible to justice. If William wanted to bring down some of these people, the first and only move he would have to pull would be to free Julian Assange. If Assange ever gets the opportunity to testify in a US court, it will start a chain reaction that won't be able to stop.

Anonymous ID: 55c4f1 July 23, 2018, 12:52 a.m. No.2249808   πŸ—„οΈ.is πŸ”—kun   >>0036

>>2249780

I don't Q is gonna fix that problem for you.

 

Since there are negligible rules here there is negligible responsibility

 

Welcome to Anarchy - you have learned a great political/social/economic lesson about that type of Utopian government

 

Don't hold your breath for a solution - anarchies don't end well

[m4xr3sdEfault]*******,=,e οΌΌοΌΏγƒΎ(α–β—ž ) ID: ad01da July 23, 2018, 12:52 a.m. No.2249810   πŸ—„οΈ.is πŸ”—kun

An enthymeme (Greek: ἐνθύμημα, enthumΔ“ma) is a rhetorical syllogism (a three-part deductive argument) used in oratorical practice. Originally theorized by Aristotle, there are four types of enthymeme, at least two of which are described in Aristotle's work.[1]

 

Aristotle referred to the enthymeme as "the body of proof", "the strongest of rhetorical proofs…a kind of syllogism" (Rhetoric I.I.3,11). He considered it to be one of two kinds of proof, the other of which was the paradeigma. Maxims, Aristotle thought to be a derivative of enthymemes. (Rhetoric II.XX.1)

Anonymous ID: 6285b8 July 23, 2018, 12:53 a.m. No.2249811   πŸ—„οΈ.is πŸ”—kun

>Mr. Trumps unprecedented decision, which he made over the objection of law enforcement and intelligence officials, had a consequence that revealed his gambit's shaky foundation. The government released the court documents in which the FBI made its case for conducting the surveillance - records that plainly demonstrated that the key elements of the Republicans' claims about the bureau's actions were misleading or false.

 

Holy kek, the fake news just doesn't stop.

 

Image from Stealth Jeff.

Anonymous ID: 7d0147 July 23, 2018, 12:54 a.m. No.2249814   πŸ—„οΈ.is πŸ”—kun

>>2249767

It's good we have these somewhere. Is anyone archiving the full-size images? Quite a lot of the generated intel here is in image form. I've got some, but not all. The ctrl-s thing doesn't work well with those. If they're not all buffered in, I just get the thumbnails again.

Anonymous ID: 35d493 July 23, 2018, 12:54 a.m. No.2249817   πŸ—„οΈ.is πŸ”—kun

https://8ch.net/qresearch/res/2246931.html#2249790

 

Someone was thankful in the catalog overnight. Just thought I'd point it out in case something something stuff…

[m4xr3sdEfault]*******,=,e οΌΌοΌΏγƒΎ(α–β—ž ) ID: ad01da July 23, 2018, 12:54 a.m. No.2249819   πŸ—„οΈ.is πŸ”—kun

A Chewbacca defense is a legal strategy in which the aim of the argument is to deliberately confuse the jury rather than to factually refute the case of the other side. This term was used in an episode of the animated series South Park, "Chef Aid", which premiered on October 7, 1998. This episode satirized attorney Johnnie Cochran's closing argument defending O. J. Simpson in his murder trial. The concept of disguising a flaw in one's argument by presenting large amounts of irrelevant information has previously been described as the modern-day equivalent of a red herring or the fallacy ignoratio elenchi (irrelevant conclusion).[1][2]

Anonymous ID: fa085a July 23, 2018, 12:56 a.m. No.2249825   πŸ—„οΈ.is πŸ”—kun   >>9833

>>2249794

You are being Jew tricked. Someone who makes his living making rude jokes can go over the line. Which in todays world where we know how much kid fucking is really going on the joke is not funny. It was not really a joke before but designed to make you cringe. It was designed to show you how insane fucking a kid is.

 

Watch very carefully who the Jew screams needs to be taken down. You should use a short hand. I will make it easy for you. STOP BELIEVING JEWS.

 

You will be better off just not paying a Jew any attention till this whole NWO shit is done and ove r with.

 

Be very careful who Jews say is a bad guy. The Jew/Luciferians reverse and mirror EVERYTHING>

Anonymous ID: c93bf5 July 23, 2018, 12:58 a.m. No.2249831   πŸ—„οΈ.is πŸ”—kun

https://theconservativetreehouse.com/2018/06/08/the-bigger-story-behind-the-james-wolfe-indictment/

 

https://twitter.com/rohnson_john/status/1005496788600672257

^Graphic draws a connection between Ben Rhodes and a lawyer, but James Wolfe's wife is Jane Rhodes-Wolfe. The GQ 50 Most Powerful People article cites Ben and David Rhodes mother as Jane Rhodes. One and the same?

 

https://www.gq.com/gallery/50-most-powerful-people-in-washington-dc#slide=49

 

Couple other interesting screen pulls of the 50 list, too.

Anonymous ID: 35d493 July 23, 2018, 12:58 a.m. No.2249832   πŸ—„οΈ.is πŸ”—kun   >>9841 >>0026

>>2249802

>anon finds "deleted" posts

 

I knew it. Shadilay!

 

There's still catalog issues imo. Yeah it's "working".. but not on all cylinders.

 

I'm still blaming Fungus. The timing of their implosion is just too fucking coincidental.

[m4xr3sdEfault]*******,=,e οΌΌοΌΏγƒΎ(α–β—ž ) ID: ad01da https://en.m.wikipedia.org/wiki/Post-truth_politics July 23, 2018, 12:58 a.m. No.2249836   πŸ—„οΈ.is πŸ”—kun   >>9843

Post-truth politics (also called post-factual politics[1] and post-reality politics[2]) is a political culture in which debate is framed largely by appeals to emotion disconnected from the details of policy, and by the repeated assertion of talking points to which factual rebuttals are ignored. Post-truth differs from traditional contesting and falsifying of facts by relegating facts and expert opinions to be of secondary importance relative to appeal to emotion. While this has been described as a contemporary problem, some observers have described it as a long-standing part of political life that was less notable before the advent of the Internet and related social changes

Anonymous ID: fe3ba6 July 23, 2018, 12:59 a.m. No.2249838   πŸ—„οΈ.is πŸ”—kun

>>2249797

>>2249797

 

Its getting funnier and funnier watching them project exactly what they were doing and exactly what is coming for them… onto this Admin. I truly hope they are playing a role and are just really bad at it… because THESE PEOPLE ARE STUPID

Anonymous ID: af56b5 July 23, 2018, 1:01 a.m. No.2249850   πŸ—„οΈ.is πŸ”—kun   >>0257 >>0459

>>2249754

I posted the AP stories (lb)

Thanks for adding even more info

The post from anon pointing out that POTUS did not threaten Iran but rather tweeted specifically at the President prompted me to want to keep the story documented as MSM likely changes it

Anonymous ID: 408ac7 July 23, 2018, 1:01 a.m. No.2249855   πŸ—„οΈ.is πŸ”—kun

>>2249826

>>2249826

do you think his installation was intimate and he actually cared?

 

or did you ever think he knew he would be trolled and made it as an excuse to show how inhumane and fucked up you guys can be?

 

see photo of man punching woman…

 

 

also a man causing a riot…

 

 

men punching women and being arrested and proven Neo Nazis is cool.

 

Fuck you guys are bored, just glowing for any kind of sense of meaning.

Anonymous ID: fe3ba6 July 23, 2018, 1:02 a.m. No.2249857   πŸ—„οΈ.is πŸ”—kun

>>2249835

>>2249835

 

I know … I saw that a while back. Its something deeper. POTUS shook killary on stage with that one word. It wasnt about that. I feel they named it that just to cover what may come in the future. Its gotta be something else.

[m4xr3sdEfault]*******,=,e οΌΌοΌΏγƒΎ(α–β—ž ) ID: ad01da July 23, 2018, 1:04 a.m. No.2249866   πŸ—„οΈ.is πŸ”—kun   >>9876

>>2249859

Paradeigma (Greek: παραδΡιγμα) is a Greek term that refers to a pattern, example or sample. In rhetoric, a paradeigma is used to compare the situation of the audience to a similar past event, like a parable. It offers counsel on how the audience should act.[1] In the Greek tradition many paradeigmas are mythological examples, often in reference to a popular legend or well-known character in a similar position to the audience.[2]

 

The term "paradigm", a distinct concept or pattern, is derived from the Greek term paradeigma.

Anonymous ID: 858d11 July 23, 2018, 1:06 a.m. No.2249874   πŸ—„οΈ.is πŸ”—kun

>>2249864

screw you faggot! don't you read the bread? learn to use the index! we already discussed that last bread. Q never said that. I've been here since the beginning. TYB. and, of course, kys

 

kek

[m4xr3sdEfault]*******,=,e οΌΌοΌΏγƒΎ(α–β—ž ) ID: ad01da July 23, 2018, 1:07 a.m. No.2249878   πŸ—„οΈ.is πŸ”—kun

Contra principia negantem non est disputandum (Latin, alternatively Contra principia negantem disputari non potest and Contra principia negantem disputari nequit; literally, "Against one who denies the principles, there can be no debate") is a principle of logic and law: in order to debate reasonably about a disagreement, there must be agreement about the principles or facts by which to judge the arguments.

[m4xr3sdEfault]*******,=,e οΌΌοΌΏγƒΎ(α–β—ž ) ID: ad01da July 23, 2018, 1:09 a.m. No.2249886   πŸ—„οΈ.is πŸ”—kun

Arthur Schopenhauer refers to it in his "The Art of Controversy,"[5] and Lenin objected to Peter Berngardovich Struve's assertion of the principle, retorting, "That depends on how these principia are formulatedβ€”as general propositions and notes, or as a different understanding of the facts of Russian history and present-day reality."[6] Karl Popper thought the maxim expressed the relativist's irrationalist "doctrine of the impossibility of mutual understanding between different cultures, generations, or historical periods – even within science, even within physics": "The myth of the framework is clearly the same as the doctrine that one cannot rationally discuss anything that is fundamental, or that a rational discussion of principles is impossible

Anonymous ID: 2e9175 July 23, 2018, 1:10 a.m. No.2249898   πŸ—„οΈ.is πŸ”—kun   >>9906 >>9913 >>9917 >>0026

>>2249802

Ty anon, perfect.

This is what I was hoping last night

someone would come up with.

I'll prolly >>2249802

bake the next 2 breads.

So if I screw up OP formats next one,

we can fine-tune by morning.

 

Since we can't fit these on one line,

what do you guys think about this formatting?

 

Wednesday 07.04.18

 

>>2029255 β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”

>do we not have a link for this one?

Independence Celebration

 

Tuesday 07.03.18

 

>>2022737 https://8ch.net/qresearch/res/2022006.html#2022737

rt >>2022584 https://8ch.net/qresearch/res/2022006.html#2022584

Who do you see?

 

>>202258 4https://8ch.net/qresearch/res/2022006.html#2022584

United 747 (Retired) Through Blinds at SFO Global First Lounge

 

>>2022398 https://8ch.net/qresearch/res/2022006.html#2022398

rt >>2022233 https://8ch.net/qresearch/res/2022006.html#2022233

Trolling is Fun. Hussein/Trump interior = identical minus small changes.

 

>>2021248 https://8ch.net/qresearch/res/2020479.html#2021248

rt >>2019981 https://8ch.net/qresearch/res/2019727.html#2019981,

>>2021248 https://8ch.net/qresearch/res/2020479.html#2021248,

>>2020544 https://8ch.net/qresearch/res/2020479.html#2020544

Do 'reflections' violate NAT SEC rules?

 

>>2018075 https://8ch.net/qresearch/res/2017360.html#2018075

Divide they try. Fail they will.

 

>>2017327 https://8ch.net/qresearch/res/2016598.html#2017327

rt >>2016766 https://8ch.net/qresearch/res/2016598.html#2016766

WelcomeAboard.png (Picture from inside AF1)

 

>>2014318 https://8ch.net/qresearch/res/2014292.html#2014318

Add another to the list

 

>>2014158 https://8ch.net/qresearch/res/2013512.html#2014158

rt >>2013625 https://8ch.net/qresearch/res/2013512.html#2013625

Matters of National Security

Anonymous ID: 9564c5 July 23, 2018, 1:11 a.m. No.2249901   πŸ—„οΈ.is πŸ”—kun   >>9923 >>9929 >>9964 >>0074 >>0137

>>2249868

if i followed through and had discipline i would have no time at all to be here.. i'm behind on so many things..

>>2249871

>>2249872

 

and i WANT to be here anons! i want to stay and be part of this movement and help the world plus truth is addicting

but my mission on earth also has to do with helping the world and instead of working on that i'm on here

i feel guilt either way

feel guilty and selfish when i'm away from the board and not actively redpilling

feel guilty and lazy when i'm on the board and not actively working on my own shit

i know the answer is balance but i've more so just been bouncing between extremes.. cold turkey.. and then back to addiction

i sound so pathetic rn lol ignore these shitposts

[m4xr3sdEfault]*******,=,e οΌΌοΌΏγƒΎ(α–β—ž ) ID: ad01da July 23, 2018, 1:14 a.m. No.2249918   πŸ—„οΈ.is πŸ”—kun

In logic, reductio ad absurdum (Latin for "reduction to absurdity"; also argumentum ad absurdum, "argument to absurdity") is a form of argument which attempts either to disprove a statement by showing it inevitably leads to a ridiculous, absurd, or impractical conclusion, or to prove one by showing that if it were not true, the result would be absurd or impossible.[1][2] Traced back to classical Greek philosophy in Aristotle's Prior Analytics[2] (Greek: αΌ‘ Ξ΅αΌ°Ο‚ Ο„α½Έ ἀδύνατον αΌ€Ο€ΟŒΞ΄Ξ΅ΞΉΞΎΞΉΟ‚ 'demonstration to the impossible', 62b), this technique has been used throughout history in both formal mathematical and philosophical reasoning, as well as in debate.

 

The "absurd" conclusion of a reductio ad absurdum argument can take a range of forms, as these examples show:

 

The Earth cannot be flat; otherwise, we would find people falling off the edge.

There is no smallest positive rational number because, if there were, then it could be divided by two to get a smaller one.

Anonymous ID: 2b6fce July 23, 2018, 1:15 a.m. No.2249923   πŸ—„οΈ.is πŸ”—kun

>>2249901

Every thought you are exactly where you are

needed most, at the same time realizing truth

about all things, including yourself. Truth harsh

light sometimes, but now realize, now chance

to change. Before no chance, so be

thankful, faithful, PRAY, if you would.

Anonymous ID: 021485 July 23, 2018, 1:17 a.m. No.2249928   πŸ—„οΈ.is πŸ”—kun   >>9936

>>2249922

not passed, sorry I misspoke.

"House - 06/12/2017 Referred to the House Committee on Oversight and Government Reform."

It is a dangerous bill. it should not pass.

 

https://www.congress.gov/bill/115th-congress/house-bill/2884

[m4xr3sdEfault]*******,=,e οΌΌοΌΏγƒΎ(α–β—ž ) ID: ad01da Reading is forvrich people July 23, 2018, 1:18 a.m. No.2249931   πŸ—„οΈ.is πŸ”—kun

Ovid, Tristia, 1.2.97: si tamen acta deos numquam mortalia fallunt, / a culpa facinus scitis abesse mea. ("Yet if mortal actions never deceive the gods, / you know that crime was absent from my fault."

Anonymous ID: 9fc0a2 July 23, 2018, 1:19 a.m. No.2249934   πŸ—„οΈ.is πŸ”—kun   >>9946

>>2249729

Theory.

Has anyone seen the Elastic Heart video by Sia?

A LOT of people screamed over it, and I have mixed feelings, however, I think the dancer Maddie was meant to be the powerful figure, trying to rescue HIM from HIS cage.

But he's too big, grown up too much to be saved and get out to the other side.

Just a theory from a person who might understand.

Anonymous ID: cef205 July 23, 2018, 1:19 a.m. No.2249937   πŸ—„οΈ.is πŸ”—kun

>>2249791

There WAS one that mentioned AIM, which anons interpreted as something like American Independence Media (?) and went down that road.

Personally, I kinda thought it was referring to the American Indian Movement, particularly in relation to the Bureau of Land Management (and the Bureau of Indian Affairs, since I thiiiiink BLM has is supposed to be the oversight.)

Anyway: BIA has been used as a slush fund forever. I think there was a pretty massive (tho little discussed) scandal a decade or so ago regarding the epic thefts by BLM. I think… May come back to that later.

Anonymous ID: 9564c5 July 23, 2018, 1:20 a.m. No.2249939   πŸ—„οΈ.is πŸ”—kun   >>9957

>>2249929

i barely slept in high school and college and it really fucked me up memory and cognition wise.. sleep is really important to me (and important for all humans living on earth rn during massive energy shifts) and my schedule has been all over the place now.. idk man

i feel like if there was some BIG action then i could step back and not feel like i have to consume every crumb but it's happening so slowly it's like i need to see the hints and crumbs and shit to keep hope alive.. dangerous cycle

Anonymous ID: d79e48 July 23, 2018, 1:21 a.m. No.2249941   πŸ—„οΈ.is πŸ”—kun

Hahahaha! I think I know what happened to Kanye.

 

According to Renegade anon he was owned by the Kardashians. Kim dosed his drinks, etc, then had him committed and took control of his life, legally, as his wife.

 

POTUS gave it back to him. Gave him the dirt on the Kardashians and whoever else he needed to have his strings effectively cut.

 

Then makes Kim stand behind POTUS in the White House!

 

Kek. Explains the murderous look on Kanye’s face after the meeting at Trump Tower. He didn’t want to talk.

 

Now he gets revenge.

[m4xr3sdEfault]*******,=,e οΌΌοΌΏγƒΎ(α–β—ž ) ID: ad01da July 23, 2018, 1:21 a.m. No.2249945   πŸ—„οΈ.is πŸ”—kun

adversus solem ne loquitor do not speak against the Sun Or, "do not argue what is obviously/manifestly incorrect

Anonymous ID: 408ac7 July 23, 2018, 1:21 a.m. No.2249946   πŸ—„οΈ.is πŸ”—kun

>>2249934

the cage symbolism is him crying for help and proof he was under hollywood's cage…

 

read his latest Esquire interview published in March.

 

he claims he was raped.

 

Basically, is totally over Hollywood.

 

And, talks like he's preparing to expose it all.

[m4xr3sdEfault]*******,=,e οΌΌοΌΏγƒΎ(α–β—ž ) ID: ad01da July 23, 2018, 1:22 a.m. No.2249947   πŸ—„οΈ.is πŸ”—kun

a falsis principiis proficisci to set forth from false principles Legal phrase; Cicero, De Finibus, 4.53

Anonymous ID: b2848d July 23, 2018, 1:22 a.m. No.2249948   πŸ—„οΈ.is πŸ”—kun

>>2249900

This could be too. Either way the Iran tweet heard round the world along with the FISA doc release were dam break events. Q returning from the shadows to help guide the next phase just fits.

Anonymous ID: 9f2d2e July 23, 2018, 1:23 a.m. No.2249951   πŸ—„οΈ.is πŸ”—kun

>>2249341 (lb)

Very sensible analysis, up until the God saves Israel stuff. For the sake of simplicity I prefer to keep things on the earthly plane, that's complicated enough. It has its place I know…

 

So, I would say according to 947 that Muslim Brotherhood is involved. 'Frenemies with Iran.'

Wrap your head around this matrix:

https://www.middleeasteye.net/news/iran-and-muslim-brotherhood-best-enemies-2061107490

 

>>2249087 (lb)

This stuff is just habbening now and that's from back in Jan! So much more to dig.

Anonymous ID: 4fd2d2 July 23, 2018, 1:23 a.m. No.2249953   πŸ—„οΈ.is πŸ”—kun   >>9991 >>0026 >>0180

>>2249905

i was here a handful of times when new bakers fucked up the numbering but they (at least those days) quickly addressed and fixed it.

this is something funky going on because the enemy is deeply disturbed by the fact that Q is going public, new arrivals will continue to increase, our /moab/ will grow to full capacity, and they will be exposed for the evil they do.

so they want to do 3 things:

  1. fuck up the organization of the breads

  2. deter new arrivals by creating an air of confusion and contrarianism

  3. deter oldfags by shitting up the breads to the extreme they're unbearable.

we have to be vigilant, be aware and fight to keep things as much in check as possible esp. now, and at least until BO/CM can make a formal statement, which we need to continue to ask for until we get.

wwg1wga.

[m4xr3sdEfault]*******,=,e οΌΌοΌΏγƒΎ(α–β—ž ) ID: ad01da July 23, 2018, 1:27 a.m. No.2249961   πŸ—„οΈ.is πŸ”—kun   >>9968

alterius non sit qui suus esse potest let no man be another's who can be his own Final sentence from Aesop ascribed fable (see also Aesop's Fables) "The Frogs Who Desired a King" as appears in the collection commonly known as the "Anonymus Neveleti", in Fable 21B: De ranis a Iove querentibus regem). Motto of Paracelsus. Usually Attributed to Cicero

Anonymous ID: d79e48 July 23, 2018, 1:27 a.m. No.2249964   πŸ—„οΈ.is πŸ”—kun   >>9974

>>2249901

 

I gave you shit on your last comment but in reality I know the feels. Not fat feels but fuckin up normal life feels. Casualties of war to some extent but also don’t make excuses (talking to myself too). There will be a payoff of sorts, but it will be in the midst of a lot of pain. When people wake up, or want to wake up, you’ll be a nice comfortable shoulder to cry on and learn from.

 

WWG1WGA chubby anon!

 

WWG1WGA!

Anonymous ID: 275d61 July 23, 2018, 1:27 a.m. No.2249966   πŸ—„οΈ.is πŸ”—kun   >>9985

It's quite obvious that now everything unfolds and makes progress like Trump on Iran, Q will post soon again or at least he has to, so he can lead us to the right direction once again. My theory is Q posts either tomorrow or friday.

[m4xr3sdEfault]*******,=,e οΌΌοΌΏγƒΎ(α–β—ž ) ID: ad01da July 23, 2018, 1:29 a.m. No.2249970   πŸ—„οΈ.is πŸ”—kun

asinus asinum fricat the jackass rubs the jackass Used to describe 2 persons who are lavishing excessive praise on one another

Anonymous ID: f253b5 July 23, 2018, 1:30 a.m. No.2249973   πŸ—„οΈ.is πŸ”—kun   >>9980 >>0000 >>0033 >>0244

JULY 23RD NowC@mesTHEP@inβ€”-23!!!

 

The only reason Q would be done posting is because Q's work is complete and the hammer is about to fall, meaning arrests and prosecutions will commence of Hussein, the witch, comey, et al. and the sealed indictments opened.

 

When it is done, Q is done. It is the moment we've all Been waiting for, The moment Q promised us would come.

 

The grand finale is upon us. Fasten your seatbelts and enjoy the show. ThankQ. (If im wrong, Q will return.)

Anonymous ID: 9564c5 July 23, 2018, 1:30 a.m. No.2249974   πŸ—„οΈ.is πŸ”—kun   >>0011

>>2249964

hey i'm not chubby! :(( just not as fit.. i still eat an extremely healthy diet so there's that

 

but YOURE RIGHT my grandparents and parents went through so much worse i need to stop being a baby.. one day they will all see why i've been a hermit..either way the work never ends! WWG1WGA <3

Anonymous ID: 4fd2d2 July 23, 2018, 1:31 a.m. No.2249975   πŸ—„οΈ.is πŸ”—kun   >>9994

>>2249965

right the + means positive.

try to stick to a variety of lean protein, the fk away from soy and whole grains and try to limit grain in any form at all… you need lean meat like chicken and fish, and a variety of fruit and veg. you need vitamin d with K2.

[m4xr3sdEfault]*******,=,e οΌΌοΌΏγƒΎ(α–β—ž ) ID: ad01da July 23, 2018, 1:33 a.m. No.2249982   πŸ—„οΈ.is πŸ”—kun   >>9990

These fag actors will be like a banal South Park of adult child emotional appeals brought to you by tax dollars and pro ciascalps

Anonymous ID: 55c4f1 July 23, 2018, 1:34 a.m. No.2249985   πŸ—„οΈ.is πŸ”—kun   >>9997

>>2249966

Maybe the Plan is rolling and he doesn't' need to come back

 

What do you expect from him?

 

Now that he has pretty much laid out a plan that will take month more to run through the phases in process.

 

What more do you think he needs from us. We haven't answered most of his open questions, but he has no need to.

 

He already know the answers, and was a favor to us to peak behind the curtain

Anonymous ID: 775577 July 23, 2018, 1:34 a.m. No.2249986   πŸ—„οΈ.is πŸ”—kun   >>0004

>>2249952

You should've seen the half-woke Anons freaking out and crying about their Muh Rick And Morty Show!!!! Oh, no!!!! Love that show!!!! Love muh mind-control programming and dumbing-down of society!!!! It was sad and pathetic.

Anonymous ID: 09138b July 23, 2018, 1:34 a.m. No.2249991   πŸ—„οΈ.is πŸ”—kun

>>2249953

I'm not denying there isn't some form of fuckery going on here. I was just pointing out that before this board became public, breads did not leave in numerical order. Sometimes 50 breads were spanned. I just wondered if the only reason we are seeing it now is because Q hasn't posted in so long. Very few anons went looking for breads that were much older than a week. However, with so many breads suddenly getting a 404, there appears to be something wrong.

I agree with your other thoughts and will add the clowns who purposefully try to start a disinfo campaign to prove we are nothing more than conspiracy theorist. It's critical we stick together and fight, fight, fight.

Cheers anon.

Anonymous ID: d43587 July 23, 2018, 1:35 a.m. No.2249992   πŸ—„οΈ.is πŸ”—kun   >>0027 >>0029

I'm not sure if this is a POSSIBLE Q decode:

 

Revolves around the following 3 pieces of information:

  1. Q post 556 with the phrase: "Make sure to learn Russian.": https://qanon.pub/?q=russian#566

  2. Putin's mention of Browder recently: https://www.businessinsider.com/trump-putin-bill-browder-magnitsky-act-press-conference-2018-7

  3. The recently resurfaced Magnitsky documentary. It's on bitchute. One of the relevant parts starts at 52:00 and on through the German politician's interview.

 

Some interesting things in the documentary, which is about the accountant who is the namesake behind the Magnitsky Act.

The official narrative is he was killed because he accused some Russian cops of stealing from Browder's interests, and they locked him up until he retracted his accusations, but held out until he died.

The EU MSM proof of this is the Russian police document which is a supposed written account or testimony and Magnitsky's accusations against the officers, and his subsequent imprisonment, and harsh treatment, which lead to his death.

According to the director, because it's in Russian, everyone (including himself) took Browder's translation of the document for granted that's what the documents say. Apparently, nobody else in western media bothered to have it translated on their own?

 

Long story short, the director contends that Magnitsky never named the officers of stealing directly, his proof being the same exact document, contrary to the widely spread translation of the document. (Which destroys the motive to kill him).

The connection to Q, and what might be the decode, is that in the U.S., the Act is passed, based on a possible FALSE TRANSLATION of said RUSSIAN "testimony". Make sure to learn Russian?

 

I couldn't track down the scrib document, that was a screen grab from the documentary, plus I don't speak/read Russian anyway, but thought maybe an anon could track it down and take a look at the actual testimony for themselves. That's all I got, and I could be way off, or maybe misunderstood some things in the doc though, because I know nothing about the Russian political atmosphere.

 

Little bonus crumb included in pic.

Anonymous ID: 9564c5 July 23, 2018, 1:35 a.m. No.2249994   πŸ—„οΈ.is πŸ”—kun

>>2249975

i don't eat dairy meat grain/gluten soy or processed foods.. before i became addicted to Qresearch i made sure to get at least an hour of sunlight every day, usually more.. i got lots of nutrition red pills for ya but too hard for most people to swallow

 

and

>>2249983 whaaat i am intrigued tell me more

Anonymous ID: 5714f9 July 23, 2018, 1:35 a.m. No.2249995   πŸ—„οΈ.is πŸ”—kun   >>0019 >>0024 >>0034 >>0039 >>0045 >>0147

>>2249714 (lb)

Expand Thinking

You're more important to the World/Universe than you believe.

Everything in life has Meaning.

Why else would our Mongolian brother be wearing green

Everything Connected.

Angels are real.

You like to call them Coincidences, but we call them signs.

Just because you can't see us and hear us, it does not prove we can't see you and hear you.

This is bigger than you can imagine.

Trust G, he works for the Boss upstairs and not for my brother who resides downstairs.

My wings are growing in nicely this reset, and soon yours will too.

Have faith

 

Gift is for (you) Anon >>2249714 (lb)

G has multiple meanings

GOD, Geometry, Green, Grandma, G=7, Gift

Why did Native's perform a rain dance?

Why would Native's teach children the rain dance generation after generation if it were a LARP.

All that Rain Dancing from Natives on multiple continents has meaning.

Think Logically.

Why?

Watch the Water.

These people are stupid.

Comey Comey Comey

A farm bill, Farmers, Farming.

Timing is crucial

^Take the last 5 lines and ask yourself why is Comey standing in a cornfield like he's lost and confused.

Pray for the Good People in the Middle East and………. MAKE IT RAIN

READ THE BIBLE

GOD WINS

G

[m4xr3sdEfault]*******,=,e οΌΌοΌΏγƒΎ(α–β—ž ) ID: ad01da July 23, 2018, 1:36 a.m. No.2249998   πŸ—„οΈ.is πŸ”—kun   >>0134

As well you should know

This stupid cia experiment

Those fucking murderpus crack dealer memes you call politicians

Leaves little room for apothogy

~serial smasher

Anonymous ID: 408ac7 July 23, 2018, 1:36 a.m. No.2249999   πŸ—„οΈ.is πŸ”—kun   >>0007

UPDATE: Aaron Bondaroff has now stepped down from Know Wave following allegations of sexual misconduct. After the news broke yesterday, Bondaroff announced that he resigned from his co-founded gallery, Moran Bondaroff.

Anonymous ID: fa085a July 23, 2018, 1:37 a.m. No.2250004   πŸ—„οΈ.is πŸ”—kun   >>0021 >>0049

>>2249986

Your a fucking shill. Rick and Morty is a show that is redpilling the youth of America. The Jew is trying to take it out. You watch the episode where they have a presidental election and they beg the new president to destroy everyone who tries to keep the old order? You see the first episode of season 3 where they show you a currency reset?

 

You Jews are moronic. You will not win this battle. Dan Harmon is no kid fucker. He was showing the insanity of the kid fuckers.

 

Yuck it up now kikes….your day is coming fast.

Anonymous ID: fe3ba6 July 23, 2018, 1:38 a.m. No.2250006   πŸ—„οΈ.is πŸ”—kun

>>2249882

>>2249882

 

"…a range of grades are available including Mil Spec (military grade),…"

 

Perhaps related to compromising our Mil equip with China? Maybe its about that deal. We already know that it was happening. Just a coincidence there.

Anonymous ID: d79e48 July 23, 2018, 1:40 a.m. No.2250011   πŸ—„οΈ.is πŸ”—kun   >>0050

>>2249974

 

Your estrogen is showing anon, kek. I don’t know of the best serious advice to give you except remind yourself of the scale of the issue at hand.

 

We are saving the world. And all the little kids. And all the people that live as slaves. This is something to be proud of.

 

Another thing…. It will never end. There will always be evil waiting to take advantage of someone. There will always be work to do. Part of what hanging around here will get you is a cold heart. Or at least a walled off place in your heart that holds the knowledge of the continual horrors that go on in the world. I couldn’t imagine what it’s like to be a high empathy person learning this stuff. I can compartmentalize, it got me through my childhood, helps me survive here.

 

Guilt slows you down anon. You sound like a patriot, you should feel pride. Sacrifices have to be made in war.

 

β€œThe worst guilt is to accept an unearned guilt.” - Ayn Rand

Anonymous ID: ae7b0b July 23, 2018, 1:41 a.m. No.2250018   πŸ—„οΈ.is πŸ”—kun

ERBIL, Iraq (Reuters) - Gunmen entered the governorate building in Erbil, the seat of the Kurdistan Regional Government (KRG) in northern Iraq on Monday, and fired from windows at security forces, a deputy governor of the city and Kurdish security officials said.

 

https://www.reuters.com/article/us-iraq-kurds-attack/gunmen-open-fire-and-enter-erbil-governorate-building-in-iraqs-kurdish-region-officials-idUSKBN1KD0MF?utm_source=twitter&utm_medium=Social

Anonymous ID: d79e48 July 23, 2018, 1:43 a.m. No.2250021   πŸ—„οΈ.is πŸ”—kun   >>0064

>>2250004

 

You may be right. They prob had some counter shots ready to go. This one was at the top of their list. We took down their guy, they muddy the waters with this.

 

Or they’re both sick fucks. Not sure yet.

Anonymous ID: 0b0084 July 23, 2018, 1:47 a.m. No.2250033   πŸ—„οΈ.is πŸ”—kun   >>0129

>>2249973

The "Plan to Save the World" video states that Q will return to help keep us informed once the "war breaks out onto the surface".

I think there's still some time before that kind of stuff (Octoberish).

IN the meantime we have the FISA and OIG reports to get unredacted somehow..

Anonymous ID: 2e9175 July 23, 2018, 1:49 a.m. No.2250036   πŸ—„οΈ.is πŸ”—kun

>>2249777

Never doubted

 

>>2249718 lb

>we need standard protocol, which all bakers are bound to follow

I agree, but it has to come organically, transparently, voluntarily, by consensus, and leave a wide latitude for interpretation or autists won't thrive. We need to recruit more autist bakers (LOOKING AT YOU FAGGOTS) and then hash this stuff out a bit more

 

>>2249808

>Since there are negligible rules here there is negligible responsibility

Incorrect. It's just that the responsibility is entirely subjectively motivated, no outside authority. Some ppl have higher standards and sense of duty than others. The key to organizing groups of independent thinkers is recognition of proven work product, open for all to see, and the freedom to do that work with minimal interference. This is why Q came here. Autist consensus will decide what/who they want. It's been working well, we don't want to break it. Just buttress as needed to withstand greater stress test of shills and normies.

Anonymous ID: 09138b July 23, 2018, 1:49 a.m. No.2250038   πŸ—„οΈ.is πŸ”—kun   >>0047 >>0078

For anons thinking Q won't be coming back.

Jan 23, Q states his last post will self destruct.

We haven't seen that yet. There was another post that I can't find right now, (too tired) that also alluded to more to come.

Anonymous ID: 1556b1 July 23, 2018, 1:50 a.m. No.2250042   πŸ—„οΈ.is πŸ”—kun   >>0051

>>2249967

>>2250010

>>2250008

 

 

if the thread is not locked to the board, then after awhile it will fall off.

 

The same thing happened to advanced memes thread. We made another one, and BO locked it.

 

I imagine that was what happened. If you make a thread, that you think is important, need to have BO lock it, or it will fall off the board into archives.

Anonymous ID: 9504c2 July 23, 2018, 1:50 a.m. No.2250043   πŸ—„οΈ.is πŸ”—kun   >>0058

plan to take down pedowood

  1. go to every famous actor/actresses social media accounts (facebook/twitter/myspace etc..)

  2. find at least 1 post containing pedophilia

  3. get friends to retweet the posts and give the pedos the hook

Anonymous ID: 9564c5 July 23, 2018, 1:52 a.m. No.2250050   πŸ—„οΈ.is πŸ”—kun   >>0067

>>2250011

oops shh..

and thank you for these words, anon. i really needed the reminder.. the work never ends but i do believe when most of the filth of this planet is removed, we have golden days ahead of us.. i'm high empathy but i am (usually) able to mentally abstract the truth so much that it loses most of its sting..

100,000ft view

but you're right.. this is war and i am proud to be here fighting alongside patriots. amazing times we're living in..

Anonymous ID: ab5b87 July 23, 2018, 1:52 a.m. No.2250052   πŸ—„οΈ.is πŸ”—kun

I missed this…different time zone.

When POTUS learns your comms!

I like the way he did this. NK/China/Iran…they all use the same 'mother of all empty threats'. Posturing/bluff/maintain their image.

 

Anyway; I agree with earlier posts, it seems to be playing out like NK.

Anonymous ID: 4fd2d2 July 23, 2018, 1:53 a.m. No.2250055   πŸ—„οΈ.is πŸ”—kun   >>0213

>>2250031

the 7/4 Q-drop bread is 404

thenceforth, bakers decided to stop posting any of the Q-drop breads at tops of bread, and instead posted highlighted, old, q-drops.

we are looking for clarity regarding 2 things:

  1. why the newer breads are gone

  2. why the formatting of breads suddenly changed to not even show the archived Q-breads

see

>>2249802

>>2250026

and THANK-Q!!

Anonymous ID: 4fd2d2 July 23, 2018, 1:54 a.m. No.2250062   πŸ—„οΈ.is πŸ”—kun

>>2250031

note - anons had to beg thru multiple breads to even get an acknowledgement of the problem, and have been begging ever since, for a better solution… we need your help BO. TY and God bless BO.

Anonymous ID: de5528 July 23, 2018, 1:55 a.m. No.2250063   πŸ—„οΈ.is πŸ”—kun   >>0459

>>2249988

 

The Greenspuns & blurb on WJC connection.

 

Thanks MSNBC!

 

What Hillary Clinton’s $225,000 speaking fee buys you

10/14/14 09:50 AMβ€”Updated 10/14/14 01:50 PM

By Alex Seitz-Wald

 

A summer dominated by concern about Hillary Clinton’s wealth has given way to a more friendly autumn. But questions about her finances returned to the headlines Monday night, because of a paid speech she gave to a school in Las Vegas.

 

The keynote speech to the University of Las Vegas Foundation’s annual dinner became controversial in July when students said they wanted funds put towards student aid, instead of Clinton’s $225,000 speaking fee.

 

Republicans sought to revive the issue Monday, sending out an email to reporters slamming β€œClinton’s Nevada Pay Day.” Much of the local news coverage of the event included reference to the payment and the controversy. (Clinton donated the speaking fee to her family’s charitable foundation.)

 

So what did the university get for it’s money?

 

Clinton helped helped raise $350,000 (minus her $225,000 speaking fee) by selling out the event at the Bellagio, where tickets for the 900 guests went for up to $3,000. Here’s what else they got:

 

2016 flirtation: Anyone seeing Clinton speak is hoping for some insight on her 2016 plans, and she is usually happy to deliver.

 

In Las Vegas, there were new euphemisms for β€œthat other thing,” as Clinton called a potential presidential run in Iowa.

 

Before beginning the Q&A portion of the event, moderator Brian Greenspun handed Clinton a pair of Nikes, which he made sure to point out were β€œrunning shoes.” Greenspun is the publisher of the Las Vegas Sun and a UNLV trustee, but before that he was Bill Clinton’s college roommate…

 

https://www.msnbc.com/msnbc/hillary-clinton-what-225000-and-pair-nikes-buys-you

Anonymous ID: fa085a July 23, 2018, 1:56 a.m. No.2250064   πŸ—„οΈ.is πŸ”—kun   >>0091

>>2250021

check out the Rick and Morty episode where they show King Jelly Bean, a leader of a medevial area that lures Morty into a bathroom and tries to rape him in a bathroom, Morty comes out crying and Rick figures out what is going on, plays it cool and then shoots King Jellybean and blows him up. It is an extreme anti-pedophile episode. It's the Meseeks and Destroy epsiode Season 1 Episode 5.

 

his channel 101 show was a mini video film fest that went on each week, where they did creative and very non mainstream videos, often making fun of the news of the week, which might have included a politician or someone in the news who had raped a baby so it may have been an attack on something liek that, but these were low budget and cheap and so the context is lost in this lone clip. Harmon's Rick and Morty is a red pill show that flew under the radar because they were 'loser animation on adult swim, nothing to worry about there', but now that it came on their radar, they are looking to take people down. dont be fooled.

Anonymous ID: e9b66c July 23, 2018, 1:57 a.m. No.2250070   πŸ—„οΈ.is πŸ”—kun   >>0084

>>2250046

It's a Y-cromosomal (patrilineal) dna group.

>The technical details of M242 are:

Nucleotide change: C to T

Position (base pair): 180

Total size (base pairs): 366

Forward 5β€²β†’ 3β€²: aactcttgataaaccgtgctg

Reverse 5β€²β†’ 3β€²: tccaatctcaattcatgcctc

 

https://www.eupedia.com/europe/Haplogroup_Q_Y-DNA.shtml

If you're interested in more, feel free to search for it? :)

Anonymous ID: 879980 July 23, 2018, 2:01 a.m. No.2250080   πŸ—„οΈ.is πŸ”—kun   >>0234 >>0391 >>0458

Hey anons we're having a really interesting and possibly huge conversation on 8chan pol about some water issues a few anons discovered happening around America. This may be very big and very related to "watch the water" as it does make sense what they are saying but they need people from different areas to confirm things. You guys should at least look at it as this looks very big from what they are writing. Conversation got sidetracked to water about halfway down so just go to bottom and up a bit and it's all about it.

 

https://8ch.net/pol/res/11895442.html

Anonymous ID: 275d61 July 23, 2018, 2:02 a.m. No.2250083   πŸ—„οΈ.is πŸ”—kun

>>2250068

Bread was deleted from July 4th, you can check it on qanon.pub

 

Others said it were archives, however some older breads, even older than June are still active, so that doesn't make really sense. I still believe someone deleted them.

Anonymous ID: 55c4f1 July 23, 2018, 2:02 a.m. No.2250085   πŸ—„οΈ.is πŸ”—kun   >>0094 >>0106

>>2250057

R.E.M. - It's The End Of The World

https://www.youtube.com/watch?v=Z0GFRcFm-aY

 

No one in the outside world gives two shits about this board (except the amateurs shills) No on is gonna waste any AI horsepower, or 3-letter agency professionals UNLESS Q is here. Otherwise, the will let this board melt down like all of them do, for all the same reasons

 

We aren't essential to the Plan - Deal with it

 

It is happening out in the real work without us

 

Open your eyes and use a little logic -

 

8 chan is NOT going to save the world - grow up

Anonymous ID: d79e48 July 23, 2018, 2:04 a.m. No.2250091   πŸ—„οΈ.is πŸ”—kun   >>0124

>>2250064

 

I’ve seen some of it and loved it. The science they reference is usually spot on with what I know, always gave me the nerd feels.

 

My pedo guard is up high. I guess that makes me vulnerable to cabal psycho-judo.

 

I will investigate further thank you.

Anonymous ID: fa085a July 23, 2018, 2:06 a.m. No.2250099   πŸ—„οΈ.is πŸ”—kun   >>0105 >>0109

>>2250077

Yes it will. In time.

 

Rick and Morty was the highest rated comedy on Cable. Comedy Central did not try hard to resign him at first….they fucked around. Story was they were not going to resign it. But it would of looked insane to dump the most popular show on TV.

 

Dan has been fighting these assholes for years.

Anonymous ID: e7ef81 July 23, 2018, 2:07 a.m. No.2250101   πŸ—„οΈ.is πŸ”—kun

>>2250000

Not saying it will be done overnight but that the hammer is about to fall.

 

Sure it will take time to prosecute everyone involved but something significant is going to happen to start things moving, wake up the sleepers and give up wakers peace.

Anonymous ID: 3a905a July 23, 2018, 2:09 a.m. No.2250107   πŸ—„οΈ.is πŸ”—kun   >>0113 >>0114 >>0145 >>0257

>>2250088

Well what happens often (And I see it happen on /pol/ alot) is that old breads get bumped up back to the top of the board, while at the same time, garbass ass threads are created that slide the good breads off of the catalog. That could be what happened. I think the board archives update on the first week of every month. I shot CM a message so I'll wait for his response.

Anonymous ID: d79e48 July 23, 2018, 2:09 a.m. No.2250109   πŸ—„οΈ.is πŸ”—kun   >>0140

>>2250099

 

Possible both a little true? Maybe he’s comped in some other way, blackmail stuff, which explains him dipping on the twat the way he did. But if we laid the cards down and ordered them after this is all said and done he’d be on the hookers and blow side and not the ritual sacrifice one.

 

If he’s red pilling like you’re saying he is he’d have to have a source.

Anonymous ID: 4fd2d2 July 23, 2018, 2:11 a.m. No.2250113   πŸ—„οΈ.is πŸ”—kun

>>2250107

Could we please have the breads formatted in the usual manner, like they used to be, regardless of the breads being in archive or not, like we always have,.. with a notice about the missing recent Q-breads ?

Anonymous ID: a45d00 July 23, 2018, 2:13 a.m. No.2250119   πŸ—„οΈ.is πŸ”—kun   >>0165 >>0170

>>2250100

Been lurking because I am using an old computer and it is giving me fts. In between that and phonefagging I have caught bits and pieces of threads throughout the last several hours.

I think I finally got this one straightened out. That whole time, I saw a huge amount of concernfagging and sliding about Muh Bread and some asshole jumping BO's shit.

 

I just want to say

SHUT THE FUCK UP

to that asshole if he is still around.

Whiny fuckin' cunt

Anonymous ID: fa085a July 23, 2018, 2:14 a.m. No.2250124   πŸ—„οΈ.is πŸ”—kun   >>0182

>>2250091

Yes….(((they))) think all their attacks out in detail. They are using our own desires to stop pedos to clowd our thinking and encourage us to attack our own people.

 

It is basically what they tried on Trump with the METOO movement. Set up some big wig Jews to take the fall and seemingly create momentum to fire and prosecute women abusers. All leading up to the press conference where they stood up there and tried to bring Trump down. It was lies and it failed.

 

They are trying this attack against Dan Harmon as a mini version of that.

Anonymous ID: b39e8e July 23, 2018, 2:14 a.m. No.2250125   πŸ—„οΈ.is πŸ”—kun   >>0149 >>0211 >>0444 >>0457

Friendly reminder to anons

 

Cousin anon was a prepper, chem trail believer, rabid Pro-Trumper and a bit edgy / paranoid…

Couldn’t balance the stress of waiting…

Killed his wife, then himself yesterday.

Young kids left.

Very very sad….

PLEASE take time to breathe, pray or ground yourselves anons….

Waiting is part of The Plan

Anonymous ID: 55c4f1 July 23, 2018, 2:16 a.m. No.2250132   πŸ—„οΈ.is πŸ”—kun

>>2250112

What channel do get that show on in the Cosmic Consciousness.

 

It is all connected so it must be like the Internet.

 

Can the Cosmic Consciousnesses be hacked too?

 

How about hijackers on the Draco ships?

They have any Space Marshalls

Anonymous ID: fa085a July 23, 2018, 2:19 a.m. No.2250140   πŸ—„οΈ.is πŸ”—kun

>>2250109

Yes he likely has a pretty high up source. Justin Roland is a true conspiracy guy. Very up on the way the world works. Dan kind of acts like he just goes along with Justin but does not quite believe. I think that is an act to avoid too much Jew attention. Justin stopped making his podcast for a while because he was afraid people would figure out what they really thought and be vindictive….the Jews never forget. Look at Iraq and Russia. They attack them hundreds of years later for some damn Jewish afront.

Anonymous ID: 879980 July 23, 2018, 2:19 a.m. No.2250141   πŸ—„οΈ.is πŸ”—kun   >>0146

>>2250128

Not sure, I am a bit hardcore about my opinions on this subject and if I had it my way I would ban anyone who gets off topic, obviously the shills/larps when the track record shows pattern but I would also ban stupid questions and stupid statements as they fill too much of the threads up. So I am probably not the best person to ask on that.

Anonymous ID: fcfa75 July 23, 2018, 2:19 a.m. No.2250142   πŸ—„οΈ.is πŸ”—kun   >>0151 >>0166

>>2250121

>>2250123

 

(((muh david duke)))

YOUR (((kind))) provokes, derails, shills this board to oblivion with "muh third temple restoration" and have the FUCKING MOUTH to (((bitch)))?

 

Fuck off to israel roth state where your TRUE loyalty belongs, [[[shills]]].

 

US is NOT a jewish country. Get that through to your treasonous heads.

 

YOU killed JFK through your jewish bullshit, YOU collaborate on RACIAL level with pedos, sandnigger rapist scum, bring chaos to the world and OPENLY declare your "choseness"

 

Now you badger BO while lying and sliding to newbies about him being a shill.

 

The ONLY (((racist))) we need to get rid of is YOU and your fucking projecting cabal pawn buddies.

 

FUCK. OFF. (((SHILL))). Your times here is OVER. We know ALL your [[[TRICKS]]

Anonymous ID: 0b0084 July 23, 2018, 2:20 a.m. No.2250144   πŸ—„οΈ.is πŸ”—kun   >>0181

>>2249864

Anon, it'll all be over soon.

You can't leave right before things start to get fun. You put in all this time and energy during the preparations, and now the show is about to start.

WATCH THE SHOW WITH US ANON

DONT LEAVE NOW

HODL THE LINE

Anonymous ID: 7d0147 July 23, 2018, 2:22 a.m. No.2250148   πŸ—„οΈ.is πŸ”—kun   >>0152 >>0191

>>2250134

One of the things I've done during the Q lull is prepare to return to my previous way of life. Given the bulk of the data, I'll probably be doing something with it for quite a while. But I can balance things better. But for now, it feels to me like a calling to work with the data generated here. Eventually, I'll turn it into the type of blog a normie could access. The beginnings of that are already available.

Anonymous ID: 1a7199 July 23, 2018, 2:22 a.m. No.2250149   πŸ—„οΈ.is πŸ”—kun   >>0154 >>0163 >>0211

>>2250125

I have transformed into some kind of vagrant looking homeless guy thats mean to everyone now. Not blaming Q blaming the fact I know and no one else gives a fuck. Def stressful . Sorry to hear about a family broken , this is war no matter how many say we are just internet addicts or whatever. The waiting is because of the clock and the plan. Simple to get to this conclusion. This evil has killed another 2 people it sounds like. Q will finish this with the heavy lifting soon I hope.

Anonymous ID: 021485 July 23, 2018, 2:23 a.m. No.2250151   πŸ—„οΈ.is πŸ”—kun   >>0153 >>0156 >>0171

>>2250142

 

BO. MY POINT.

These fuckinig SJWs hijack every fucking bread with [their] CIA David Duke Paid PROPAGANDA.

 

If anyone disagrees (in any way shape or form, they are a KIKE)

They spam the same half truths, lies and utterly stupid historical bullshit, in every bread.

Anonymous ID: 021485 July 23, 2018, 2:25 a.m. No.2250155   πŸ—„οΈ.is πŸ”—kun

In those days the people of Judah will join the people of Israel, and together they will come from a northern land to the land I gave your ancestors as an inheritance.

Anonymous ID: 5714f9 July 23, 2018, 2:25 a.m. No.2250159   πŸ—„οΈ.is πŸ”—kun

>>2250019

Trust what your heart/soul tells you and ask yourself what side is winning.

POTUS was chosen for a reason.

JA was chosen for a reason.

Q was chosen for a reason.

SR was chosen for a reason.

8-chan was chosen for a reason.

G was chosen for a reason.

Dennis Rodman was chosen for a reason.

Autist's too were chosen for a reason.

(you) were chosen for a reason.

General Mattis was chosen because he can choke the enemy without using his hands.

Trust the Plan goes back further than you think.

I pray every day for those who can't see the LIGHT and work very hard to show them the LIGHT.

TRUTH brings LIGHT.

KEEP FIGHTING and IGNORE THE SHILLS.

GOODNIGHT AND GOD BLESS ALL YOU ANGELS, YOU ARE NOT ALONE.

G

Anonymous ID: 1556b1 July 23, 2018, 2:25 a.m. No.2250160   πŸ—„οΈ.is πŸ”—kun   >>0173 >>0176

>>2250112

>>2250105

Over decades the general population, likes, loves, admires many people they see on tv.

They relate to the characters they play, and think they are good people.

 

We all thought many of them were good.

 

One thing many of us anons have had to come to terms with, is the people we have watched and loved since our childhoods, are all evil, sick, cruel, twisted monsters.

 

Hollywood stars are doing everything to lie, manipulate, and hide the truth from the people.

 

Many people listen to their idols. Many think they are reflections of the people they play.

 

These are the people screaming the loudest against Trump anmd all good progress.

 

These are the people who have been manipulating everyone, and corrupting people.

 

They need to be exposed, people need to start waking up, and seeing them for what they are.

 

Having the tangible tweets, and pics, etc, helps now , with red pilling, before the arrests come.

 

Anons discovered James Gunns tweets, look at what that lead to. Disney fired him, and alot of normies got a tiny taste of what people in hollywood are really like. So when the arrests comes, and that evidence comes out, they will be prepared, and better able to accept it.

 

Proabably the same numbers as congress, upwards of 70% or more of the people in hollywood, and music, are a part of the cult/club.

 

And A list stars, are, i imagine around 95 to 99%

Anonymous ID: 97fd77 July 23, 2018, 2:26 a.m. No.2250161   πŸ—„οΈ.is πŸ”—kun   >>0177 >>0179 >>0224 >>0240

>>2250138

So, what board did she allegedly post this to? qresearch? and it is the funniest thing I have ever heard!! "Some of you aren't as anonymous as you think!" No kidding! Exposing the truth is number 1 priority. Anonymity is a secondary priority. There are millions of eyes on this board. Millions of people who are learning the truth. This is the begginning of something great anons. You should all be proud of the work you have done. I know I am.

 

But, Sarah Silverman is not posting threats here? Right? She would have to be crazy…

Anonymous ID: d79e48 July 23, 2018, 2:27 a.m. No.2250165   πŸ—„οΈ.is πŸ”—kun

>>2250119

 

My filter goes something like this.

 

Simple shill shit posts to trigger us. Just scroll.

 

Advances shill concernfags. This will always work to some degree, momentarily. Sound like an anon and play off of inexperience of new fags. Easy to spot most of the time when rebuttals are made and response is shilly.

 

Human pieces of scum do the back and forth shill. They engage and with each other and have a retarded conversation in which the idiot usually convinces the more reasonable person challenging them. Or one of a multitude of retarded mixes of truths and dog shit. The key to spotting these is identifying contradictions in competency. In other words, given that they sound anon enough to get point A, they ought to know point B. And they usually move in small groups. They think we give a fuck that their friend thinks they’re right.

 

Anyway rant over, bed time.

Anonymous ID: e54c24 July 23, 2018, 2:27 a.m. No.2250166   πŸ—„οΈ.is πŸ”—kun   >>0184

>>2250142

 

Division shilling 101 here. At least you are not spamming repetitive low level copypasta like your friends from the other breads.

"Blah blah blah jews".

 

There is a problem with certain ellites who are jewish and wirh the religious jewish attitude of the chosen people. But using identity group politics chases away those jews who dont follow the ideology you go against and makes you and the board sound nazi to them and to normies.

Anonymous ID: 1a7199 July 23, 2018, 2:27 a.m. No.2250167   πŸ—„οΈ.is πŸ”—kun   >>0172

>>2250154

I know I keep my patience as high as I can . Its difficult when you walk from the garage into the home and its sesame street level mentality and dealing with children both adults and the real thing. Walk back out into the garage and its world war. I am adjusting and was being a bit dramatic. I try to be nice to as many people as I can but it has gotten less as the normies hate my president so I assume almost all are against him. I yell out TRUMP in public and the white men hang their heads in shame and turn the backs on me. Sickening.

Anonymous ID: fcfa75 July 23, 2018, 2:28 a.m. No.2250171   πŸ—„οΈ.is πŸ”—kun   >>0174 >>0178

>>2250151

>SJWs

>seriously believing this shit

>double posts to 'support' and forgets to chang IP

 

That's some fucking kike level pretzel retardation.

 

You stupid fucks are singled out for a reason you dumb motherfucking cunts.

 

Do you see ANY other group doing this?

 

ANY?

 

YEA WE FUCKING KNOW THERE ARE MUZZIES trying to larp.

 

We can pick em out easier than you can.

 

YOU fucking badger BO, YOU bitch about notables trying to prune them, YOU manipulate those like AFLB and try to ruin like you shill and slide comment boards all across media platforms and online networks.

 

YOU fucking collaborate with MSM to push angles here, you fucking treasonous whores.

 

FUCK. OFF. (((CUNT)))

Anonymous ID: 2e9175 July 23, 2018, 2:30 a.m. No.2250180   πŸ—„οΈ.is πŸ”—kun

>>2249953

Can't speak to point 1, don't know history.

But these are true. Coordinated:

>2. deter new arrivals by creating an air of confusion and contrarianism

>3. deter oldfags by shitting up the breads to the extreme they're unbearable.

Night Crew still has cleanest comms, but they tried pretty hard earlier this week to fuck that up. Many of you have been putting time in days calling out fuckery, is a good thing. Shaking the hornet's nest.

Keep up the good work.

>we have to be vigilant

Always. It's the only way.

Enemy never sleeps.

Adapts. Counters.

Good thing we're better at it, kek

Anonymous ID: 9564c5 July 23, 2018, 2:31 a.m. No.2250181   πŸ—„οΈ.is πŸ”—kun

>>2250133

anon i am still plenty anonymous…

this post scares me lol

 

>>2250134

i know.. already experiencing that.. i tried to wake them up but they rather enjoy being asleep

 

>>2250137

not worried about chicks..though honestly it would be great to marry an anon..can't imagine dating anyone comatose..and yes priorities have definitely shifted but it's worth it

 

>>2250144

don't worry..apparently i can't leave even if i try! lol wwg1wga fam

Anonymous ID: d79e48 July 23, 2018, 2:31 a.m. No.2250182   πŸ—„οΈ.is πŸ”—kun   >>0198

>>2250124

 

Maybe. He still fucked a baby doll. Need to rectify still. If he’s doing that to hurt the deep state somehow there ought to be some evidence to back that up. I’m open to it I’d prefer to like that show.

 

The story is plausible. The show has some red pill material.

Anonymous ID: 708354 July 23, 2018, 2:31 a.m. No.2250183   πŸ—„οΈ.is πŸ”—kun   >>0217

>>2250162

Six degrees of separation…

get this message to the β€œsleeping” sheeple and watch what happens!

 

Our government has allowed an organized fraudulent centralized banking cartel to print fiat currency at will, which they use as an economic whip to beat ALL working people mercilessly…

They never ended slavery, they just figured out a way to include everyone in their scheme.

Q team, I urge you to return us to a constitutionally mandated monatary policy before we are confronted with the inevitable collapse.

 

Of course… we can’t say we weren’t warned:

 

"If the American people ever allow private banks to control the issue of their currency, first by inflation, then by deflation, the banks and corporations that will grow up around them will deprive the people of all property until their children wake up homeless on the continent their Fathers conquered…. I believe that banking institutions are more dangerous to our liberties than standing armies…. The issuing power should be taken from the banks and restored to the people, to whom it properly belongs."

-Jefferson

 

https://www.zerohedge.com/news/2018-04-02/there-no-escaping-history-fiat-currency-eventually-fails

Anonymous ID: fcfa75 July 23, 2018, 2:31 a.m. No.2250184   πŸ—„οΈ.is πŸ”—kun   >>0186 >>0189

>>2250166

 

IP hop some more, (((nigga))).

"normies" are WIDE AWAKE and pissed off now, you fucking idiot shill.

Clearly living in the #1 organ/human trafficking destination of the middle east while playing "chosenite" fucked with your perception, kikey.

 

We know your games.

There was nothing pleasing about "saving israel for last".

 

We remember JFK. You failed.

Anonymous ID: 1a7199 July 23, 2018, 2:33 a.m. No.2250187   πŸ—„οΈ.is πŸ”—kun   >>0207

>>2250172

Florida if you can believe it. I say "Thank God for President Trump "out loud and everyone scurrys away and hangs there heads scared to agree or brainwashed. This is for sure a mental challenge as well as all the rest. This memewar is nothing to laugh at. Mentally I am cracking. Not blaming anyone or whining. I have been waiting for justice since 91101 and I can wait as long as needed. My hairline just gets higher and more wrinkles . For the future of the country and world's children its worth losing my life and every worldly possession to see Q win and Presidnt Trump win.

Anonymous ID: fcfa75 July 23, 2018, 2:35 a.m. No.2250195   πŸ—„οΈ.is πŸ”—kun   >>0202 >>0233

>>2250186

>>2250189

 

Y'all both giving a good show, you stupid fucking (((shills))).

 

>we speak for POTUS

>all of my c_a paid shills

 

For Christ's sake, these fuckers are not getting that no one cares what (((they))) have to say anymore.

 

>did not IP hop and DEFINITELY not using multiple devices, goy

 

Pic related.

 

CARRY ON, LADS. FUCK these (((shills))) and msm 4am points today

Anonymous ID: 9293f2 July 23, 2018, 2:36 a.m. No.2250196   πŸ—„οΈ.is πŸ”—kun   >>0219

why did george lucas give up directing starwars if he was hanging out for the tech to catch up to do it justice, ( coincidently it's also when it seemed to change direction drastically)

Anonymous ID: fa085a July 23, 2018, 2:36 a.m. No.2250198   πŸ—„οΈ.is πŸ”—kun   >>0214 >>0230

>>2250182

You should rewatch the show. You will find lots more than a little redpill material.

 

They do a currency reset. They do a kill everyone show who resist the President(showing Saudi and other foreigners). They mock everything.

 

See who supports this attack on Dan. And remember who they are. They will belong to (((them))).

 

They have no rainy days left. No reason to maintain their cover. The Jew is calling all their agents to the battle. Watch who you thought was on ourside seemingly go sideways and attack Trump. Watch who attacks Dan now. And you will learn how the game is played.

Anonymous ID: ff3feb July 23, 2018, 2:36 a.m. No.2250199   πŸ—„οΈ.is πŸ”—kun   >>0217 >>0226

Q and anons:

 

Throwing this out there.

I get a strong sense of, β€œHere we go.”

I see a lot of people in a huge meeting room.

I see everyone doing shoulder shrugs, as if to say, β€œWe’re ready, is there anything else left to prep?

The meeting wraps up and as everyone rises and mills about the room, I see everyone looking around at each other as the answer comes back without words, β€œYes, we’re ready.”

Some slight concern of β€œover” preparation, with some thinking, β€œAre we too cautious?”

I see everyone knows, β€œIt’s time.”

No more talking.

No more planning.

Knowing the time has finally come, I see EVERYONE holding their excitement back.

Everyone is more than ready, almost too ready.

I see them extremely resolute, with a spiritual and Godly dose of self-righteous indignation.

I see them with an easy calm and a confidence in their given roles.

I know that they all know, they are on a very, very special team.

A once in a lifetime gathering of people all pulled together to do something special.

The feeling that each of them has of being a part of this team, is very powerful.

Everyone knows what’s at stake.

If God is for us, who can be against us?

 

Romans 8:31-39

31 After saying this, what can we add? If God is for us, who can be against us?

32 Since he did not spare his own Son, but gave him up for the sake of all of us, then can we not expect that with him he will freely give us all his gifts?

33 Who can bring any accusation against those that God has chosen? When God grants saving justice

34 who can condemn? Are we not sure that it is Christ Jesus, who died – yes and more, who was raised from the dead and is at God's right hand – and who is adding his plea for us?

35 Can anything cut us off from the love of Christ – can hardships or distress, or persecution, or lack of food and clothing, or threats or violence;

36 as scripture says: For your sake we are being massacred all day long, treated as sheep to be slaughtered?

37 No; we come through all these things triumphantly victorious, by the power of him who loved us.

38 For I am certain of this: neither death nor life, nor angels, nor principalities, nothing already in existence and nothing still to come, nor any power,

39 nor the heights nor the depths, nor any created thing whatever, will be able to come between us and the love of God, known to us in Christ Jesus our Lord.

 

This they know and know with all their hearts.

Nobody wants to let anyone down.

The sense of pride for this mission is overwhelming.

It’s the glue that binds.

They feel lucky to be a part.

They all know what’s coming next.

There is nothing else left to do.

They knew this very moment would come.

That time has now arrived.

Get ready anons, we will all be called upon.

The calm before the storm.

 

(Will report in next breads, it's important.)

Anonymous ID: 77e319 July 23, 2018, 2:39 a.m. No.2250205   πŸ—„οΈ.is πŸ”—kun

The jew pedos are being exposed as we speak, and all the jew enablers can tell us is how "Chosen" the jews are.

Jesus didn't think so.

The only "god" that would support the jews is the devil.

I think Jesus said so in the book of John.

Anonymous ID: 021485 July 23, 2018, 2:40 a.m. No.2250209   πŸ—„οΈ.is πŸ”—kun   >>0262

Therefore this is what the LORD, the God of Israel, says to the shepherds who tend my people: "Because you have scattered my flock and driven them away and have not bestowed care on them, I will bestow punishment on you for the evil you have done," declares the LORD.

Jeremiah 23:2

Anonymous ID: 1556b1 July 23, 2018, 2:41 a.m. No.2250211   πŸ—„οΈ.is πŸ”—kun   >>0221 >>0229

>>2250149

>>2250125

sorry to hear about your cousin.

 

The waiting is like Christmas, you know it's coming, and can't wait to find out what the presents are, kek

 

Q said the attacks( from MSM ) would get worse.

 

ENJOY THE SHOW

 

This is the greatest events in history, which i could never miss.

 

GOD BLESS ALL OF YOU ANONS, STAY STRONG, DO NOT LOSE HEART.

 

JUSTICE IS COMING.

 

CHRISTMAS WILL BE HERE BEFORE YOU KNOW IT.

 

I WANT MY GITMO PERP WALK VIDEOS, KEK

 

I also want to be director of entertainment at GITMO.

THAT WOULD BE TOP KEK

I would play messages from the people, telling them what they really think of them, among other things( like repeating annoying music/videos)

Anonymous ID: 41963e July 23, 2018, 2:41 a.m. No.2250213   πŸ—„οΈ.is πŸ”—kun

>>2250026

>>2250055

 

You fucking newfags and your demands..

 

>1. why the newer breads are gone

Did you check the archive? https://8ch.net/qresearch/archive/index.html

>2. why the formatting of breads suddenly changed to not even show the archived Q-breads

There are many archives: one on 8ch (which might or might not be complete).

Dropboxes/megauploads etc online

Anonymous ID: 879980 July 23, 2018, 2:41 a.m. No.2250216   πŸ—„οΈ.is πŸ”—kun

Not going to bring it up again as I don't want to spam but you anons really should look at that post and especially so if your city/area has recently been dealing with water issues. Anons on 8chan may have stumbled on to something pretty fucking immense… like next level monumental if more areas confirm as true.

Anonymous ID: fa085a July 23, 2018, 2:41 a.m. No.2250218   πŸ—„οΈ.is πŸ”—kun   >>0222

>>2250186

Wrong. Potus job is to keep us united, Q's job is to keep us united. OUR job is to tell the truth.

 

Truth is America has been propagandized by the total Jewish domination of any mass media for 150 years. A part of waking up is realizing this fact. Our job is to break the people who brave this site to learn all the truth and to harden their skins against the attacks of "nazi, muh holocaust,"

 

This site is not for the normies. This site is for the leaders. For the taste makers. For the intellectual vangard of a new Aeon. That is our job.

 

Your job is to shill for the Jews till the shekels run out. Listen for the knock.

Anonymous ID: 77e319 July 23, 2018, 2:42 a.m. No.2250220   πŸ—„οΈ.is πŸ”—kun

Look how utterly insane the kikes really are.

They think that the stupid goy will believe that everything that the fucking kikes so is being done by "Nazi's."

My God. These people are insane and need to be locked away.

Anonymous ID: 6ccc04 July 23, 2018, 2:44 a.m. No.2250225   πŸ—„οΈ.is πŸ”—kun

>>2249671

You know, I've never watched it. Firing up Netflix now. Back in a few weeks (assuming it doesn't get taken off, but hey it's Netflix)

 

KEK+, in just the first minute. Wow. Yeah ok, back in a few weeks.

Anonymous ID: 1a7199 July 23, 2018, 2:44 a.m. No.2250227   πŸ—„οΈ.is πŸ”—kun

>>2250207

I will keep keep baking , praying and making memes/blasting them out. Saving offline and getting ready . Doing what Q says. Anon's are keeping my spirits up and I love to laugh at the memes . It's dealing with my family that is most challenging. Child like minds from TV and MSM brainwashing. I am used to being alone. Q will win Trump will keep winning and life will get better that is my AA. I read ACIM alot too that helps.

Anonymous ID: 77e319 July 23, 2018, 2:44 a.m. No.2250228   πŸ—„οΈ.is πŸ”—kun   >>0238 >>0251

←- This comes out of the jew "holy" book.

It is fucking disgusting.

What normal person thinks fucking kids is ok?

Normal people do not.

The jews need to be kept as far away from normal people as possible.

Anonymous ID: d79e48 July 23, 2018, 2:46 a.m. No.2250230   πŸ—„οΈ.is πŸ”—kun

>>2250198

 

I’m seeing it happen, fuckin Marco was exhibit A. All of the fake personas will start falling away now.

 

I hear you anon. I only watched a few episodes, there’s plenty ignorance on this side. If he’s based he’s based and will be hero anon. I hope so we need allies in culture!

Anonymous ID: 41963e July 23, 2018, 2:47 a.m. No.2250234   πŸ—„οΈ.is πŸ”—kun   >>0245 >>0458

>>2250080

This is very interesting..

Water is going to be the crucial conversation in human survival for the coming decades.

I must also add that The Netherlands is dealing with a very heavy dry streak (worse in about 40 years).

Didn't Liddle Lynn de Rothschild treathened with droughts?

Anonymous ID: fcfa75 July 23, 2018, 2:48 a.m. No.2250235   πŸ—„οΈ.is πŸ”—kun   >>0241 >>0252

>>2250222

>>2250223

What the world is going to do to these fucking idiots…

The jewish and middle east uppity criminal mind set runs DEEP.

We get rid of deep state, cabal, networks, and these fuckers will STILL be mired in this criminal mindset.

Which is WHY (((they))) will end, one way or another.

No more samson option. No more nukes in the middle east.

Only two additional rogue nuclear states remaining (israel and pak).

 

CHANGE YOUR SCRIPT, you fucking inbred (((retard shills)))

Anonymous ID: e54c24 July 23, 2018, 2:49 a.m. No.2250238   πŸ—„οΈ.is πŸ”—kun   >>0250

>>2250228

 

The jewish holy book that is a 2000 year old oral tradition and bible interpretation. It doesn t enable anything you idiot. It has some stuff that will look barbaric to us just like some aections of the bible and like the quran. its an ancient text that the average jew cant even cite one sentence from it. Some very religious sheep do follow it literaly but they are sheep.

 

Fuck off division shill

Anonymous ID: 021485 July 23, 2018, 2:49 a.m. No.2250239   πŸ—„οΈ.is πŸ”—kun

"In his days Judah will be saved and Israel will live in safety. This is the name by which he will be called: The LORD Our Righteous Savior."

Jeremiah 23:6

 

Thus saith the Lord.

 

You Shills can just go hang yourselves now.

Anonymous ID: fcfa75 July 23, 2018, 2:50 a.m. No.2250242   πŸ—„οΈ.is πŸ”—kun   >>0253

>>2250233

 

Damn anon, I will say some newfags could hear it, and also (((they))) tend to extend their reach if nothing is done.

One slap down, will last for a day.

 

Also, no-"infighting" and "divisionfagging" where hostiles and shills are concerned…careful they try to spread that kind of lie everywhere while deflecting.

 

pilpul 101. also tries to work your fatigue.

We see it.

Anonymous ID: 55c4f1 July 23, 2018, 2:50 a.m. No.2250243   πŸ—„οΈ.is πŸ”—kun

>>2250206

Agree

 

All the Skinheads are going to be real disappointed

 

Cleansing Crew Lask List

Saudi Arabia - done

NKorea - done

Russia - Certificate renewed

China - 1 st notification sent

Iran - In process

FBI - In process

CIA - In process

DoJ - in process

Congress - pending (Nov)

Isreal - pending

EU - pending

Rome - tbd

US - in process (pending trials)

Anonymous ID: ff3feb July 23, 2018, 2:52 a.m. No.2250248   πŸ—„οΈ.is πŸ”—kun

>>2250226

Not a remote viewer anon.

Not being short with you, but I would rather leave this question alone for now?

Please?

As for a report in next bread, I should have been more clear.

I'll just copy and paste this in the next couple of breads for others to see.

Do me a favor please? Can you copy and file this?

Thanks.

Please pray for President Trump for his health and safety, that's big.

As well as Q and all the others involved in this battle of good over evil.

God bless us all.

WWG1WGA

Anonymous ID: 021485 July 23, 2018, 2:53 a.m. No.2250252   πŸ—„οΈ.is πŸ”—kun   >>0278 >>0299

>>2250235

There are bad actors in Mossad. So you condemn all of Judah.

There are bad actors in the CIA, FBI, NSA. Do you condemn all Americans?

 

The Talmudic Jews are a tiny satin worshiping cult, so you condemn all of Judah.

The Mormons are a tiny satin worshiping cult. do you condemn all Americans?

Anonymous ID: 09138b July 23, 2018, 2:54 a.m. No.2250253   πŸ—„οΈ.is πŸ”—kun   >>0261

>>2250242

you know very well what happens when jews and kikes are brought up. It is an endless slide. No one is going to change a newfags mind about their stance on the subject. Continuing to fight about it serves no purpose but to shit up the bread. You know this. Be the strong one and don't engage.

Anonymous ID: 41963e July 23, 2018, 2:55 a.m. No.2250254   πŸ—„οΈ.is πŸ”—kun   >>0260 >>0267

>>2250245

Your posts just activated my almonds:

 

We need Air -that is being poisoned

We need Water -They want to control that, as the thread shows. They are poisoning the sea as well (Fukushima? Oil spills?)

We need Food -GMO Monsanto/Bayer/IG Farben are balls deep in that. Next to that: there are only a few, huge companies that dictate this process worldwide.

 

And to top it all off, the fire of critical thought is being subdued by this manufactered hoax called global warming.

Fuck these people. Global Tribunals when?

Anonymous ID: 2e9175 July 23, 2018, 2:56 a.m. No.2250257   πŸ—„οΈ.is πŸ”—kun   >>0324

Basket of deNotables

#2836

>>2249797 Got us another one "screaming loudest," NY Rep. Jerrold Nadler

>>2249782 Prominent S Korea politician found dead in possible suicide

>>2249754, >>2249762, >>2249850, (>>2249386 lb) AP Cov'g of Iran Tweet

>>2249741, >>2249818 Mission Impossible 7/27 Release, 'dasting Soundtrack

 

>>2250031

>>2250082

>>2250107

Thanks BO, glad you're here.

Lemme know if I can help.

 

>>2249959

TY anon

Anonymous ID: fcfa75 July 23, 2018, 2:56 a.m. No.2250261   πŸ—„οΈ.is πŸ”—kun

>>2250253

Yeah why not. Not like we actually get anon or autist replies when JIDF gets shut down. Pretty much zero sympathy for kikes in truth seeking parts.

 

I suppose today's msm efforts will be repeating the faggotry they do here today:

>"trump is causing division"

>"they are all nazis"

 

At least we got to know something ;)

Anonymous ID: bf7538 July 23, 2018, 2:57 a.m. No.2250263   πŸ—„οΈ.is πŸ”—kun   >>0307

Steven Greer had his Disclosure Project shill meat hooks all up in this. Wonder what he will say now

 

Controversy over Atacama 'alien' deepens: Follow-up to study on 6-inch Chilean mummy uncovers faulty methods and ethical concerns, finding it was a NORMAL human fetus and 'reflects a sad loss for a mother'

Study published earlier this year concluded tiny mummy β€˜Ata’ was a human girl

It claimed she suffered genetic abnormalities, including β€˜accelerated bone age’

New research has called into question both the science and ethics of the study

Researchers say analysis was unjustified, and skeleton is a typical 15-week fetus

They also say it was likely a miscarriage, possibly from a recent incident in Chile

 

https://www.dailymail.co.uk/sciencetech/article-5975679/Atacama-alien-controversy-deepens-new-study-points-ethical-concerns-faulty-science.html?ito=social-twitter_mailonline

Anonymous ID: ece830 July 23, 2018, 2:58 a.m. No.2250265   πŸ—„οΈ.is πŸ”—kun

I don't know if mentioned, but I was posting the DoD's tweet about staying calm and taking a breath and watching the ocean video (water)…when I saw the prior tweet about the AF airman having his body mass measured in some type of ALIEN-movie type of pod that looks like it just came straight of the spaceship Nostromo. Then I remembered that the DOD said:

 

I think I saw this on the #Jetsons once …

 

Then I remembered Trump's tweet out to Rouhani that sounds like we are preparing to go to war with Iran.

 

Then it clicked!

DoD was already preparing us to start thinking about SPACE FORCE!

Anonymous ID: 879980 July 23, 2018, 2:58 a.m. No.2250267   πŸ—„οΈ.is πŸ”—kun   >>0276 >>0303 >>0323

>>2250254

I seriously think you and I may be the only people legitimately looking into Q research right now on this thread given the gravity of this and the fact it's just us seriously looking into it even with the "watch the water" statement awhile back we never figured out.

 

But you're right, you're absolutely right in what you wrote. Air, food and water and fruits and vegetables have seen a huge uptick in being recalled due to chemicals and feces the past few months in the US.

Anonymous ID: fa085a July 23, 2018, 2:59 a.m. No.2250272   πŸ—„οΈ.is πŸ”—kun   >>0287 >>0297

>>2250222

Your not a very good anon. You seem to think Q tells the truth in everything. You forget one of the first post Q made. Disinformation is necessary.

 

Israel is last. All disinformation is to avoid Jew panic and to confuse normies of the true endgame. MI worked this out. How to free yourself from a parasite that has magickally fooled most of your own people into thinking they are victims and innocent?

 

How indeed?

 

How my anon?

 

 

What has happened the last nine months?

This is how. This. Q. Me…..you…..everything. Is how.

Anonymous ID: 7982b5 July 23, 2018, 3:03 a.m. No.2250281   πŸ—„οΈ.is πŸ”—kun   >>0289

I actually disagree with the top anon post here. Renegade and others should ONLY be going to 8ch, and not 4chan, since 4chan is compromised, and 8ch is most likely under control of the US Gov’t at this point.

Anonymous ID: 5be10e July 23, 2018, 3:06 a.m. No.2250289   πŸ—„οΈ.is πŸ”—kun

>>2250281

Still most people visit half chan. If you want your message to reach most people as fast as possible you would post it there.

We got it here anyways.

And if renegade's story is to be believed he doesn't care about his life anymore, so he doesn't care about the danger.

Anonymous ID: 55c4f1 July 23, 2018, 3:07 a.m. No.2250297   πŸ—„οΈ.is πŸ”—kun

>>2250272

Delusional

 

Are you not aware the Trump' daughter, son-in- law and grandchildren are Jewish?

 

You might be happier with Hamas & Hezbollah

 

The are always looking for more suicide bombers.

 

No need a letter of reference?

Anonymous ID: fa085a July 23, 2018, 3:07 a.m. No.2250299   πŸ—„οΈ.is πŸ”—kun   >>0305

>>2250252

Do they use only Americans to run the worlds banks? No Jews.

Do they use Eskimos to run all the worlds media? No Jews.

Do they use Japanese to run all the worlds films? NO again that is a role set aside for Jews.

 

See what is happening here?

 

It is debatable who is at the top of the pyramid of the NWO. But what is not debatable is the Jews are the number one weapon in bringing in this horror show. Only Jews are trusted this much to genocide and rob the nations of the earth this much.

Anonymous ID: 41963e July 23, 2018, 3:09 a.m. No.2250303   πŸ—„οΈ.is πŸ”—kun

>>2250267

 

>>2250276

You are partially right: in the scenario of NK, that one proved to be most fitting.

However, we are dealing with MI here: if they ask if you want a croissant with your cafe lattΓ©, they might be asking you if you believe if the Crescent Moon will light the waters of the the center Milky Way or something

 

The "Watch The Water" has many, multiple layers of meanings. I honestly believe that dominating the water supply is one of the big issues associated with it.

[m4xr3sdEfault]*******,=,e οΌΌοΌΏγƒΎ(α–β—ž ) ID: bd0338 July 23, 2018, 3:13 a.m. No.2250319   πŸ—„οΈ.is πŸ”—kun

Sacrificial superficial asshole demiurge ASSange(L) whom is totally homo for Elons glittery vampire salad tossing tribe with tredeau , and butt paste

Anonymous ID: 77e319 July 23, 2018, 3:14 a.m. No.2250321   πŸ—„οΈ.is πŸ”—kun   >>0345

>>2250318

You are taking one side of history, and making it into the whole picture.

You are being intellectually dishonest, but then, you kikes can't tell the truth no matter what.

Did Catholics start the Bank of England?

How about the FED RES?

Nice try.

Anonymous ID: fa085a July 23, 2018, 3:14 a.m. No.2250323   πŸ—„οΈ.is πŸ”—kun

>>2250267

If Jews cant own the world they want to destroy it and poison us all. They would try to nuke us but the Aliens are tired of their shit and turned all the nukes off. This is the great secret Iran threatened to tell the world. The fucking nukes dont work and we cant nuke each other. The Jew Samson option is off the table. The Jews are cornered……they have to make a deal. To become a multicultural country or Russia will just over run it.

 

Soon they will be bred out of existence by the Palestinans. Fucking Karma. Karma is a real bitch.

Anonymous ID: fd00d0 July 23, 2018, 3:14 a.m. No.2250324   πŸ—„οΈ.is πŸ”—kun   >>0341

Examples of:

 

(1) Properly ARCHIVED Q-BREAD from 3/28/18

https://8ch.net/qresearch/res/821673.html#822219

 

(2) 404 Q-BREAD from 7/4/18

https://8ch.net/qresearch/res/2029070.html#2029255

 

Several Q-BREADS generating 404 errors (2), rather than properly archived (1).

 

Pic related, showing evolution of BREAD formatting, removing previous Q-BREAD lists.

 

>>2250257

Anonymous ID: 55c4f1 July 23, 2018, 3:16 a.m. No.2250328   πŸ—„οΈ.is πŸ”—kun   >>0342

>>2250294

I thought the all moved to from /pol/ to /skinheads/

 

We like top keep them in their own containment area.

 

Makes is easier for to merge with post there and to /nationofislam/

 

Did you get those quotes from the great warrior Shaka Zulu

 

I hear they are trying to make a comeback.

 

You any good at killing Boer farmers?

 

They always looking for recruits

Anonymous ID: fcfa75 July 23, 2018, 3:17 a.m. No.2250332   πŸ—„οΈ.is πŸ”—kun

>>2250325

Maybe POTUS and fitton worked out a message for us?

 

Also, judging by the speed with which the niggastronk spams are occuring, it's likely a bot/script by these kikes. At least it used to be less automated but they lifted this copy pasta shit from half chan

[m4xr3sdEfault]*******,=,e οΌΌοΌΏγƒΎ(α–β—ž ) ID: bd0338 July 23, 2018, 3:18 a.m. No.2250337   πŸ—„οΈ.is πŸ”—kun   >>0348

SUpport crack heads tax fraud for glittery famewhore salad tossing vampires in electric cars with autopilot and trannyshillin pedoraptor

Anonymous ID: 2e9175 July 23, 2018, 3:19 a.m. No.2250343   πŸ—„οΈ.is πŸ”—kun   >>0350

>>2250304

….aaaaaand cue black man best man pron

kek.

Guess it's time to load my Blink 1488 playlist and get this party started

 

>Godspeed

Thanks man, appreciated.

Couldn't do it w/o you guys.

Godspeed back atcha

 

>>2250308

So flak, such over target!

 

Why tho? What diggs tonight?

Not intel, PERSONNEL.

You. The autists.

Night-to-day

Anonymous ID: fa085a July 23, 2018, 3:22 a.m. No.2250351   πŸ—„οΈ.is πŸ”—kun

>>2250294

The smell of panic this gives off is powerful. We know how scared you are. You were kings of the world. No one was going to catch you. You had all the media and all the politicians.

 

And now all you have is race baiting and gore porn.

 

Expect the knock.

Anonymous ID: 77e319 July 23, 2018, 3:23 a.m. No.2250353   πŸ—„οΈ.is πŸ”—kun   >>0369

>>2250345

For those that don't understand the "Catholics" made jews into bankers" lie. It goes like this.

The fucking jews have always been in banking.

The fucking kikes always charged interest also known as Usury,

The Catholics, being greedy cunts in their own right, made an exception, and allowed their money to be run by jew banking.

So the lie that Catholics made the "jews do it" is just a fucking lie.

Don't be taken in my the lies of the jew.

it is all they know how to do.

Anonymous ID: 5be10e July 23, 2018, 3:25 a.m. No.2250367   πŸ—„οΈ.is πŸ”—kun   >>0374

Did you guys see that or is it just me?

I called out nigger-shills tactics.

He then wen't on to randomly target a few more posts, just to invalidate my point and now he's gone.

Kek

 

They are really retarded

Anonymous ID: 021485 July 23, 2018, 3:26 a.m. No.2250369   πŸ—„οΈ.is πŸ”—kun   >>0378

>>2250353

The Idol worshipers could not charge interest, so there was no reason for them to lend. Except out of the "Goodness of their hearts". and since they had no hearts there was actually no reason to lend.

 

Do all the mental SJW mental gymnastics you want, You are living in fantasy land.

Anonymous ID: 1a7199 July 23, 2018, 3:28 a.m. No.2250372   πŸ—„οΈ.is πŸ”—kun

>>2250366

Meber they said they have your passwords to your VPN. Q has it all . an't wait till [you] are gone. Last you for you E-Butt , I won't say your real name here. Time to go to sleep faggot. Give it a rest .

Anonymous ID: bd7714 July 23, 2018, 3:28 a.m. No.2250373   πŸ—„οΈ.is πŸ”—kun

Almost fill, every honest anon understands that antiseptic discussion at this point is premature. Israel is saved for last. As events unravel with regard to Iran we will see which direction POTUS and admin will go. If you trust the plan, you know they will do it right. Just need to be patient. Hours spent on discussing jew issue are a waist of time at this point, as we lack insight.

Anonymous ID: fcfa75 July 23, 2018, 3:29 a.m. No.2250376   πŸ—„οΈ.is πŸ”—kun   >>0424

>>2250360

>>2250364

I also like how (((shills))) are now reduced to talking shit about white people on Q research board of all places.

Funny how this coordinates with known jidf/black hat shills on the bread, yeah?

 

PIC FUCKING RELATED.

 

D5 incoming, anons.

Clapper: Obama Was Behind The Whole Thing

 

https://www.zerohedge.com/news/2018-07-22/clapper-obama-was-behind-whole-thing

 

"Former Director of National Intelligence (DNI) James Clapper admitted in a CNN interview Saturday that former President Obama instigated the ongoing investigations into Donald Trump and those in his orbit.

 

Speaking with CNN's Anderson Cooper, Clapper let slip:

 

If it weren’t for President Obama we might not have done the intelligence community assessment that we did that set up a whole sequence of events which are still unfolding today including Special Counsel Mueller’s investigation. President Obama is responsible for that. It was he who tasked us to do that intelligence community assessment in the first place.

 

James Clapper admits to Anderson Cooper that Obama set off the sequence of events that led to the Mueller investigation by tasking the intelligence community assessment pic.twitter.com/v79PNuTxBe

β€” ᏒᏒαŽ₯sᏟαŽ₯ᏞᏞαŽͺ’s ᏉαŽ₯ᎬᎳ ℒ️ (@PriscillasView) July 19, 2018

 

Recall in May, Senate Judiciary Committee Chairman Chuck Grassley (R-IA) fired off a letter to the Department of Justice demanding unredacted versions of text messages between FBI agent Peter Strzok and former bureau attorney Lisa Page, including one exchange which took place after Strzok had returned from London as part of the recently launched "Operation Crossfire Hurricane" referring to the White House "running" an unknown investigation."

Anonymous ID: 55c4f1 July 23, 2018, 3:29 a.m. No.2250377   πŸ—„οΈ.is πŸ”—kun

>>2250327

 

You get an F for FAIL (plagiarism). Had to steal from the Turkman?

(Sadface)

(BTW - Your site malware isn't functioning any more) - FAIL)

 

The TÜRK man is the epitome of male dominance and masculinity …

https://veekyforums.com/…/the-trk-man-is-the-epitome-of-male-dominance-and.html

Aug 19, 2017 - 32 posts - β€Ž29 authors

His body is large. His domineering size makes his presence known without him even needing to point himself out.

 

KARA BOĞA | Know Your Meme

https://knowyourmeme.com/memes/kara-boga

His body is large. His domineering size makes his presence known without him even needing to point himself out. He is muscular, as a result of his high levels of

 

First /int/ post mentioning KARA BOĞA, From an Anonymous Turkish poster.

KARA BOĞA is originated from Turkish shitposters on 4chan's /pol/. Around June-July 2017, Turkish shitposters created several anti-white, pro-black or pro-muslim threads on /pol/. These threads received an extravagant amount of butthurt from the white and American users of /pol/. That these threads usually gets +400 posts unless the moderato(s) delete it. On these threads Turkish posters usually preach the Black supremacy and call muscular Black men as Black Bulls ( Bull = cuckold term for the person who fucks the cuckold's wife/gf). These events was eventually led to the birth of KARA BOĞA.

Anonymous ID: 1556b1 July 23, 2018, 3:31 a.m. No.2250382   πŸ—„οΈ.is πŸ”—kun   >>0392

Donald J. Trump

‏

Verified account

 

@realDonaldTrump

50s51 seconds ago

More

So we now find out that it was indeed the unverified and Fake Dirty Dossier, that was paid for by Crooked Hillary Clinton and the DNC, that was knowingly & falsely submitted to FISA and which was responsible for starting the totally conflicted and discredited Mueller Witch Hunt!

Anonymous ID: e8e53f July 23, 2018, 3:31 a.m. No.2250384   πŸ—„οΈ.is πŸ”—kun   >>0389

Regarding the threads falling off

It looks serious and extremely unusual.

 

  • All Q posts in qanon.pub, qanon.map and qanon.news link back to our archived breads at the /qresearch/ 8ch archive at

https://8ch.net/qresearch/archive/index.html

 

  • As you'll see there, threads from July 1 onwards have not yet been archived yet and we don't know how many are missing from the catalog.

 

  • If they're missing, are they 'unarchivable' now to our central archive?

 

  • Numbers: Generals #2463 - #2836 have yet to be archived = 373 general threads have yet to be archived and some are missing.

 

  • Checking at qanon.pub and Q's last post links to the (what should be) archived page, which is not found. Pics related. Link: https://8ch.net/qresearch/res/2029070.html#2029255

 

  • I asked BO about the archives yesterday and he said he thought they were archived at the end of each month.

 

  • This would normally be fine, as threads stay in the catalog at least a month, however this time with threads going missing it seems we could be in a 'pickle'.

 

  • I'm unsure if the archives are done automatically or by hand, either way, I believe this should be looked into, as it seems we've already lost breads.

 

  • Archives should possibly be done by hand at the moment, on all breads still in the catalog, until it's found out what's happened. That way we can be safe rather than sorry.

Anonymous ID: fe9082 July 23, 2018, 3:34 a.m. No.2250395   πŸ—„οΈ.is πŸ”—kun   >>0397 >>0404

Baker

This is TZ… I found more faults in the bread…

 

From >>2249666

IntegrityΓ’β‚¬β€œfor in Truth lies Victory. Replace strange stuff in middle with dash.

 

HIGHLIGHTED Q POST

 

 

Q !UW.yye1fxo ID: 27d57d No.594016 Γ°ΕΈβ€œΒ

 

Mar 8 2018 19:55:52 (EST)

Anonymous ID: 576924 No.593959 Γ°ΕΈβ€œΒ

Mar 8 2018 19:53:28 (EST)

nov14.png Ò¬‑

 

Note the strange characters at the end of the lines

 

>>2249677

Between 40 and 70 should be a dash

 

CURRENT EXPOSURE #QAnon: 40 Γ’β‚¬β€œ 70 MILLION EXPOSURES/DAY!

 

I have found strange stuff like this before. Some baker has something funky with his computer that corrupts dashes and other characters (as shown above)

Anonymous ID: 5771be July 23, 2018, 3:36 a.m. No.2250405   πŸ—„οΈ.is πŸ”—kun

We are aware of the issue with an accelerated pattern of some breads being 404'ed from /qresearch/.

 

a whole catalog full of breads and all the ones with the Q posts have fallen off…

 

I told BO this was happening right after CM fixed the catalog… but nobody listens.

Anonymous ID: af56b5 July 23, 2018, 3:37 a.m. No.2250407   πŸ—„οΈ.is πŸ”—kun

>>2250386

Before Fitton came on F&F. Todd Piro [host] made comments about RR

He was asking if RR just rubber stamped the FISA warrants and renewed them after they expired

He was making comments that we [American public] needed to know if he was following orders from above or more like a worker bee just signing whatever came across his desk

Anonymous ID: 0e4f36 Dropping Like Flies. July 23, 2018, 3:43 a.m. No.2250433   πŸ—„οΈ.is πŸ”—kun

Large Cap CEO’s dropping swatted Flies.

 

https://www.cnbc.com/2018/07/22/how-fiat-chrysler-told-employees-sergio-marchionne-was-being-replaced.html

 

Coincidence?

Anonymous ID: fcfa75 July 23, 2018, 3:43 a.m. No.2250435   πŸ—„οΈ.is πŸ”—kun

>>2250424

Now they are throwing fake nigga hussein under the bus.

This is getting serious enough to make this happen.

Possible bait by black hats to make white hats move early?

 

>>2250426

BO or BV, can we stop making these (((shills))) remind me MUH big black dick fucks jewish women and they like it?

 

shadilay, anons

Anonymous ID: 28ba4d July 23, 2018, 3:45 a.m. No.2250443   πŸ—„οΈ.is πŸ”—kun

>>2250439

>His behaviour strikes fear into the more timid, cowardly races of man(Κ·Κ°*ᡀᡉ dogs)

Kek that's why white men had to free nigger slaves from kike slaveholders.

Anonymous ID: fcfa75 July 23, 2018, 3:49 a.m. No.2250454   πŸ—„οΈ.is πŸ”—kun   >>0464

>>2250449

>imagine being this stupid and responding to a known jidf

 

lurk moar nigga.

 

>>2250451

Perhaps rouhani is out of the loop, or being set up?

 

This will go very badly for rouhani one way or another.

 

We know white hats and POTUS have upper hand on iran.

Anonymous ID: 2e9175 July 23, 2018, 3:50 a.m. No.2250459   πŸ—„οΈ.is πŸ”—kun

#2836

>>2250386 @DJT comes out swinging: "So now we know" Dirty Dossier Fake

>>2250185 Another one bites the dust: Sportsman Harley James jailed for CP

>>2249988, >>2250063, >>2250104 Barrick Gold/Clinton/Shoshone/Burns Strider

>>2249797 Got us another one "screaming loudest," NY Rep. Jerrold Nadler

>>2249782 Prominent S Korea politician found dead in possible suicide

>>2249754, >>2249762, >>2249850, ( >>2249386 lb) AP Cov'g of Iran Tweet

>>2249741, >>2249818 Mission Impossible 7/27 Release, 'dasting Soundtrack

Anonymous ID: fcfa75 July 23, 2018, 3:53 a.m. No.2250463   πŸ—„οΈ.is πŸ”—kun

>>2250458

We are aware of the cabal tech including their study of tesla which should have given them the starting point to the science of "telegeodynamics"

 

While average people are made to wish on a fucking bone to dig for wells and hit water, it's a sure bet cabal already has most of the world's underground water aquifer mapped out.

Anonymous ID: 35d493 July 23, 2018, 3:58 a.m. No.2250470   πŸ—„οΈ.is πŸ”—kun

Full court press. [They] are giving us all they have right now anons.

 

It doesn't matter, [shills]. Even if this place is overrun, we've broken 10% visibility in the world.

 

It's too late to stop it.

Anonymous ID: fa085a July 23, 2018, 3:58 a.m. No.2250472   πŸ—„οΈ.is πŸ”—kun   >>0492 >>0493

>>2250419

Have you noticed? No topic brings this much resistance. None. And they are only 1-2% of the population yet about 75% of the shills are Jew apologist. The numbers dont make sense if your a normie and can do math. Just look at the zeal of the Zionist. They know the danger to them. They know they have little real power that is not media based. If they lose the propaganda war they know what is coming next.

 

They played the game of thrones as a win all or a lose all proposition. They are in the process of losing all.

 

They are going through the five stages of grief.

The five stages, denial, anger, bargaining, depression and acceptance are a part of the framework that makes up their learning to live with the world they lost.

 

They are still in the denial and anger part. Soon the bargaining and depression will set in.

 

The Kvetching will start up. Nothing is louder than a Jewish wail over lost shekels.

 

Then acceptance. That is when they will run for their bunkers, cash out their assets, take for the hills.

 

But the world is smaller today and there is no where to hide. Bunkers flood and a vulnerable to shit being dropped on them.

Anonymous ID: 517d18 July 23, 2018, 4:02 a.m. No.2250483   πŸ—„οΈ.is πŸ”—kun

>>2250461

Is that all you have butt plug? Take your stupid gore porn back to the shit hole half chan or reddit from which you crawled. Climb back up in your mamma's asshole you were spawned from.

Anonymous ID: a7b0c4 July 23, 2018, 4:02 a.m. No.2250485   πŸ—„οΈ.is πŸ”—kun

>>2250422

OK

 

guys can you check this your end?

 

fox and friends today

 

5:5

 

timeline shows 5:14

 

1+4 =5

5:5

 

my sound cuts off

 

crazy shit in the background including strange visuals?

 

could be nothing

Anonymous ID: fcfa75 July 23, 2018, 4:06 a.m. No.2250492   πŸ—„οΈ.is πŸ”—kun

>>2250472

>They played the game of thrones as a win all or a lose all proposition. They are in the process of losing all.

 

Couldn't have put it better myself.

 

>>2250490

at least 5

>ivanka heli attempt

>jr. wife and kids with powder

>AK missile

>UK dead USSS agent

>POTUS during 2016 rally (rushing the stage by deranged lib from UK)

Anonymous ID: 19ef50 July 23, 2018, 4:07 a.m. No.2250494   πŸ—„οΈ.is πŸ”—kun   >>0499 >>0500 >>0509

>>2250458

Interesting theory and evidence until it starts talking about redirecting underground aquifers.

 

You can put down a bunch of wells and drop the water table and dry up home owner's shallow wells, happens all the time.

 

When you start talking about redirecting underground aquifer's without a sauce, thats suspect at best.

 

Some of you need to really think about how the hell you're gonna redirect an underground aquifer.

Did Musk invent a waterproof tunneling machine?

Fucking slide ass clowns man.