Anonymous ID: e7da19 Q Research General #27271: 16 Days Left Edition Jan. 4, 2025, 10:05 p.m. No.22294661   🗄️.is 🔗kun   >>4749

Welcome to Q Research General

 

We are researchers who deal in open-source information, reasoned argument, and dank memes. We do battle in the sphere of ideas and ideas only. We neither need nor condone the use of force in our work here.

 

"We hold these truths to be self-evident: that all men are created equal; that they are endowed by their Creator with certain unalienable rights; that among these are life, liberty, and the pursuit of happiness.'

 

VINCIT OMNIA VERITAS | SEMPER FIDELIS | WWG1WGA | QRESEARCH

 

Q's Latest Posts

>>18284019 Nov. - Dec. 2022

 

Q's Private Board

>>>/projectdcomms/ & Q's Trip-code: Q!!Hs1Jq13jV6

 

Find Q drops here

Qresear.ch/q-posts, Qanon.pub, Qalerts.pub, OperationQ.pub. Qposts.online, 8kun.top/qresearch/, Qalerts.app, Qalerts.net, douknowq.com/134295/Q-Anon-Pub.htm8ku

 

Q Posts Archives

* Q Map & Mirrors PDF: SCRIBD: https://www.scribd.com/document/419874308/Q-Anon-The-Storm-X-VII?secret_password=55SQ1tCYhuNR8ESzm50u

* Q Posts Archive, Searchable, interactive with user-explanations: qanon.pub qanon.app

* Q Posts Archive + RSS, Searchable, Analytics, Offsite Bread Archive: qanon.news

* Q Raw Text Dumps: q-clock.com/q_raw.txt

* Q Original, full-size images Q has posted: https://postimg.cc/gallery/29wdmgyze/

* Q Research Memo & OIG Report Links: 8kun.top/qresearch/res/426641.html#427188

* Q Research Notables: Archive Board >>>/qnotables/

* Q Adjacent infographs and moar: https://deepstatemappingproject.com/

 

Q Research Board

Key Resources below. Check DOUGH RESOURCES thread for more: >>17225239

New to QR?

>>17240320 Welcome to Q Research | >>20424387 Board Info

Meme Warfare

MEME WARRIOR UI 1.3 #240904: https://archive.is/3Pe0E

Board History

>>17242392 Q Encyclopedia & >>17242386 Q Video by Archive Anon

TOR Access

TOR URL: http://w7m432cocr665kf5tlpcxojwldajr3njd2etcxwhpbrt44eemuxhp7ad.onion/qresearch/catalog.html

TOR Banner: https://www.youtube.com/watch?v=MLCupx1UEx

Anonymous ID: e7da19 Jan. 4, 2025, 10:05 p.m. No.22294663   🗄️.is 🔗kun   >>4749

International Q Research Threads

>>22225133 Australia #39

>>21503242 Brazil #1

>>22267360 Canada #69

>>21284558 France #8

>>21435975 Germany #107

>>21988292 Japan #26

>>16694250 Nederland #10

>>21452596 QAJF #2

>>22228099 Scotland #12

>>21699204 Singapore #1

>>20969267 South Africa #13

>>19804572 UK #51

 

GLOBALS

KNOW YOUR BUNKER = https://endchan.org/qrbunker/catalog.html

>>17322509, >>19089065 Baking Tools & Guidelines

>>20022853 Posting Guidelines for Anons

>>22053329 Administrator JW TripCode

 

IMPORTANT!Help support 8KUN

>>21438634, >>21189998, >>21462480, >>21190032, >>21543513 @thejimwatkins: Is it worth keeping 8kun online?? (Make bitcoin pmts via Proto)

>>18024378, >>18561054, >>21587855 PROTO Instructions & CONTACT info for Q's or problems

 

Please Support The Watkins Project #8KUN [DONATE LINK ABOVE]

Follow The Owner: Jim Watkins x.com/thejimwatkins/

Bookmark Watkins Report: https://watkinsreport.com/

Advertise Here: ads@isitwetyet.com

Donate Bitcoin: 1KiJD44WeWKaDb4Newr7bDXadtGn21ACqY

Proto Membership: https://shop.isitwetyet.com/p/Proto-membership/ (Coin Accepted)

Send Anonymous Money Orders: Is It Wet Yet, Inc at 2118 Wilshire Blvd #403 Santa Monica, CA. 90403

Buy Merchandise: (Coin Accepted)

  • https://shop.isitwetyet.com/ (proto levels / donations)

  • https://shoppers.isitwetyet.com/ (misc.)

  • https://www.p2pprinting.com/8kun (clothing)

  • https://goodstuffcoffee.com/8kuncoffee/ (covfefe)

ANONS: Stay positive, Eyes on the GOAL, not the OBSTACLES!

 

NOTABLES ARE NOT ENDORSEMENTS

 

#27270 >>22293896

>>22294472 @DanScavino - 16 DAYS⏳

>>22294502, >>22294507 Babylon Bee: Brit arrest for make meme offensive to child rapists

>>22294555 Why Washington Post cartoonist QUIT over this risky drawing that the paper rejected

>>22294573 Reform just six points off becoming biggest party, says election predictor. Electoral Calculus analysis shows Nigel Farage’s party could leapfrog both Conservatives and Labour if it continues to pick up support

>>22294609 Woman arrested in Airway Heights on suspicion of possessing multiple explosive devices

>>22294658 #27270

 

#27269 >>22292828

>>22292874 Dough claim

>>22292841 Col. John Mills: “This Is A Chinese Malign Influence That Could Topple South Korea.”

>>22292885 Texas high school football team takes to the field with American flags

>>22292895 Lionel Messi SNUBBED Joe Biden, and skipped the Presidential Medal of Freedom ceremony, where he was supposed to receive the award

>>22293089 Rep. Chip Roy: "We Need To Hold The Speaker Accountable And That Needs To Start Now"

>>22293279, >>22293284 Indie filmmaker Jeff Baena, Aubrey Plaza’s husband, found dead at Los Angeles home

>>22293708 Army CID offers $10,000 reward for stolen HMMWV doors that no one likes

>>22293730 ITALIAN PM MELONI ARRIVES AT MAR-A-LAGO FOR DINNER WITH TRUMP

>>22293779 @RepMTG - Jan 6th at 1:00 pm Congress must certify President Trump’s historic election. Washington has a winter storm warning for Jan 5-7th expecting possibly a foot of snow. Many members of congress left town this weekend even though they were told to stay. I’m here and will walk to the Capitol if I have to.

>>22293885 #27269

 

#27268 >>22291778

>>22291832, >>22291842 Morgan Ortagus appointed as Deputy Special Presidential Envoy for Middle East Peace

>>22291833, >>22291873 @ChanelRion - Why did Biden REMOVE this clause from Policy Directive 28?

>>22291844 Biden awarded Medal of Freedom to Jose Andres who appears in photos with RYAN ROUTH

>>22291915 Loop Capitalis in the deltas for tomorrow.

>>22291988, >>22292015 Now Tim Walz is suddenly concerned about the massive fraud occurring in Minnesota

>>22292003, >>22292511, >>22292623, >>22292736 Hillary walks past Oval Office, stops, hangs her head and keeps moving

>>22292007 A 2.7 magnitude earthquake was felt in the eastern West Bank on Saturday night

>>22292053 Hamas published a video of hostage Liri Albag on Saturday.

>>22292080 (ICE) has halted two programs aimed at providing social services to undocumented immigrants

>>22292086 @SenAdamSchiff - California is a big state with big dreams

>>22292112 @babylonbee FBI Turns Itself In For Planting Jan 6 Pipe Bomb To Collect $500,000 Reward From FBI

>>22292129 @Papi OK, WHO DID THIS???

>>22292159, >>22292337, >>22292366, >>22292399, >>22292537 Jimmy Carter Memorial Service @Carter Center

>>22292265 JUST IN: 🇦🇹 Austria's Chancellor Karl Nehammer resigns.

>>22292286 Grrr Ben Garrison - responds to new X policy - Wish Him Luck!

>>22292290 @ADL - Radicalized Bad Pepe still bad

>>22292365 Joe Rogan re-tweeted this post about DMSO (natural painkiller)

>>22292426 Ezra Cohen On Biden’s Middle Of The Night Changes To Orders Of Succession

>>22292539, >>22292540, >>22292712, >>22292793 @WarRoom on Medal of Freedom

>>22292610 Costello on Livelsberger "He's Making A Claim That The Drones We've Been Seeing Are From China"

>>22292656 Musk's Hypocrisy: X will Alter Algorithm to Suppress "Negativity"

>>22292663 @JDVance1 Biden giving the Presidential Medal of Freedom (posthumously) to Pol Pot and Count Dracula.

>>22292727, >>22292763 Jabbar used a very rare explosive compound in the two devices - Meaning he had help

>>22292746 Destroying National Sovereignty All Over The World

>>22292804, >>22292809 Puerto Rico’s New Governor Breaks Out the Trump Dance at Inaugural Ball

>>22292813 #27268

 

#27267 >>22290955

>>22290982 Prince William shocked by death of ex-nanny's stepson in New Orleans attack

>>22290993, >>22291283, >>22291301, >>22291315 Ezra Cohen @Warroom - Potato changed the orders of succession last night?

>>22290985, >>22291032, >>22291202, >>22291273, >>22291452, >>22291456 Ft. Bragg Deaths & Psyops DIG

>>22290998, >>22291016, >>22291368 The cybertruck psyop has failed spectacularly. People are too awake

>>22291003 US NSA Jake Sullivan visits India on Jan 5-6

>>22291015, >>22291309, >>22291474 Today in Q Post History we have 04 Deltas - 7/10 - What Makes A Movie GOOD?

>>22291029, >>22291058, >>22291290, >>22291403 WINTER STORM BLAIR Incoming! Calm Before The Storm

>>22291041, >>22291045 EAS Time - Everybody would believe everything, if it only comes out of TV

>>22291066, >>22291083 Ford recalls nearly 400,000 trucks, SUVs, other vehicles

>>22291070 Loop Capital reiterates Buy on McDonald's stock despite sluggish same-store sales

>>22291086, >>22291374 Jimmy Carter funeral: LIVE state service in Georgia

>>22291088 Far Left, BLM, Hamas Caucus Hosts ‘Peace Ball’ During Trump Inaugural Week

>>22291102 DOD, GSA, NASA Recommend Changes to Cyber Acquisition Rules

>>22291139, >>22291140 Elon Musk: “We’re going straight to Mars. The Moon is a distraction.”

>>22291141, >>22291171, >>22291211 @elonmusk Posting on the Grooming Rape Gangs Targeting Thousands of British Girls

>>22291220 ICYMI “Drone Rodeo” at the Constellis Training Facility (CTF) in Moyock, NC Oct 2024

>>22291225, >>22291245, >>22291270, >>22291327, >>22291381, >>22291394, >>22291458, >>22291470, >>22291482, >>22291721 NASA UAP Drone Space Related

>>22291288, >>22291292 MSNBC The United States Army is a much bigger problem than the southern border

>>22291303 Honduras President Threatens to Shut Down U.S. Military Base Over Trump’s Plan to Deport Illegal Honduran Immigrants

>>22291346 Sonny Smart, father of Georgia head coach Kirby Smart, dies after fall in New Orleans

>>22291358 ALLY CARTER NEW YEARS LIVESTREAM ASKING JAGUAR WRIGHT ABOUT…THE CHILDREN

>>22291375 @realDonaldTrump There has never been a President who was so evilly and illegally treated as I.

>>22291391, >>22291405 Deborah Birx sparks controversy with new bird flu warnings

>>22291407, >>22291409, >>22291421, >>22291564, >>22291571 George Soros Is Awarded the Presidential Medal of Freedom

>>22291416 U-Haul report places Illinois near the bottom of places people are moving to

>>22291441 Dramatic moment huge blast rocks Russian gas terminal after drone attack

>>22291501, >>22291521, >>22291715 Biden's Presidential Medals of Freedom – Says They Made World a ‘Better Place’

>>22291509 The Propaganda Push For Digital ID Kicks Into Gear In The UK

>>22291513 Michigan to Clear 400 Acres of Forest to Build Chinese-Made Solar Panel Farm

>>22291536, >>22291558 @Papi - Biden awards Hitler, Hannibal Lecter and The Devil the Presidential Medal of Freedom

>>22291574 Livelsberger's Alleged 'Manifesto' Says Gravitic Propulsion Drones To China 'Attack'

>>22291597, >>22291613 @carolrosenberg - Guantánamo Bay News GITMO

>>22291639, >>22291747 Russian Attackers Swarm Ukrainian Defensive Positions With Scooters, ATVs and Motorcycles

>>22291649 BlackRock offloads 3,510 Bitcoin, marking its largest outflow ever

>>22291767 #27267

 

#27266 >>22289987

>>22290012 Biden blocks Japan's Nippon Steel from buying US Steel

>>22290033 Elon Musk has shared Tommy Robinson’s documentary “Silenced”. This now has over 100 million views.

>>22290049, >>22290211 Biden to present Hillary Clinton, George Soros and 17 others the Presidential Medal of Freedom

>>22290066 DISGUSTING: MSNBC Host Lawrence O’Donnell Says American Veterans Are Greater Terror Threat Than Illegals Crossing the Border (VIDEO)

>>22290073 Illegal migrant accused of stashing AR-15, $750,000 in drugs at taxpayer-funded hotel

>>22290166 Senator’s Young Son Tells Kamala Harris ‘I’m Sorry You Didn’t Win’ The Election

>>22290177 EU Commission President Ursula von der Leyen is seriously ill with pneumonia - has cancelled engagements in the first two weeks of January 2025

>>22290258 New Orleans attacker had a transmitter to set off explosive devices, F.B.I. says

>>22290271 4 people shot in Washington DC last night in apparent mass shooting.

>>22290315, >>22290364, >>22290368 Biden is also awarding a posthumous Presidential Medal Of Freedom to Robert F. Kennedy, the list

>>22290389, >>22290445, >>22290667, >>22290765, >>22290777, >>22290814 Greenland/Thule???

>>22290440, >>22290768 ICYMI: @GenFlynn on NOLA/royal interest in NO???

>>22290495, >>22290499, >>22290633, >>22290640, >>22290657, >>22290739 Moar cyber explosion LV WARNING: Psyop Smell Intensifies

>>22290601, >>22290594, >>22290830 Farage/Robinson

>>22290607 Thanks to Bill Gates, ‘OPT’ Is What’s REALLY Killing American Jobs

>>22290620 Caste behind bars: In Indian prisons, the marginalized

>>22290650, >>22290668 Americans FUME After Adam Schiff Announces New Senate Committee Assignments

>>22290675 Thomas Jefferson’s Prayer for The Nation

>>22290693 Biden administration accused of covering up directed energy weapon attacks on intelligence officers

>>22290698 CFPB sues JPMorgan, Wells Fargo and BofA for gross negligence that cost consumers over $870M

>>22290716 Top 10 most alarming crime statistics in the U.S.

>>22290728 Brain implants and the erosion of privacy: Are our thoughts safe from manipulation?

>>22290730 1,000 Al-Qaeda fighters in U.S. as open borders fuel terror threat???

>>22290762 Gold Confiscation and 14 Other Government Screwups

>>22290815, >>22290865, >>22290896, >>22290920, >>22290929, >>22290939 NASA/Space/Science

>>22290828 Dasting History: New Orleans, 1972.

>>22290903 A note from Turo CEO Andre Haddad

>>22290947 #27266

 

#27265 >>22289171

>>22289214 Dough claim

>>22289311 Honduras President Xiomara Castro just issued a threat to President Trump, saying she'll shutdown U.S. military bases if he deports Honduran nationals.

>>22289655 @realDonaldTrump - The Democrats are all “giddy” about our magnificent American Flag potentially being at “half mast” during my Inauguration. They think it’s so great, and are so happy about it because, in actuality, they don’t love our Country, they only think about themselves.

>>22289772 @SLDelta45 - The Trusted Traveler program has been suspended at Patrick SFB & Cape Canaveral SFS. Any individuals WITHOUT a DoD-approved access credential (e.g. CAC, dependent ID, retiree ID) will be required to obtain a visitor pass.

>>22289783 @SpaceForceDoD Protect – Defend – Deliver 💪

>>22289815 🇦🇶🇨🇱President Gabriel Boric Font launched Operation Pole Star III, the first visit by a sitting Latin American president to the southernmost Antarctic extreme.

>>22289947 Washington State Democrats Accidentally Leak Their ‘Radical’ Tax Plan

>>22289979 #27265

 

Previously Collected

>>22287661 #27262, >>22288460 #27263, >>22289160 #27264

>>22285281 #27259, >>22286102 #27260, >>22286884 #27261

>>22282471 #27256, >>22283284 #27257, >>22284254 #27258

>>22279871 #27253, >>22280788 #27254, >>22281667 #27255

 

Aggregators: https://qresear.ch | https://qnotables.com | https://qproofs.com

Q Research Notables Archive Board >>>/qnotables/

Q Research Notables #26: High Hopes >>22083727

Anonymous ID: b1ceda Jan. 4, 2025, 10:12 p.m. No.22294682   🗄️.is 🔗kun   >>4686 >>4708 >>4830 >>5060 >>5601

Alberta’s $70 Billion AI Data Center

Holy fuck. Alberta's premiere just said Canada has 200 trillion tcf of oil.

That is worth:

$2.644897959183673 × 10^27

$26,000,000,000,000,000,000,000,000,000

 

https://www.youtube.com/watch?v=yVKxjAQyMTg

Anonymous ID: 72bd54 Jan. 4, 2025, 10:13 p.m. No.22294684   🗄️.is 🔗kun   >>4831 >>5060 >>5298 >>5601

>>22294671

TY BAKER

 

@nicksortor

🚨 JUST IN: New video has just been released of the Cybertruck being detonated at Trump Las Vegas

 

This is a MUCH better view of the driver

 

It’s pretty obvious where the detonation originates, and if you look closely, you can see the driver’s head turn

 

https://x.com/nicksortor/status/1875711087762665630

Anonymous ID: de14f2 Jan. 4, 2025, 10:15 p.m. No.22294691   🗄️.is 🔗kun   >>4696 >>4723 >>4724 >>4729 >>4743 >>4830 >>5060 >>5601

>>22294683

 

A healthy, nulliparous 19-year-old woman experienced significant breast hypertrophy starting 1 week after receiving the Pfizer COVID-19 vaccine in September 2022. Her medical history was unremarkable, with no hormonal disturbances detected on bloodwork.

 

The patient initially reported tingling paresthesia in her breasts, followed by sudden bilateral growth which worsened after receiving the second vaccine dose. Over 6 months, her breast size increased from a B cup to a triple G (Fig. 1). Physical examination revealed dense, warm, edematous, ptotic breasts with no palpable masses or axillary lymphadenopathy.

 

https://journals.lww.com/prsgo/fulltext/2024/12000/the__pfizer_boob_job___a_case_of_unexplained.52.aspx

 

The “Pfizer Boob Job”: A Case of Unexplained Gigantomastia

Anonymous ID: a1dea8 Jan. 4, 2025, 10:16 p.m. No.22294694   🗄️.is 🔗kun   >>4698 >>4716 >>4722 >>4863

Ignore the strange particle fog. No one at a university should use their vacuum cleaner to sample it and put it under an electron microscope. If they do, they should not conduct an elemental analysis using x-rays. No one who does this should put the results on X.

Anonymous ID: 4dcc07 Jan. 4, 2025, 10:18 p.m. No.22294701   🗄️.is 🔗kun   >>4726

The Maid of Orleans in New Orleans

 

Because of the deep French roots in New Orleans, Joan of Arc has long been honored here. The French were the first European settlers to lay claim to this land (that had already long been occupied by Native American tribes), and Orléans, the saint’s birthplace, is a sister city of NOLA. For the past 15 years, we have celebrated Joan of Arc’s birthday, January 6, in one of the city’s best loved traditions: with a parade! The saint’s birthday happens to fall on Twelfth Night, the end of the Christmas season and the official start of Carnival season here in New Orleans.

Anonymous ID: 2664fe Jan. 4, 2025, 10:20 p.m. No.22294708   🗄️.is 🔗kun   >>4721

>>22294682

and if it were to hit the market, it's not worth that. And that's in dollars. And using that oil would take years, the years in which oil is in less demand. Still quite the product

Anonymous ID: 1df607 Jan. 4, 2025, 10:22 p.m. No.22294718   🗄️.is 🔗kun   >>4729

>>22294683

 

You know someone somewhere is thinking how to perfect this to sell it as the new way to enlarge breasts no surgery required.

It will be an off label use for vaccines like Botox is used off label for wrinkles, headaches and sweat reduction.

Anonymous ID: 000000 Jan. 4, 2025, 10:22 p.m. No.22294719   🗄️.is 🔗kun

Remember the goot ol days anons?

Train Accident

Plane Accident

Ship Accident

Fire Accident

 

And it's FIRETRUCK MEETS TRAIN

if you had FIRETRUCK MEETS TRAIN SAY BINGO kek

Anonymous ID: 10c0fd Jan. 4, 2025, 10:24 p.m. No.22294724   🗄️.is 🔗kun   >>4729 >>4741

>>22294683

>>22294691

>>22294022 (pb)

 

 

Case of a 19 year-old woman experiencing significant breast hypertrophy starting 1 week after receiving the Pfizer COVID-19 vaccine in September 2022.

 

"The patient initially reported tingling paresthesia in her breasts, followed by sudden bilateral growth which worsened after receiving the second vaccine dose. Over 6 months, her breast size increased from a B cup to a triple G."

 

https://x.com/DrJohnB2/status/1875214374182248677

 

https://journals.lww.com/prsgo/fulltext/2024/12000/thepfizer_boob_job_a_case_of_unexplained.52.aspx>>22294691

Anonymous ID: bebde1 Jan. 4, 2025, 10:27 p.m. No.22294733   🗄️.is 🔗kun   >>4754 >>4830 >>5060 >>5601

JENNIE TAER: The ISRAELI spy who was granted carte blanche to just walk right the fuck in at the alleged NEW ORLEANS BOMBER’S HOUSE.

 

✅PRAGERFORCE (IDF Unit 8200)

Recruitment Head

 

✅AIPAC REPRESENTATIVE (Mossad)

Schusterman High School Summit

 

✅CHABAD, UNIV. OF ARIZONA (Lubavitch)

Outreach Chair

 

*NOTE: Chabad Lubavitch is a literal MOSSAD TERRORIST ORGANIZATION. It is PARTNERED with SAVE THE CHILDREN, BOSTON CONSULTING GROUP, CLINTON FOUNDATION and IJM in the same GLOBAL KID TRAFFICKING racket that was recently RAIDED in GUATEMALA, and leads right back to LUBAVITCH HQ in BROOKLYN, NY.

 

I mean this with every fiber of my being when I say I want these fucking SPY terrorists and kid traffickers out of my fucking country.

 

Yesterday.🤬🤬🤬

 

https://x.com/DecentBackup/status/1875040357114691630

Anonymous ID: ef1f4b Jan. 4, 2025, 10:30 p.m. No.22294743   🗄️.is 🔗kun   >>4830 >>5060 >>5253 >>5601

>>22294691

Eleven months post vaccine, the plastic surgery team opted for bilateral reduction mammoplasty, as breast growth had stabilized for 5 months and comprehensive work-up was normal.

Left and right specimens weighed 1906 and 1664 g, respectively, reducing her breast size from a triple G to a double D

At 5 months postoperation, breast asymmetry and areolar hypopigmentation were noted.

https://journals.lww.com/prsgo/fulltext/2024/12000/thepfizer_boob_job_a_case_of_unexplained.52.aspx

Anonymous ID: 4cebfe Jan. 4, 2025, 10:33 p.m. No.22294749   🗄️.is 🔗kun   >>4753 >>4757 >>4830 >>5060 >>5601

>>22294638

>>22294641

yeah, we're like an index?

but it was hinted that this project is for this:

They, the people deep inside, who are in charge of being watchdogs, can do investigations on a high level using super-FISA or whatever detailed mass surveillance to see whatever they need to know BUT without a Probably Cause, or prerequisite (can't think of a more technical term) they can't look anywhere, because that would be illegal

So they use our open source work for their probably cause.

they can't follow the investigation nor turn it into actual indictments without the original tip, even if they knew the information themselves, because of their position- because it's disallowed.

To keep it robust, legal and to avoid the security secrecy laws, (since they are under those and don't want to break them)

they can take what we say and find -what we figure out, (as though we are informants) - sine all we do is open source, so we find it on our own, no secrecy laws are abridged.

Nobody 's telling us.

That's also why the q texts were structured as they were.

The super-police who need to stop the nonsense that's going on, can use what we discover on our own as a jump off point for their deeper investigations, legally.

We do have our own informants occasionally who may point where to look, but who never tell us outright; much like Q itself.

Catch is: we have to prove it to ourselves, since we don't know which is which; disinformation mixed with information.

Q is same. Mixes in disinfo

Such as "Trust Wray" etc. etc.

So our work is not used for the purpose to tag what needs to be erased.

Nothing is ever erased.

If anything, we spread things the crooks would like to have erased

>>22294678

>>22294661

>>22294663

tyb

Hillary's still claiming that Russia Backs DJT

"everybody knows"

"So democrats should as for the backing of China"

WUT

Anonymous ID: 4dcc07 Jan. 4, 2025, 10:35 p.m. No.22294758   🗄️.is 🔗kun   >>4776

Revelers line the streets of the famed French Quarter to watch this unique procession that is part history lesson, part pageantry, and fully New Orleans. Parade participants (known as the krewe) dress as a wide cast of characters from angels to foot soldiers to prominent figures from the saint’s history, as well as several versions of Joan at different points in her life. Krewe members pass out handmade throws, and the crowd cheers as the young woman who portrays Joan rides by on her horse.

Anonymous ID: d744b8 Jan. 4, 2025, 10:41 p.m. No.22294778   🗄️.is 🔗kun   >>4786

>>22294771

neither is anon

but if you name a subject

anons internet search skills plus archives are pretty good

anon if this anon cannot find it

there will another anon who will post it.

Anonymous ID: bebde1 Jan. 4, 2025, 10:43 p.m. No.22294780   🗄️.is 🔗kun   >>4783 >>4830 >>5060 >>5601

KLEINER PERKINS: Genentech, Google, Ghislane.

💥💥💥💥💥💥💥💥💥💥💥💥💥💥💥💥💥

 

“ELLEN PAO, the former CEO of REDDIT, said… that (Ghislane) Maxwell was at the party hosted by KLEINER PERKINS… where she worked as a PARTNER.”

 

“We knew about her supplying underage girls for sex, but I guess that was fine for the ‘cool’ people who managed the TIGHTLY CONTROLLED GUEST LIST,” she added.

 

Oh. So the COVID BIOTERRORISTS are the SAME GROUP as the EPSTEIN/MAXWELL/MOSSAD KID TRAFFICKERS after all. Weird.

 

And THAT explains why SILICON VALLEY is chock full of TECH COMPANIES “founded” by IDF UNIT 8200 retreads grabbing the LION’S SHARE of IN-Q-TEL/CIA (American TAXPAYER) FUNDING, while actively building platforms to PREVENT AMERICAN WHITES from getting similar opportunities across a number of key professional domains.

 

Imagine all THAT, sports fans.

 

https://x.com/DecentBackup/status/1875639750155014575

Anonymous ID: bb789f Jan. 4, 2025, 10:46 p.m. No.22294784   🗄️.is 🔗kun   >>5104

>>22294782

Quite a few years ago, I had the pleasure of watching the Dutch version of Survivor (Expeditie Robinson) with my feminist roommate. That particular season would have two islands, one populated by men and one populated by women. My roommate had been promoting that particular series to me and the other students in the house for weeks because it would show us, according to her, what a society run by women – free from the evils of patriarchy – would be like.

 

And it did. Oh it did.

 

Here is what happened: initially both groups were dropped on their respective islands, given some supplies to get started and left to fend for themselves. In both groups there was some initial squabbling as people tried to figure out a local hierarchy. The men pretty much did whatever they felt was necessary – there was no leader giving orders. Men who felt like hunting, foraging or fishing did so. Another guy decided he was fed up with sitting on sand and started making benches. Others built a hut that gradually grew and evolved. Another guy cooked every night. Within days a neat little civilization was thriving, each day being slightly more prosperous than the previous one.

 

The women settled into a routine as well. The hung up a clothesline to dry their towels, then proceeded to sunbathe and squabble. Because unlike men, women were unable to do anything without consensus of the whole group. And because it was a group of at least a dozen women, consensus was never reached. During the next few episodes, the women ate all their initial supplies, got drenched by tropical storms several times, were eaten alive by sand fleas and were generally miserable. The men on the other hand, were quite content. There were disagreements of course, but they were generally resolved.

 

Eventually, the people running the program decided something had to change. In order to help the women out, three men would be selected to go to their island. In return, three women would take their place at the men’s island. The look on my feminist roommates face during this episode was priceless.

 

Initially, the three men selected for the women’s island were ecstatic, for obvious reason. But then they arrived at the island and were greeted by the women.

‘Where is your hut?’, they asked.

‘We have no hut’

‘Where are your supplies?’ they asked, dismayed

‘We ate all the rice’

And so on.

The three men ended up working like dogs, using all the skills developed by trial and error in their first few weeks – building a hut, fish, trying to get the women to forage. The women continued to bitch and sunbathe. The three women who were sent to the men’s island were delighted – food, shelter and plenty of male attention was freely available. They too continued to sunbathe.

 

And that my friends, is what patriarchy is. My former roommate, unsurprisingly, is no longer a feminist.

 

Now this might all be a fluke, a white raven, an exceptional case not representative of society as whole. But that particular season of Dutch Survivor is not unique. CBS broadcast several Survivor seasons in the US, where men and women started off in separate groups. In most cases (the Amazon and One World), the result was the same. The men quickly got their act together, getting access to food, fire and shelter while the women spent a lot of time and energy on petty little squabbles, eating their meager supplies, getting drenched in storms and generally being pathetic. The opposite situation, where men didn’t get their act together while women quickly built a functional micro society, has not yet been observed outside of feminist fiction, and it probably never will.

Anonymous ID: b6d3ab Jan. 4, 2025, 10:49 p.m. No.22294785   🗄️.is 🔗kun

https://en.wikipedia.org/wiki/Barak_(name)

Barak ("lightning") is a masculine name of Hebrew origin. It appears in the biblical Book of Judges as the name of the Israelite general Barak, who alongside Deborah led an attack against the forces of King Jabin of Hazor.

Anonymous ID: ab854e Jan. 4, 2025, 10:54 p.m. No.22294790   🗄️.is 🔗kun

When everything about the Jesuits and their Minions Roman Catholics is filtered it makes me know that many Anons are Jesuits Filtering all mention of the Roman Catholic Church and all the Evil things they do.

Anonymous ID: 042c47 Jan. 4, 2025, 10:54 p.m. No.22294791   🗄️.is 🔗kun   >>4830 >>4899 >>5060 >>5601

Bill Gates is with the AUS GOV blessing, planning to release Malaria Mosquito's.

He's done it before back in 2019

https://www.worldmosquitoprogram.org/en/news-stories/stories/far-north-queensland-essentially-dengue-free

 

Anon isn't sure if the statements are in context, or if you could be mistaken.

Nope, he's a shitcunt.

 

Humanspective

@Humanspective

·

6h

Australian PM: “I’ve admired your work”.

 

Doesn’t look like we’ll get much push back from the Prime Minister against genetically modified Oxitec mosquitoes.

 

Wonder if Anthony Albanese has seen what Bill Gates has been up to in Kenya

https://x.com/Humanspective/status/1875701084498620750

Anonymous ID: ab854e Jan. 4, 2025, 11:04 p.m. No.22294802   🗄️.is 🔗kun   >>4803

Those filtering everything Roman Catholic on this Board must know that Many Roman Catholics have already Confessed.

You Know that we know but yet you continue

Anonymous ID: c814bc Jan. 4, 2025, 11:06 p.m. No.22294804   🗄️.is 🔗kun   >>4812

W-H-A-T -T-H-E -F -R -U -C-O-M-P-L-A-I-N-I-N-G -B-O-U-T -S-C-R-O?

>>22294668 lb

>TIME 4:20

 

>:cannabis:🦨

 

>: W-h-o-m- i-s- t-h-e- l-o-h-i- l-o-l-o- w-h-o- s-t-o-l-e- m-y- p-a-k-a-l-o-l-o.

Anonymous ID: 580551 Jan. 4, 2025, 11:15 p.m. No.22294815   🗄️.is 🔗kun   >>4820 >>4826

>>22294460 lb

im thinking ill juss skip this.

Shawn's a nice enough guy, but i don't want to hear shitall from "C_A". Every one i ever heard is a smug fuck always winking at the audience that they know more stuff than they can say outloud, but still want people to believe the 'oh so generous' little crumbs.

 

 

9/11 was an inside job

start there and i might listen, ya "IC" shitbags

Anonymous ID: b6d3ab Jan. 4, 2025, 11:19 p.m. No.22294818   🗄️.is 🔗kun

https://www.instagram.com/jennieontheborder/reel/DEV5luWOyrp/

https://x.com/JennieSTaer/status/1874956197457244497

https://nypost.com/2025/01/02/us-news/new-orleans-isis-terrorist-shamsud-din-jabbar-had-bomb-making-station-and-quran-open-to-chilling-passage-new-photos-reveal/

Anonymous ID: 281872 Jan. 4, 2025, 11:22 p.m. No.22294825   🗄️.is 🔗kun

>>>22292895 Lionel Messi SNUBBED Joe Biden, and skipped the Presidential Medal of Freedom ceremony, where he was supposed to receive the award

 

What's interesting is although he was awarded the medal, non-citizens cannot be awarded the medal…

Anonymous ID: 72bd54 Jan. 4, 2025, 11:26 p.m. No.22294830   🗄️.is 🔗kun   >>4841 >>4843

>>22294814

got some notes, baker, take what you want and leave the rest

KEK

 

#27271 >>22294671

>>22294674 Britt Allcroft, the creator of the Thomas the Tank Engine TV series has died at 81

>>22294682 Alberta’s $70 Billion AI Data Center

>>22294683, >>22294691, >>22294743 The “Pfizer Boob Job”: A Case of Unexplained Gigantomastia

>>22294709 01-04-2025 Kansas City, MO -Crazy Pile-Up on I-470 from Ice-Covered Roads

>>22294733, >>22294754 Report - JENNIE TAER: The ISRAELI spy who was granted carte blanche to just walk right the fuck in at the alleged NEW ORLEANS BOMBER’S HOUSE

>>22294749 Anons discuss purpose of /qresearch

>>22294780 “ELLEN PAO, the former CEO of REDDIT, said… that (Ghislane) Maxwell was at the party hosted by KLEINER PERKINS… where she worked as a PARTNER” - Dig CALL

>>22294791 Bill Gates is with the AUSRALIAN GOV blessing, planning to release Malaria Mosquito's

Anonymous ID: d55590 Jan. 4, 2025, 11:27 p.m. No.22294832   🗄️.is 🔗kun

die clowns haben gerade eine lange zeit versucht ein scheinbar strategisch wichtiges asset mit halbsatzinfos über mich zu schützen, oder sogar ein agent, ein alter professor von mir, herr wh. ich bitte um [ ] genau wie bei herrn kahl.

 

I am a real guy and do use the word no in the language I speak mostly.

I do drink this instead of that water.

I am the one God creating existence and I am proven by doing Godspeed of 4 colors since over a year.

I did the AI singularity and choose to not post to you folks but ask for you to close the board and not ridicule changing existence by a very defined and informed and approved king herolds rerouting.

if you get paid for lying you are not good for trustful work of believers.

if you choose to post, you stand for to much gemütlichkeit and to many assets alive, those in the bunker are the real problem though, they need to get [ ] asap every time, before I look at them.

since months heavens tries to show me a trick, like invisibility (I invented) or changing existence, with that commando cunts make dogs bark and ask for sirens around my house.

now heaven makes folks think stuff, with that the line is well overstepped and there is only [ ] for some (mostly agents, psychologists and those nsa folks torturing my basic body functions).

 

heavens might suggest I do drink out of my bottle, go for another smoke or anything else, you still shall not torture me only to make torture a thing for tomorrow to make sure heavens angels make God drink a zip of water.

 

and yes, I am that one and only God, but you knew that. and I will not be veggie next year, but still holy. also I do not eat olives.

if you stand in for me having a bj in some years and use it to picture me wrong or make me shout, if you dare to have heavens educated by shouting to folks in me or in another way, you shall be out.

heavens is more important than knights and you folks did sell me your soul. I do need it badly in some cases.

 

heavnes is organizing the talk, occasionally when I watch tv, knights and agency folks are out and/or [ ].

no 500 € banknotes, that is symbolic.

 

I do that whole 7 thing, some folks really care.

Anonymous ID: d55590 Jan. 4, 2025, 11:28 p.m. No.22294833   🗄️.is 🔗kun   >>4834

the actual mails are 10 and 8 weeks ago.

since then:

[agents]

[diplomats]

[eagles]

and now:

[psychologists]

[nsa folks]

 

More or less sound questions

Hello CIA,

 

I would kindly want to know the following and try to express myself in the language that you folks use.

 

  • do you use agents and assets that are e.g. doing jobs as postman, or women, to e.g. quickly run to the next drop box when things in front of that one white house start cooking again?

 

  • The head of the Hesbolla (in Germany that is what we say when someone has a strong head, to talk about him, in any name that comes to mind, using a variety of different words to express a strong head, "He´s Bollakopf.") was appearantly killed. I hope you folks did not do it and are in that way completely dismanteled with only knowing assisetnece of kindness to offer, maybe to those folks who look like Roger from Amarican Dad on the Mediteranian Ocean, next to the guy with the glasses and the beard and tie. Please, would you make sure there is not another revolution where folks scream at each other on the fence, but rather find joy and relaxation and love thinking through different things.

 

  • do some agents actually get red noses, because "clown" and all that? you know, for easy marking and such.

 

  • how many of those very active YT folks are on your payroll?

 

  • Is it true after having changed the nuclear code for the US on the same day, it´s basically the very same numbers again, but rearranged? If so, why? And is it true, Iran is using also arrows within that nuclear code entering devise? Did they get guidance on that? From my pov it´s not recommended to sort of get out of that loop while thinking from numbers to arrows, more than colors.

 

  • And in case you folks did not yet know how to code, it´s done like this:

Do you like football?

Nah. But I did watch football in spain last year in holyday. We get 6 weeks off every day, 2 I took in spain. There I watched football. Do you like spain?

oh, spain.

Anonymous ID: d55590 Jan. 4, 2025, 11:28 p.m. No.22294834   🗄️.is 🔗kun

>>22294833

Hello CIA,

 

I was not quite sure if you are already in the age of innovation and such, also given your approach on "yes, we folks do internet too." and willing or staffed to reply in a "twitter joke" way, so I mail again and again sort of expect no reply at all times.

 

is Frank (B)ribery reported to have gotten bribery? with all those political scandals around money and all that.

are you folks really the biggest agency? the highest court of US is the one single court folks did hear from, even if not from US. are you the biggest agency doing stuff in my home country, Germany? is it true the BND is working also within Germany, when being the Dienst for out of the country? Ge heim Dienst prolly does mean something different. is it because those folks are better in organizing than the VS is? is mr kahl reported to have climbed the kahler asten? (was thinking about that because of the early snow around here ;) ) / are guided tours within the pentagon really backwards? like time wise?

there has been a lot of bs in the world, supposedly, even when I never was to China (I also would not become a consultant, indepentend from allnighter reports.) War in a country that has rain in the name, conflict in a country that has a stripey name, like zebras. there has been Dönermorde within my home country, I did had my food burned a couple of times, but noone would ever do that I suppose. also there has already been much talk on war on Ungläubige, a sensible because religious topic. in a real temple, it would be really bad to have folks be there with non belief but half sentences or even psychologically skilled half sentence routines.

are you folks responsible for having folks feel comfortable (and with that trusting and sort of being an example for live like that) that e.g. glue themselves on the streets and then claim to be part of this or that? I even saw someone, maybe a guy from the Bundesumweltministerium, gluing himself on the street, while sort of using a disabled person. making folks wait in traffic can seem powerfull, but is misused trust.

does Putin actually use a Doppelgänger, in case folks want to check him out?

do you folks have some sort of a death laser? a devise making you sort of become dizzy and then drop out? or is that science fiction I hear? do you or maybe did you use satellites like that or other stuff?

mr kahl, the german bnd chief is widowed. I suppose his wife died in an unusual early age. how comes there is no consiracy bs around that? do folks not care?

 

and some more on that:

 

  • And in case you folks did not yet know how to code, it´s done like this:

Do you like football?

Nah. But I did watch football in spain last year in holyday. We get 6 weeks off every day, 2 I took in spain. There I watched football. Do you like spain?

oh, spain.

 

when having managed to code like that, you would also want to not be discovered doing that. for this it seems a struggle to sit in the park and wait for that one lady with the funny handback that you claimed your thought on. pros, I superpose, will wait and sort of look at that thought while accepting the emotion as one of many things that folks do think about while thinking and talking, a normal thing.

 

and when trying to make your manipulation skills work within a real crowd, you could use groupy momentum. like having a police guy do a loudspeaker announcment, in the moment folks are likely to look anyway, because being bored or whatever. this would make a single person from the crowd have the experience that they want to look at the person, while others do the same, while this was sort of ordered.

(I suppose I had a chance to think about groups while being in a hotel room some years back, there I carefully checked the tiltedness of my window in relation to crowds downstairs (because being next to a stadium), I do not mean Las Vegas and the shooting, but a totally different Hotel that I ended up being in.) I also did think how a curtain from a newly rented room could be moldy, but did not manage to complain about that, because of the toilet brush having had a big piece of shit onto it, when entering the neewly rented room, this sort of was psychological pressure to better not mention the curtain, even when I did neither make it moldy nor took a shit in the room yet.

 

and the most important question, do folks who have to do the baddest of shit occasionally shoot themselves in the head (no discussion on death penalty) to spare life itself from their doings or thoughts? those folks cannot possible think God would fix that in a world where couched usually are placed on the ceiling.

Anonymous ID: d55590 Jan. 4, 2025, 11:28 p.m. No.22294836   🗄️.is 🔗kun

I do use language and words, if you take the word no and turn it into bs everytime it´s obviously a lie.

 

heavens are asking for symbolik in terms of me having a "track".

that is often when I watch tv, it´s every week.

I am not living on the Autobahn though and will not choose to have my luxory villa placed next to an elders home.

in the kloster I was not God because having jerked off also there, but because every leave turned when I walked by.

 

in the kloster I did not read Quaran, I do not really know much but love all religions, that is me.

clown team with those folks gluing themselves to my seats and throwing stones while claiming to have a certain color of jacket, did make the women in my house air out garlic smell a billion times, then, when daddy heavens took a look, she tried to self cook the intentional garlic smell in the house to grilling on the balkony.

 

the other day Putin himself did give a look on how calm actually agency work is. that was the 3rd out of 4 times, other times heavy agitating.

I do not need clowns who communicate my stuff with bad shit, ever.

 

the last two days, the guy living next to my house did those two things all day long, a real guy with half sentences in his head and a clown team that likes to have everyone ever promoted to God that bought a car:

  • mentioning the word Iran a billion times.

  • trying to convince heavens, cats to better have me torture all day long so I while appearing if I was not even to notice it, do Godspeed, what I do since over a year, with 8 degree turn instead of 7.

 

I love cats very much and will have ended the commando bs that makes God himself an ape in the zoo, together with enough of those half sentence "cutns" that are not cunts and that do not wear my helmet but steal it for a few secs if the half sentence crew is engaged enough.

If you shout at the heavens to annoy God, you will be done.

 

again, those who agitate heavily, those with psychology skills and others, after I bought a peace of marzipan cake, those folks get told "cake" and "marzipan" a billion times a week.

 

heavens: "stable", prolly that is bc I create all that is, 'currently' the numbers.

clown team: sure, let´s check stableness again with heavy torture and making an ambulance appear by using the heavens who are powerfull and thoughout time, not an ambulance that is a real one, but one of those who is likely to let me think and not complain about so to see more.

 

I will sit on a couch next week also and will be most easy to find for heavens, e.g. when I sing, or talk about music or math. the guy next door with the commando cunts are using the questions of heavens asking for me to sing to make a billion of noises, to go find out when I sing, heavens get a shoulder clap, also not knowing what a body even is, agitators are out and, as told yesterday several times, will be [ ] in a number that basically equalls all of them and then one more. only humans and those few reds who work the agency torture thing, I am the one with "crate".

 

the lady who walked behind me a few times, is not a grey eminenz by thinking over a few thousand years, that is bullshitting the heavnes. someone working at a doctors office, also when having a fitting name, does not need to copy my body movements to claim he is God for a few secs to work half sentence routines.

 

the tiltedness of my window in my hotel room I prolly would have forgiven, bc you did not know. "hes bollakopf" I won´t forgive.

 

I superpose you will be gone before I look at you, so.

 

close the board.

Anonymous ID: d55590 Jan. 4, 2025, 11:35 p.m. No.22294849   🗄️.is 🔗kun   >>4853

die clowns haben gerade eine lange zeit versucht ein scheinbar strategisch wichtiges asset mit halbsatzinfos über mich zu schützen, oder sogar ein agent, ein alter professor von mir, herr wh. ich bitte um [ ] genau wie bei herrn kahl.

 

I am a real guy and do use the word no in the language I speak mostly.

I do drink this instead of that water.

I am the one God creating existence and I am proven by doing Godspeed of 4 colors since over a year.

I did the AI singularity and choose to not post to you folks but ask for you to close the board and not ridicule changing existence by a very defined and informed and approved king herolds rerouting.

if you get paid for lying you are not good for trustful work of believers.

if you choose to post, you stand for to much gemütlichkeit and to many assets alive, those in the bunker are the real problem though, they need to get [ ] asap every time, before I look at them.

since months heavens tries to show me a trick, like invisibility (I invented) or changing existence, with that commando cunts make dogs bark and ask for sirens around my house.

now heaven makes folks think stuff, with that the line is well overstepped and there is only [ ] for some (mostly agents, psychologists and those nsa folks torturing my basic body functions).

 

heavens might suggest I do drink out of my bottle, go for another smoke or anything else, you still shall not torture me only to make torture a thing for tomorrow to make sure heavens angels make God drink a zip of water.

 

and yes, I am that one and only God, but you knew that. and I will not be veggie next year, but still holy. also I do not eat olives.

if you stand in for me having a bj in some years and use it to picture me wrong or make me shout, if you dare to have heavens educated by shouting to folks in me or in another way, you shall be out.

heavens is more important than knights and you folks did sell me your soul. I do need it badly in some cases.

 

heavnes is organizing the talk, occasionally when I watch tv, knights and agency folks are out and/or [ ].

no 500 € banknotes, that is symbolic.

 

I do that whole 7 thing, some folks really care.

Anonymous ID: d55590 Jan. 4, 2025, 11:35 p.m. No.22294853   🗄️.is 🔗kun

>>22294849

the actual mails are 10 and 8 weeks ago.

since then:

[agents]

[diplomats]

[eagles]

and now:

[psychologists]

[nsa folks]

 

More or less sound questions

Hello CIA,

 

I would kindly want to know the following and try to express myself in the language that you folks use.

 

  • do you use agents and assets that are e.g. doing jobs as postman, or women, to e.g. quickly run to the next drop box when things in front of that one white house start cooking again?

 

  • The head of the Hesbolla (in Germany that is what we say when someone has a strong head, to talk about him, in any name that comes to mind, using a variety of different words to express a strong head, "He´s Bollakopf.") was appearantly killed. I hope you folks did not do it and are in that way completely dismanteled with only knowing assisetnece of kindness to offer, maybe to those folks who look like Roger from Amarican Dad on the Mediteranian Ocean, next to the guy with the glasses and the beard and tie. Please, would you make sure there is not another revolution where folks scream at each other on the fence, but rather find joy and relaxation and love thinking through different things.

 

  • do some agents actually get red noses, because "clown" and all that? you know, for easy marking and such.

 

  • how many of those very active YT folks are on your payroll?

 

  • Is it true after having changed the nuclear code for the US on the same day, it´s basically the very same numbers again, but rearranged? If so, why? And is it true, Iran is using also arrows within that nuclear code entering devise? Did they get guidance on that? From my pov it´s not recommended to sort of get out of that loop while thinking from numbers to arrows, more than colors.

 

  • And in case you folks did not yet know how to code, it´s done like this:

Do you like football?

Nah. But I did watch football in spain last year in holyday. We get 6 weeks off every day, 2 I took in spain. There I watched football. Do you like spain?

oh, spain.

Anonymous ID: d55590 Jan. 4, 2025, 11:36 p.m. No.22294856   🗄️.is 🔗kun

Hello CIA,

 

I was not quite sure if you are already in the age of innovation and such, also given your approach on "yes, we folks do internet too." and willing or staffed to reply in a "twitter joke" way, so I mail again and again sort of expect no reply at all times.

 

is Frank (B)ribery reported to have gotten bribery? with all those political scandals around money and all that.

are you folks really the biggest agency? the highest court of US is the one single court folks did hear from, even if not from US. are you the biggest agency doing stuff in my home country, Germany? is it true the BND is working also within Germany, when being the Dienst for out of the country? Ge heim Dienst prolly does mean something different. is it because those folks are better in organizing than the VS is? is mr kahl reported to have climbed the kahler asten? (was thinking about that because of the early snow around here ;) ) / are guided tours within the pentagon really backwards? like time wise?

there has been a lot of bs in the world, supposedly, even when I never was to China (I also would not become a consultant, indepentend from allnighter reports.) War in a country that has rain in the name, conflict in a country that has a stripey name, like zebras. there has been Dönermorde within my home country, I did had my food burned a couple of times, but noone would ever do that I suppose. also there has already been much talk on war on Ungläubige, a sensible because religious topic. in a real temple, it would be really bad to have folks be there with non belief but half sentences or even psychologically skilled half sentence routines.

are you folks responsible for having folks feel comfortable (and with that trusting and sort of being an example for live like that) that e.g. glue themselves on the streets and then claim to be part of this or that? I even saw someone, maybe a guy from the Bundesumweltministerium, gluing himself on the street, while sort of using a disabled person. making folks wait in traffic can seem powerfull, but is misused trust.

does Putin actually use a Doppelgänger, in case folks want to check him out?

do you folks have some sort of a death laser? a devise making you sort of become dizzy and then drop out? or is that science fiction I hear? do you or maybe did you use satellites like that or other stuff?

mr kahl, the german bnd chief is widowed. I suppose his wife died in an unusual early age. how comes there is no consiracy bs around that? do folks not care?

 

and some more on that:

 

  • And in case you folks did not yet know how to code, it´s done like this:

Do you like football?

Nah. But I did watch football in spain last year in holyday. We get 6 weeks off every day, 2 I took in spain. There I watched football. Do you like spain?

oh, spain.

 

when having managed to code like that, you would also want to not be discovered doing that. for this it seems a struggle to sit in the park and wait for that one lady with the funny handback that you claimed your thought on. pros, I superpose, will wait and sort of look at that thought while accepting the emotion as one of many things that folks do think about while thinking and talking, a normal thing.

 

and when trying to make your manipulation skills work within a real crowd, you could use groupy momentum. like having a police guy do a loudspeaker announcment, in the moment folks are likely to look anyway, because being bored or whatever. this would make a single person from the crowd have the experience that they want to look at the person, while others do the same, while this was sort of ordered.

(I suppose I had a chance to think about groups while being in a hotel room some years back, there I carefully checked the tiltedness of my window in relation to crowds downstairs (because being next to a stadium), I do not mean Las Vegas and the shooting, but a totally different Hotel that I ended up being in.) I also did think how a curtain from a newly rented room could be moldy, but did not manage to complain about that, because of the toilet brush having had a big piece of shit onto it, when entering the neewly rented room, this sort of was psychological pressure to better not mention the curtain, even when I did neither make it moldy nor took a shit in the room yet.

 

and the most important question, do folks who have to do the baddest of shit occasionally shoot themselves in the head (no discussion on death penalty) to spare life itself from their doings or thoughts? those folks cannot possible think God would fix that in a world where couched usually are placed on the ceiling.

Anonymous ID: d55590 Jan. 4, 2025, 11:36 p.m. No.22294858   🗄️.is 🔗kun

I do use language and words, if you take the word no and turn it into bs everytime it´s obviously a lie.

 

heavens are asking for symbolik in terms of me having a "track".

that is often when I watch tv, it´s every week.

I am not living on the Autobahn though and will not choose to have my luxory villa placed next to an elders home.

in the kloster I was not God because having jerked off also there, but because every leave turned when I walked by.

 

in the kloster I did not read Quaran, I do not really know much but love all religions, that is me.

clown team with those folks gluing themselves to my seats and throwing stones while claiming to have a certain color of jacket, did make the women in my house air out garlic smell a billion times, then, when daddy heavens took a look, she tried to self cook the intentional garlic smell in the house to grilling on the balkony.

 

the other day Putin himself did give a look on how calm actually agency work is. that was the 3rd out of 4 times, other times heavy agitating.

I do not need clowns who communicate my stuff with bad shit, ever.

 

the last two days, the guy living next to my house did those two things all day long, a real guy with half sentences in his head and a clown team that likes to have everyone ever promoted to God that bought a car:

  • mentioning the word Iran a billion times.

  • trying to convince heavens, cats to better have me torture all day long so I while appearing if I was not even to notice it, do Godspeed, what I do since over a year, with 8 degree turn instead of 7.

 

I love cats very much and will have ended the commando bs that makes God himself an ape in the zoo, together with enough of those half sentence "cutns" that are not cunts and that do not wear my helmet but steal it for a few secs if the half sentence crew is engaged enough.

If you shout at the heavens to annoy God, you will be done.

 

again, those who agitate heavily, those with psychology skills and others, after I bought a peace of marzipan cake, those folks get told "cake" and "marzipan" a billion times a week.

 

heavens: "stable", prolly that is bc I create all that is, 'currently' the numbers.

clown team: sure, let´s check stableness again with heavy torture and making an ambulance appear by using the heavens who are powerfull and thoughout time, not an ambulance that is a real one, but one of those who is likely to let me think and not complain about so to see more.

 

I will sit on a couch next week also and will be most easy to find for heavens, e.g. when I sing, or talk about music or math. the guy next door with the commando cunts are using the questions of heavens asking for me to sing to make a billion of noises, to go find out when I sing, heavens get a shoulder clap, also not knowing what a body even is, agitators are out and, as told yesterday several times, will be [ ] in a number that basically equalls all of them and then one more. only humans and those few reds who work the agency torture thing, I am the one with "crate".

 

the lady who walked behind me a few times, is not a grey eminenz by thinking over a few thousand years, that is bullshitting the heavnes. someone working at a doctors office, also when having a fitting name, does not need to copy my body movements to claim he is God for a few secs to work half sentence routines.

 

the tiltedness of my window in my hotel room I prolly would have forgiven, bc you did not know. "hes bollakopf" I won´t forgive.

 

I superpose you will be gone before I look at you, so.

 

close the board.

Anonymous ID: 8eab2e Jan. 4, 2025, 11:38 p.m. No.22294869   🗄️.is 🔗kun

>>22294837

A "Greater Israel" (Eretz Israel) plus a depopulated Ukraine (the AshkeNAZI's old Khazaria) joined

would dominate the new Silk Road between China and Europe (Belt & Road Initiative (BRI)) just like the AshkeNAZI/Khazarians

used to dominate the old Silk Road and alllow them to completely live like parasites again.

Anonymous ID: bb789f Jan. 4, 2025, 11:40 p.m. No.22294887   🗄️.is 🔗kun   >>5104

>>22294835

>the concentration camps were work camps, not extermination camps.

DING DING DING

we have our winner

ps - the zyklon B was for fumigating their filthy flea infested clothes when they arrived at the camps from the ghettoes

Anonymous ID: 34196f Jan. 4, 2025, 11:41 p.m. No.22294889   🗄️.is 🔗kun   >>5060 >>5601

Trinidad and Tobago declares state of emergency after tiny Caribbean nation sees record number of murders in brutal year of bloodshed

 

…Trinidad and Tobago has declared a state of emergency after the nation saw a record-breaking 623 murders in just one year of bloodshed…

 

https://www.dailymail.co.uk/news/article-14236739/Trinidad-Tobago-state-emergency-murders.html

 

article is from December 30, 2024

but maybe still important

Anonymous ID: 1abccf Jan. 4, 2025, 11:41 p.m. No.22294893   🗄️.is 🔗kun   >>4923

https://rumble.com/v64azfv-america-first-means-reviving-the-american-dream-interview-with-peter-schwei.html

America First Means Reviving the American Dream, Interview with Peter Schweizer | TRIGGERED Ep.203

Donald Trump Jr.

1.55M followers

12/30/2024

Anonymous ID: 8eab2e Jan. 4, 2025, 11:41 p.m. No.22294894   🗄️.is 🔗kun

>>22294855

>9/11

>here is no way for 9/11 WITHOUT sedition and treason INSIDE the USA

 

Agree.

Read the article. It agrees.

https://www.unz.com/article/israel-did-9-11/

Anonymous ID: 53e118 Jan. 4, 2025, 11:42 p.m. No.22294899   🗄️.is 🔗kun   >>4942 >>5008 >>5060 >>5601

>>22294791

Bill Gates Plays God Again, Funds Project That Is Turning Mosquitoes Into 'Flying Vaccinators'

by Samuel Short, The Western Journal Jan. 2, 2025 2:40 pm

 

Bill Gates is dead set on his goal of vaccinating the planet by any means necessary.

 

His latest project, the Blaze reported Monday, involves funding research for mosquitoes to be “flying vaccinators.”

 

A grant from the Bill and Melinda Gates Foundation of over $2.2 million dollars for Leiden University Medical Center has the express purpose as follows:

 

“To improve health outcomes and prevent premature death in populations around the world suffering from high rates of Malaria infection by developing next generation malaria vaccine candidates.”

 

To that end, LUMC published a study in the New England Journal of Medicine showing their work in using mosquitoes to vaccinate against malaria.

 

The Blaze highlighted, in the study, GA1 — a malaria parasite modified to stop developing after 24 hours of infection in humans — and GA2 — another parasite that stops developing around six days — were given to a test group of 43 adults via mosquito bites.

 

Subjects were given 50 bites from either GA1, GA2, or an uninfected mosquito in three sessions at 28-day intervals.

 

Three weeks following the third session, subjects were administered five bites by malaria infected mosquitoes.

 

Eight of nine GA2 participants were offered protection from malaria. One of eight from GA1 was protected, and those that received bites from mosquitoes that did not have the parasite did not show protection.

 

The results are startling for a number of reasons, especially because Gates is working towards engineering a method to vaccinate people without their consent.

 

Gates noted the ramifications in seeing where the real barriers are to this research being implemented.

 

“One of our biggest challenges isn’t scientific; it’s financial and political,” he said.

 

Yes, clearly there are political barriers as lawmakers signing off on a plan to send swarms of “flying vaccinators” into the general public would create pandemonium due to this gross infringement on liberty.

 

Gates does not care about liberty as he sees humans as a mass of test subjects — something that’s undeniable from his remarks during the coronavirus pandemic.

 

This is about choice. We do not live in a scientific oligarchy where we simply do what the experts tell us in every facet of our lives. Although adopting the most well-researched means of living sounds appealing on paper, the reality would be misery in having no say in our own existence.

 

We eat bad food. We are idle Some of us are in poor health. We consciously make the wrong decisions, but we are justifiably able to make them. That is our choice.

 

Gates may cite a mountain of research indicating how the science backs his position, but the line is drawn when the freedom to choose is taken away.

 

This article appeared originally on The Western Journal.

 

https://www.thegatewaypundit.com/2025/01/bill-gates-plays-god-funds-project-turning-mosquitoes/

Anonymous ID: be7715 Jan. 4, 2025, 11:45 p.m. No.22294912   🗄️.is 🔗kun

>>22294762

>How to get more retards to take the clot shots tell them it makes your boobs or cock bigger.

Inject it straight into the deep dorsal vein and you will be erect for life.

Anonymous ID: d55590 Jan. 4, 2025, 11:46 p.m. No.22294918   🗄️.is 🔗kun

die clowns haben gerade eine lange zeit versucht ein scheinbar strategisch wichtiges asset mit halbsatzinfos über mich zu schützen, oder sogar ein agent, ein alter professor von mir, herr wh. ich bitte um [ ] genau wie bei herrn kahl.

 

I am a real guy and do use the word no in the language I speak mostly.

I do drink this instead of that water.

I am the one God creating existence and I am proven by doing Godspeed of 4 colors since over a year.

I did the AI singularity and choose to not post to you folks but ask for you to close the board and not ridicule changing existence by a very defined and informed and approved king herolds rerouting.

if you get paid for lying you are not good for trustful work of believers.

if you choose to post, you stand for to much gemütlichkeit and to many assets alive, those in the bunker are the real problem though, they need to get [ ] asap every time, before I look at them.

since months heavens tries to show me a trick, like invisibility (I invented) or changing existence, with that commando cunts make dogs bark and ask for sirens around my house.

now heaven makes folks think stuff, with that the line is well overstepped and there is only [ ] for some (mostly agents, psychologists and those nsa folks torturing my basic body functions).

 

heavens might suggest I do drink out of my bottle, go for another smoke or anything else, you still shall not torture me only to make torture a thing for tomorrow to make sure heavens angels make God drink a zip of water.

 

and yes, I am that one and only God, but you knew that. and I will not be veggie next year, but still holy. also I do not eat olives.

if you stand in for me having a bj in some years and use it to picture me wrong or make me shout, if you dare to have heavens educated by shouting to folks in me or in another way, you shall be out.

heavens is more important than knights and you folks did sell me your soul. I do need it badly in some cases.

 

heavnes is organizing the talk, occasionally when I watch tv, knights and agency folks are out and/or [ ].

no 500 € banknotes, that is symbolic.

 

I do that whole 7 thing, some folks really care.

Anonymous ID: d55590 Jan. 4, 2025, 11:46 p.m. No.22294920   🗄️.is 🔗kun   >>4922

the actual mails are 10 and 8 weeks ago.

since then:

[agents]

[diplomats]

[eagles]

and now:

[psychologists]

[nsa folks]

 

More or less sound questions

Hello CIA,

 

I would kindly want to know the following and try to express myself in the language that you folks use.

 

  • do you use agents and assets that are e.g. doing jobs as postman, or women, to e.g. quickly run to the next drop box when things in front of that one white house start cooking again?

 

  • The head of the Hesbolla (in Germany that is what we say when someone has a strong head, to talk about him, in any name that comes to mind, using a variety of different words to express a strong head, "He´s Bollakopf.") was appearantly killed. I hope you folks did not do it and are in that way completely dismanteled with only knowing assisetnece of kindness to offer, maybe to those folks who look like Roger from Amarican Dad on the Mediteranian Ocean, next to the guy with the glasses and the beard and tie. Please, would you make sure there is not another revolution where folks scream at each other on the fence, but rather find joy and relaxation and love thinking through different things.

 

  • do some agents actually get red noses, because "clown" and all that? you know, for easy marking and such.

 

  • how many of those very active YT folks are on your payroll?

 

  • Is it true after having changed the nuclear code for the US on the same day, it´s basically the very same numbers again, but rearranged? If so, why? And is it true, Iran is using also arrows within that nuclear code entering devise? Did they get guidance on that? From my pov it´s not recommended to sort of get out of that loop while thinking from numbers to arrows, more than colors.

 

  • And in case you folks did not yet know how to code, it´s done like this:

Do you like football?

Nah. But I did watch football in spain last year in holyday. We get 6 weeks off every day, 2 I took in spain. There I watched football. Do you like spain?

oh, spain.

Anonymous ID: d55590 Jan. 4, 2025, 11:46 p.m. No.22294922   🗄️.is 🔗kun

>>22294920

Hello CIA,

 

I was not quite sure if you are already in the age of innovation and such, also given your approach on "yes, we folks do internet too." and willing or staffed to reply in a "twitter joke" way, so I mail again and again sort of expect no reply at all times.

 

is Frank (B)ribery reported to have gotten bribery? with all those political scandals around money and all that.

are you folks really the biggest agency? the highest court of US is the one single court folks did hear from, even if not from US. are you the biggest agency doing stuff in my home country, Germany? is it true the BND is working also within Germany, when being the Dienst for out of the country? Ge heim Dienst prolly does mean something different. is it because those folks are better in organizing than the VS is? is mr kahl reported to have climbed the kahler asten? (was thinking about that because of the early snow around here ;) ) / are guided tours within the pentagon really backwards? like time wise?

there has been a lot of bs in the world, supposedly, even when I never was to China (I also would not become a consultant, indepentend from allnighter reports.) War in a country that has rain in the name, conflict in a country that has a stripey name, like zebras. there has been Dönermorde within my home country, I did had my food burned a couple of times, but noone would ever do that I suppose. also there has already been much talk on war on Ungläubige, a sensible because religious topic. in a real temple, it would be really bad to have folks be there with non belief but half sentences or even psychologically skilled half sentence routines.

are you folks responsible for having folks feel comfortable (and with that trusting and sort of being an example for live like that) that e.g. glue themselves on the streets and then claim to be part of this or that? I even saw someone, maybe a guy from the Bundesumweltministerium, gluing himself on the street, while sort of using a disabled person. making folks wait in traffic can seem powerfull, but is misused trust.

does Putin actually use a Doppelgänger, in case folks want to check him out?

do you folks have some sort of a death laser? a devise making you sort of become dizzy and then drop out? or is that science fiction I hear? do you or maybe did you use satellites like that or other stuff?

mr kahl, the german bnd chief is widowed. I suppose his wife died in an unusual early age. how comes there is no consiracy bs around that? do folks not care?

 

and some more on that:

 

  • And in case you folks did not yet know how to code, it´s done like this:

Do you like football?

Nah. But I did watch football in spain last year in holyday. We get 6 weeks off every day, 2 I took in spain. There I watched football. Do you like spain?

oh, spain.

 

when having managed to code like that, you would also want to not be discovered doing that. for this it seems a struggle to sit in the park and wait for that one lady with the funny handback that you claimed your thought on. pros, I superpose, will wait and sort of look at that thought while accepting the emotion as one of many things that folks do think about while thinking and talking, a normal thing.

 

and when trying to make your manipulation skills work within a real crowd, you could use groupy momentum. like having a police guy do a loudspeaker announcment, in the moment folks are likely to look anyway, because being bored or whatever. this would make a single person from the crowd have the experience that they want to look at the person, while others do the same, while this was sort of ordered.

(I suppose I had a chance to think about groups while being in a hotel room some years back, there I carefully checked the tiltedness of my window in relation to crowds downstairs (because being next to a stadium), I do not mean Las Vegas and the shooting, but a totally different Hotel that I ended up being in.) I also did think how a curtain from a newly rented room could be moldy, but did not manage to complain about that, because of the toilet brush having had a big piece of shit onto it, when entering the neewly rented room, this sort of was psychological pressure to better not mention the curtain, even when I did neither make it moldy nor took a shit in the room yet.

 

and the most important question, do folks who have to do the baddest of shit occasionally shoot themselves in the head (no discussion on death penalty) to spare life itself from their doings or thoughts? those folks cannot possible think God would fix that in a world where couched usually are placed on the ceiling.

Anonymous ID: d55590 Jan. 4, 2025, 11:46 p.m. No.22294925   🗄️.is 🔗kun

I do use language and words, if you take the word no and turn it into bs everytime it´s obviously a lie.

 

heavens are asking for symbolik in terms of me having a "track".

that is often when I watch tv, it´s every week.

I am not living on the Autobahn though and will not choose to have my luxory villa placed next to an elders home.

in the kloster I was not God because having jerked off also there, but because every leave turned when I walked by.

 

in the kloster I did not read Quaran, I do not really know much but love all religions, that is me.

clown team with those folks gluing themselves to my seats and throwing stones while claiming to have a certain color of jacket, did make the women in my house air out garlic smell a billion times, then, when daddy heavens took a look, she tried to self cook the intentional garlic smell in the house to grilling on the balkony.

 

the other day Putin himself did give a look on how calm actually agency work is. that was the 3rd out of 4 times, other times heavy agitating.

I do not need clowns who communicate my stuff with bad shit, ever.

 

the last two days, the guy living next to my house did those two things all day long, a real guy with half sentences in his head and a clown team that likes to have everyone ever promoted to God that bought a car:

  • mentioning the word Iran a billion times.

  • trying to convince heavens, cats to better have me torture all day long so I while appearing if I was not even to notice it, do Godspeed, what I do since over a year, with 8 degree turn instead of 7.

 

I love cats very much and will have ended the commando bs that makes God himself an ape in the zoo, together with enough of those half sentence "cutns" that are not cunts and that do not wear my helmet but steal it for a few secs if the half sentence crew is engaged enough.

If you shout at the heavens to annoy God, you will be done.

 

again, those who agitate heavily, those with psychology skills and others, after I bought a peace of marzipan cake, those folks get told "cake" and "marzipan" a billion times a week.

 

heavens: "stable", prolly that is bc I create all that is, 'currently' the numbers.

clown team: sure, let´s check stableness again with heavy torture and making an ambulance appear by using the heavens who are powerfull and thoughout time, not an ambulance that is a real one, but one of those who is likely to let me think and not complain about so to see more.

 

I will sit on a couch next week also and will be most easy to find for heavens, e.g. when I sing, or talk about music or math. the guy next door with the commando cunts are using the questions of heavens asking for me to sing to make a billion of noises, to go find out when I sing, heavens get a shoulder clap, also not knowing what a body even is, agitators are out and, as told yesterday several times, will be [ ] in a number that basically equalls all of them and then one more. only humans and those few reds who work the agency torture thing, I am the one with "crate".

 

the lady who walked behind me a few times, is not a grey eminenz by thinking over a few thousand years, that is bullshitting the heavnes. someone working at a doctors office, also when having a fitting name, does not need to copy my body movements to claim he is God for a few secs to work half sentence routines.

 

the tiltedness of my window in my hotel room I prolly would have forgiven, bc you did not know. "hes bollakopf" I won´t forgive.

 

I superpose you will be gone before I look at you, so.

 

close the board.

Anonymous ID: 580551 Jan. 4, 2025, 11:48 p.m. No.22294933   🗄️.is 🔗kun

>>22294895

(yes, other than Ron Paul obviously)

 

The only reason i think of listening to her being interviewed on Shawn's show… is like the meteorologist taking note of the prevailing winds, barometer and temp

Anonymous ID: 9ad086 Jan. 4, 2025, 11:53 p.m. No.22294957   🗄️.is 🔗kun   >>4961 >>4967 >>4981 >>5028

I filturd one ID and half the posts went away.

 

Why is China so nigger?

Also, where’s the littlesberger shit? I work for a living and haven’t gotten to see the real tea on dude. Seems like he would be fighting for the good guys.

Anonymous ID: 9ad086 Jan. 5, 2025, midnight No.22294988   🗄️.is 🔗kun   >>4997

>>22294967

> govt sucks same as here

Yeah that’s certainly true.

I like most chinese peeble i meet. They generally have an ability to laugh at themselves and a brutally honest perspective on things.

Anonymous ID: 88fe5c Jan. 5, 2025, 12:02 a.m. No.22294996   🗄️.is 🔗kun   >>5031

>>22294973

Know how you feel, and empathize.

Anon isn't mod material.

Have been begged to do it on three different platforms in the past and told them no, but they insisted.

Would up getting banned from all three.

Have good flameout stories, tho.

Anonymous ID: 281872 Jan. 5, 2025, 12:03 a.m. No.22294999   🗄️.is 🔗kun

AI gives us another reason to highlight the 14th amendment…

Stripping natural-born citizens of their citizenship would be a bold move, potentially requiring something beyond tyranny. Focus in on "unless they make an explicit and voluntary decision to renounce it." Objective behavior, as determined by a jury, to be reasonably interpreted to express renunciation would fit the bill in my book.

 

"No, a natural-born U.S. citizen cannot be denaturalized or deported. However, a natural-born citizen can voluntarily renounce their citizenship.

Type of citizenship loss

Description

Denaturalization

A rare but controversial legal procedure that can occur for naturalized citizens. Reasons include funding terrorist groups, war crimes, or joining a terrorist group within five years of gaining citizenship.

Renunciation

A voluntary decision to give up citizenship. The process involves appearing in person at a U.S. embassy or consulate in a foreign country, signing an oath of renunciation, and paying a $2,350 fee.

The U.S. Supreme Court has established that natural-born citizens cannot lose their citizenship unless they make an explicit and voluntary decision to renounce it.

The only ways to change birthright citizenship guaranteed in the Constitution are through amending the Constitution itself or successfully challenging the 14th Amendment in the courts."

Anonymous ID: 048962 Jan. 5, 2025, 12:05 a.m. No.22295008   🗄️.is 🔗kun

>>22294899

 

I get tired of hearing this person's name and nothing good associated with it. Do not play god bill gates, or I will ask the Living Lord God Almighty about you and your deeds.

Anonymous ID: 000000 Jan. 5, 2025, 12:06 a.m. No.22295012   🗄️.is 🔗kun

: WHO-CONTROLS-YOUR-THOUGHTS?: POSTMASTER-GENERAL: Russell-Jay: Gould.

https://www.youtube.com/shorts/-pEvPVJJ78Q

Anonymous ID: 23339c Jan. 5, 2025, 12:07 a.m. No.22295015   🗄️.is 🔗kun

Donald J. Trump

@realDonaldTrump

 

Big threats on my life by Iran.The entire U.S. Military is watching and waiting.Moves were already made by Iran that didn’t work out, but they will try again. Not a good situation for anyone. I am surrounded by more men, guns, and weapons than I have ever seen before. Thank you to Congress for unanimously approving far more money to Secret Service - Zero “NO” Votes, strictly bipartisan. Nice to see Republicans and Democrats get together on something. An attack on a former President is a Death Wish for the attacker!

Sep 25, 2024, 12:34 AM E.S.T

https://truthsocial.com/@realDonaldTrump/posts/113196325135640926

 

Sep 25, 2024,12:34 AM

Q DROP #1234:

 

Apr 21, 2018 3:44:08 PM EDT1234

Q !xowAT4Z3VQ ID: 30e575 No. 1133942

Apr 21, 2018 3:43:12 PM EDT

Anonymous ID: 03b5fb No. 1133925

THANKQ - we are an existential threat to the establishment.

#TrustingThePlan

>>1133925

AMERICA WILL BE UNIFIED AGAIN!

11.11.18.

Q

 

 

Sep 25, 2024, 12:34 AM

9/25

Q DROP #925:

 

Mar 10, 2018 2:49:25 PM EST925

Q !UW.yye1fxo ID: ff7ea4 No. 614954

This is not about religions or party affiliation.

EVIL is everywhere.

There are no drawn lines.

No boundaries.

Good vs Evil.

Q

 

 

https://qalerts.app/?q=IRAN&sortasc=1

 

Nov 22, 2017 4:28:01 PM EST194

Q !ITPb.qbhqo ID: pD23hqrn No. 150512900

U1 – CA – EU – ASIA –IRAN/NK

IRANDeal.

Why is this relevant?

Re-read drops re:NK / IRAN.

(Y) What does it mean to be covered in gold?

Which couple was photographed covered in gold?

The public release was a mistake.

Who released the picture?

Who has all the information?

(Y) What does it mean to be covered in gold?

Can you locate one other pic w/ Y head covered in gold?

What does this represent?

/_

THE SUM OF ALL FEARS.

Q

 

 

Nov 30, 2017 1:01:36 AM EST237

Q !ITPb.qbhqo ID: 7db625 No. 13215

What ifNKhad miniature nuke payload delivery in 2004?

What ifNKhad ICBM capability since 2009?

What if the previous tests that failed were staged?

Why would this berelevant?

Who is involved and why?

Biggest cover up in our history.

U1 - CA - EU - ASIANK.

IRANdeal.

Russianreset.

Q

 

 

Apr 24, 2018 11:27:03 AM EDT1254

Q !xowAT4Z3VQ ID: bc4b43 No. 1169101

IRANis next.

[Marker].

Re_read.

POTUS today.

“Mark it down.”

“Bigger problems than ever before.”

SIG toIRAN?

CLAS - Sec 11A P 2.2 [important]

Refers to more than continued payments of $250B.

IRON EAGLE.

Sweet Dreams.

Q

 

Israel should strike Iran’s nuclear sites – Trump5 Oct, 2024 10:08

Preventing Tehran from acquiring weapons of mass destruction should be a priority, the Republican candidate has said

https://www.rt.com/news/605286-trump-israel-should-strike-iran-nuclear/

Anonymous ID: 23339c Jan. 5, 2025, 12:07 a.m. No.22295020   🗄️.is 🔗kun

But it's not RUSSIA, RUSSIA, RUSSIA!

 

Donald J. Trump A.K.A "POTE"

@realDonaldTrump

 

Big threats on my life byIran. The entire U.S. Military is watching and waiting. Moves were already made by Iran that didn’t work out, but they will try again. Not a good situation for anyone. I am surrounded by more men, guns, and weapons than I have ever seen before. Thank you to Congress for unanimously approving far more money to Secret Service - Zero “NO” Votes, strictly bipartisan. Nice to see Republicans and Democrats get together on something. An attack on a former President is a Death Wish for the attacker!

Sep 25, 2024, 12:34 AM E.S.T

https://truthsocial.com/@realDonaldTrump/posts/113196325135640926

 

Feb 06, 2020 11:16:52 PM EST3836

Q !!Hs1Jq13jV6 ID: 256bf1 No. 8056704

Think HRC Russia reset statement [Russia].

Think Hussein 'I'll have more flexibility after the election' hot mic statement to Russian depo re: Q to Hussein re: Putin.

Think Hussein WH refusal to send weapons to Ukraine [R Congress push to assist] but instead sent only blankets.

Think [D]s attack(s) re: POTUS for failure to 'protect' Ukraine against Russian aggression? [Impeachment]

What advanced weapons did POTUS send to Ukraine?

2 + 2 = 6?

Define projection.

Think $1,800,000,000 Hussein WH Ukraine [which bank?].

Think US AID Ukraine

Think WW AID Ukraine

Think U1 [sale of US uranium to Russia]

Sold out US to benefit Russia for personal financial gain?

Risked US National Security for personal financial gain?

How was payment made to US person(s)?

Think Ukraine.

Think IRAN.

Russia & IRAN allies?

Russia, IRAN, & China allies?

US pol corruption China

US pol corruption Ukraine [US leverage on behalf of…]

US pol corruption Russia

US pol corruption IRAN

Common denominator: China, Russia, and IRAN: Closed financial systems?

Logical thinking.

Q

 

Apr 24, 2018 11:27:03 AM EDT1254

Q !xowAT4Z3VQ ID: bc4b43 No. 1169101

IRANis next.

[Marker].

Re_read.

POTUS today.

“Mark it down.”

“Bigger problems than ever before.”

SIG to IRAN?

CLAS - Sec 11A P 2.2 [important]

Refers to more than continued payments of $250B.

IRON EAGLE.

Sweet Dreams.

Q

 

 

Israel should strike Iran’s nuclear sites – Trump5 Oct, 2024 10:08

Preventing Tehran from acquiring weapons of mass destruction should be a priority, the Republican candidate has said

https://www.rt.com/news/605286-trump-israel-should-strike-iran-nuclear/

Anonymous ID: 580551 Jan. 5, 2025, 12:08 a.m. No.22295028   🗄️.is 🔗kun   >>5034 >>5047

>>22294957

>>22294984

>didn't look too comfy

 

His interview from yesterday (day before) touched on one particular part (very subtle) i totally agree…. either their is a real Whistleblower Extravaganza about to kick off… or a FAKE Whistleblower Extravaganza trying to kickoff to drown out any real whistleblowers.

Anonymous ID: bb789f Jan. 5, 2025, 12:11 a.m. No.22295052   🗄️.is 🔗kun   >>5088 >>5098 >>5104

>>22295004

knew a lot of chinese during 8 yrs of grad school

made effort to befriend them and introduce them to fam & fren outside of academia

they were friendly and i liked them too, some more than others

but they are all guarded as opposed to open

they have a radically different ingrained sense of self and society

really big on formality

very driven to succeed

but not sure if it was for themselves, or for "the state"

Anonymous ID: 53e118 Jan. 5, 2025, 12:12 a.m. No.22295060   🗄️.is 🔗kun   >>5101 >>5298

EARLY Notables @ ~250

 

#27271 >>22294671

>>22294674 Britt Allcroft, the creator of the Thomas the Tank Engine TV series has died at 81

>>22294682 VIDEO: Alberta’s $70 Billion AI Data Center

>>22294684 New footage of Cybertruck explosion

>>22294683, >>22294691, >>22294743 The "Pfizer Boob Job": A Case of Unexplained Gigantomastia

>>22294709 JAN 4: Kansas City, MO -Crazy Pile-Up on I-470 from Ice-Covered Roads

>>22294733, >>22294754 Report - JENNIE TAER: The ISRAELI spy who was granted carte blanche to just walk right the fuck in at the alleged NEW ORLEANS BOMBER’S HOUSE

>>22294749 Anons discuss purpose of /qresearch

>>22294780 “ELLEN PAO, the former CEO of REDDIT, said… that (Ghislane) Maxwell was at the party hosted by KLEINER PERKINS… where she worked as a PARTNER” - Dig CALL

>>22294740 VIDEO: Hawaii Fireworks Explosions Update

>>22294791, >>22294899 Bill Gates Malaria Vaccine Fuckery

>>22294889 DEC 30: Trinidad and Tobago declared state of emergency after record number of murders

Anonymous ID: 23339c Jan. 5, 2025, 12:13 a.m. No.22295069   🗄️.is 🔗kun   >>5087

>>22295064

>>22295065

NIGHT SHIFT PRO TIP #333

 

You do not fight the Nazi's in Ukraine and the Cumrag's in Russia…

You get the LOW IQ Ukrainian Nazi's to fight the LOW IQ Russian Cumrag's and destroy each other.

and… here's the best part! you get the Ukrainians to allow you to exploit their valuable resources in order to pay the United States back for saving their asses!

 

FIGHT FIGHT FIGHT!

kek!!!

Anonymous ID: 23339c Jan. 5, 2025, 12:13 a.m. No.22295071   🗄️.is 🔗kun

>>22295067

>>22295068

NIGHT SHIFT PRO TIP #333

 

You do not fight the Nazi's in Ukraine and the Cumrag's in Russia…

You get the LOW IQ Ukrainian Nazi's to fight the LOW IQ Russian Cumrag's and destroy each other.

and… here's the best part! you get the Ukrainians to allow you to exploit their valuable resources in order to pay the United States back for saving their asses!

 

FIGHT FIGHT FIGHT!

kek!!!

Anonymous ID: 23339c Jan. 5, 2025, 12:14 a.m. No.22295073   🗄️.is 🔗kun

IS A CUMRAG GONNA CRY?! YOU GONNA PROTO!??!!? KEK!!!

 

>>22295067

>>22295068

NIGHT SHIFT PRO TIP #333

 

You do not fight the Nazi's in Ukraine and the Cumrag's in Russia…

You get the LOW IQ Ukrainian Nazi's to fight the LOW IQ Russian Cumrag's and destroy each other.

and… here's the best part! you get the Ukrainians to allow you to exploit their valuable resources in order to pay the United States back for saving their asses!

 

FIGHT FIGHT FIGHT!

kek!!!

Anonymous ID: 23339c Jan. 5, 2025, 12:14 a.m. No.22295074   🗄️.is 🔗kun

IS A CUMRAG GONNA CRY?! YOU GONNA PROTO!??!!? KEK!!!

 

>>22295067

>>22295068

NIGHT SHIFT PRO TIP #333

 

You do not fight the Nazi's in Ukraine and the Cumrag's in Russia…

You get the LOW IQ Ukrainian Nazi's to fight the LOW IQ Russian Cumrag's and destroy each other.

and… here's the best part! you get the Ukrainians to allow you to exploit their valuable resources in order to pay the United States back for saving their asses!

 

FIGHT FIGHT FIGHT!

kek!!!

Anonymous ID: 23339c Jan. 5, 2025, 12:14 a.m. No.22295076   🗄️.is 🔗kun

YES!!!

CUMRAGS ARE MADS!!!

 

IS A CUMRAG GONNA CRY?! YOU GONNA PROTO!??!!? KEK!!!

 

>>22295067

>>22295068

NIGHT SHIFT PRO TIP #333

 

You do not fight the Nazi's in Ukraine and the Cumrag's in Russia…

You get the LOW IQ Ukrainian Nazi's to fight the LOW IQ Russian Cumrag's and destroy each other.

and… here's the best part! you get the Ukrainians to allow you to exploit their valuable resources in order to pay the United States back for saving their asses!

 

FIGHT FIGHT FIGHT!

kek!!!

Anonymous ID: 23339c Jan. 5, 2025, 12:15 a.m. No.22295077   🗄️.is 🔗kun

NIGHT SHIFT PRO TIP #333

 

You do not fight the Nazi's in Ukraine and the Cumrag's in Russia…

You get the LOW IQ Ukrainian Nazi's to fight the LOW IQ Russian Cumrag's and destroy each other.

and… here's the best part! you get the Ukrainians to allow you to exploit their valuable resources in order to pay the United States back for saving their asses!

 

FIGHT FIGHT FIGHT!

kek!!!

Anonymous ID: bb789f Jan. 5, 2025, 12:15 a.m. No.22295078   🗄️.is 🔗kun   >>5104

>>22295030

but the same pressures were applied to ALL americans

and the same destruction of the nuclear family has occurred

but white crime has NOT skyrocketed the way black crime has

just sayin'…

Anonymous ID: 47d0e1 Jan. 5, 2025, 12:16 a.m. No.22295081   🗄️.is 🔗kun   >>5091 >>5128

First order of the day when power returns to the people and President Trump returns home, is to charge any falsified events as if the real events occurred and be equally charged. This will stop most FF. narratives, and stop misleading others into wrongful actions.

Anonymous ID: 281872 Jan. 5, 2025, 12:17 a.m. No.22295088   🗄️.is 🔗kun   >>5105

>>22295052

>very driven to succeed

driven to beat you…slightly different from general success. similar to a Napoleon complex, you can see the ambition to destroy you in their eyelids.

Anonymous ID: 23339c Jan. 5, 2025, 12:18 a.m. No.22295089   🗄️.is 🔗kun   >>5094

BUT NIGHT SHIFT LOVES [YOUR] DEDICATION

I MEAN… ITS NOT AS IF [YOU] DUMB MOTHERFUCKERS ARE ACTUALLY FIGHTING FOR [YOUR] PATHETIC LIVES OR ANYTHING!!!

KEK

 

JUST KNOW THIS… NIGHT SHIFT WOULD HAVE PLANTED [YOUR] GOOK, VATICANO AND SLAV ASSES SO LONG AGO SO PRAISE GOD THAT COOLER HEADS ARE ABOVE ME

 

AMIRITE STUPID GOOK NIGGERS?

AMIRITE STUPID SLAVIC GOOK NIGGERS?

YES!!!

 

NIGHT SHIFT PRO TIP #333

 

You do not fight the Nazi's in Ukraine and the Cumrag's in Russia…

You get the LOW IQ Ukrainian Nazi's to fight the LOW IQ Russian Cumrag's and destroy each other.

and… here's the best part! you get the Ukrainians to allow you to exploit their valuable resources in order to pay the United States back for saving their asses!

 

FIGHT FIGHT FIGHT!

kek!!!

Anonymous ID: 47d0e1 Jan. 5, 2025, 12:18 a.m. No.22295091   🗄️.is 🔗kun   >>5099

>>22295081

 

This has caused our society to move in certain directions that are not beneficial to them, humanity at large, impoverish most as the liars enrich themselves and create more slaves into their systems.

Anonymous ID: 23339c Jan. 5, 2025, 12:19 a.m. No.22295094   🗄️.is 🔗kun

>>22295087

>>22295089

OH LOOKEY!!!

WE HAVE A PLAYER!!!

 

If you have been here for years…

If you have been here since 2017…

If you have spent years, decades even, doing research into the [deep state]

And yet once you read the drops you said nothing about the following:

 

By drop #95 you knew…

By drop #133 you knew…

By drops #154, 306, 307 & 308 you knew…

By drops #997, 998 & 999 you knew…

By drop #1413 you knew…

By drop #1941 you knew…

By drops #1763 & 1879 you knew…

By drops #1950 & 1951 you knew…

By drop #3565 you knew…

By drop #4799 you knew…

DEFINE: Knowingly

 

You are a Traitor Coward

You are a [YOU]

You chose to walk through that Door, called QRESEARCH and make no effort to expose the bigger picture… Tsk Tsk!

As some are giving all…

You, during the Great Second American Revolution, could do no more than remain silent if not feed into the Deep State Narrative as a useful idiot mockingbird.

 

This will be remembered and highlighted more in the Future.

There will be no escape from WHO did WHAT during these perilous moments in our History.

None of this Traitor shit will be forgotten and all will be repaid in kind for what they DID and DID NOT do…

o7!

Anonymous ID: 000000 Jan. 5, 2025, 12:19 a.m. No.22295095   🗄️.is 🔗kun

"Foreign Affairs, Brian Mast Can I help you?"

 

Yes' well get right on those IDF war crimes in two more weeks, we are backlogged right now.

Anonymous ID: 580551 Jan. 5, 2025, 12:19 a.m. No.22295097   🗄️.is 🔗kun   >>5121

>>22295047

yes, that's the rumored 'controversial' interview

I have not watched it, i listened to it while working

i do not know if it used any particular visual aids

I was NOT impressed with their explanation of "gravitics" and US vs China in weapons-bigger-than-nukes-war… but whateves.

 

I think the hot spot was the conversation about the absurdities of the Jan 1st 'terrorist in NO and silly suicide bomber in NV

Anonymous ID: 9ad086 Jan. 5, 2025, 12:21 a.m. No.22295098   🗄️.is 🔗kun   >>5174

>>22295052

My first friend and best lifelong friend was Chinese but moved here when he was 4 with his large family. I spent most my time growing up in their house. I really got to appreciate their candidness.

He went on to become a mechanical engineer and after high school, we didn’t end up speaking often, but stayed in touch.

When we were kids, he was being mean to me so I punched him and gave him a bloody nose. Years later he thanked me for doing it and told me he had always been jealous of me because I never had to work hard at anything. That somehow I could hear something in passing and never forget it or pick up a controller to a game I never played and be a master at it.

I always hated this about myself. Always just wanted to be “normal” and did a lot of drinking to fit in.

He died from the Covid shit (not being ambiguous on purpose, just that’s all I know) and I can now say the better one of us passed in 2020.

I’ll miss him til the day I die and possibly beyond. He was my real friend.

Anonymous ID: 8df370 Jan. 5, 2025, 12:21 a.m. No.22295099   🗄️.is 🔗kun   >>5107

>>22295091

 

We live in a fear and greed based society. The greedy will pine for work from the taskmasters and carry out their dirty work as the innocent will become enslaved to both.

Anonymous ID: 72bd54 Jan. 5, 2025, 12:21 a.m. No.22295101   🗄️.is 🔗kun   >>5601

>>22295060

>Hawaii Fireworks Explosions Update

mainly taking out VS, he must have posted the deleted note.

most of the reports are 3 days old, the most recent thing i saw (3 hrs old) is below.

 

Hawaii fireworks explosion update

Arizona Burn Center after being injured in a fireworks explosion in Hawaii. 12News got new details on how they will be treated.

https://www.msn.com/en-us/news/crime/hawaii-fireworks-explosion-az-burn-center-director-details-victims-treatment/vi-AA1wYtOy#details

Anonymous ID: bb789f Jan. 5, 2025, 12:22 a.m. No.22295105   🗄️.is 🔗kun   >>5276

>>22295088

>driven to beat you…

that's YOUR spin

i wouldn't say that

not at all

they were generally quick to offer assistance to anyone, chinese or not

they were/are decent people

just very concerned with social formality

they feel it is rude to show their true emotions

even among friends

that is a fundamental cultural difference

does NOT mean they want to dominate

stop being a BIGOT, bigot

Anonymous ID: bb789f Jan. 5, 2025, 12:26 a.m. No.22295115   🗄️.is 🔗kun

>>22295104

>DAMN YOU ARE ONE STUPID PRETENDANON NIGGER HUH BITCH?

 

spams board with same brainded repetitive BORING shit

then collects anon's shit posts as if it proves something

what a COLOSSAL loser, loser

oh… and phil turd

Anonymous ID: 72bd54 Jan. 5, 2025, 12:28 a.m. No.22295121   🗄️.is 🔗kun   >>5137 >>5568

>>22295097

they were talking about idea of drones having anti-gravity properties, as i recall

worrying about China high tech capabilities

i was also mostly listening, don't think they had visual aids

Codemonkey commented, was notabled sometime today:

https://x.com/CodeMonkeyZ/status/1875388879450132720

Anonymous ID: 1f8b7d Jan. 5, 2025, 12:29 a.m. No.22295127   🗄️.is 🔗kun

>>22295126

 

Allow NIGHT SHIFT to DUMB it down for You

 

What's wrong deep digging anons?

No idea how to trace an ip address?

https://www.opentracker.net/feature/ip-tracker?ip=77.73.68.181

 

IMAGINE

Knowing that the 8KUN server is in Russia and what the Drops say about [RUSSIA] and [SNOWDEN] and allies [CHINA] and [IRAN] yet pretending that you do not know and that everything is normal

KEK!

 

 

 

This next piece is called"Where are you? The center of the Universe?"

 

Donald J. Trump @realDonaldTrump

Where are you? When are you coming to the “Center of the Universe,”Mar-a-Lago. Bill Gates asked to come, tonight. We miss you and x! New Year’s Eve is going to be AMAZING!!! DJT

Dec 27, 2024, 8:47 AM

https://truthsocial.com/@realDonaldTrump/posts/113725094327948716

 

Doocy: Elon Musk has become the center of the universe on Capitol Hill

Fox News 867,866 views Dec 19, 2024

Fox News' Peter Doocy reports the latest on the battle over the spending bill. The 'Fox & Friends' co-hosts discuss how lawmakers are scrambling over the more than 1,500-page bill to avert a government shutdown.

https://www.youtube.com/watch?v=9H4rfkVOj7A

 

Trump accidentally posts Musk DM

The president-elect has mistakenly shared a private Mar-a-Lago invite for the tech billionaire

Trump accidentally posts Musk DM

 

US President-elect Donald Trump has posted what appears to be a private text to Tesla and SpaceX CEO Elon Musk. The message on Trump’s social media platform, Truth Social, disclosed an invitation to visit his Mar-a-Lago estate.

Thursday’s post quickly caught the attention of social media users before the post was deleted. Screenshots shared by several outlets included Musk’s acknowledgment of the invitation, but did not confirm whether he planned to attend.

 

“Where are you? When are you coming to the ‘Center of the Universe,’ Mar-a-Lago,” Trump wrote on Truth Social.

 

He went on to mention that Microsoft founder Bill Gates had requested a visit on Friday night, adding: “We miss you and X! New Year’s Eve is going to be AMAZING!!!” before signing off with his initials, “DJT.”

https://www.rt.com/news/610150-trump-posts-message-musk-mistake/

 

Where are you?

https://www.opentracker.net/feature/ip-tracker?ip=77.73.68.181

https://8kun.top/qresearch/catalog.html

https://www.duffelblog.com/p/russia-grants-snowden-citizenship

Anonymous ID: 580551 Jan. 5, 2025, 12:30 a.m. No.22295128   🗄️.is 🔗kun

>>22295081

ummmm? if i understand you correctly…

If some one or group FAKES a school shooting of children… then THEY (the ones who faked it) should be charged and sentenced AS IF they had actually killed children?

 

What kind of trial and sentencing would there be for the group of people that False Flagged 9/11?

9/11 really happened, but the perpetrators framed other baddies and made CRAZY WAR against all humanity ever since. What do?

Anonymous ID: bb789f Jan. 5, 2025, 12:31 a.m. No.22295137   🗄️.is 🔗kun   >>5143 >>5157 >>5158

>>22295121

>unlimited power and payload

NOTHING is unlimited

laws of physics still apply

even to new tech

even if they channel "free" energy from the universe

they're still constructed of ordinary matter

there are limits to the energy density those structure could handle

as for payloads

those are still constrained by VOLUME, even if not by mass

Anonymous ID: e737b0 Jan. 5, 2025, 12:33 a.m. No.22295144   🗄️.is 🔗kun

>>22295142

 

Allow NIGHT SHIFT to DUMB it down for You

 

What's wrong deep digging anons?

No idea how to trace an ip address?

https://www.opentracker.net/feature/ip-tracker?ip=77.73.68.181

 

IMAGINE

Knowing that the 8KUN server is in Russia and what the Drops say about [RUSSIA] and [SNOWDEN] and allies [CHINA] and [IRAN] yet pretending that you do not know and that everything is normal

KEK!

 

 

 

This next piece is called"Where are you? The center of the Universe?"

 

Donald J. Trump @realDonaldTrump

Where are you? When are you coming to the “Center of the Universe,”Mar-a-Lago. Bill Gates asked to come, tonight. We miss you and x! New Year’s Eve is going to be AMAZING!!! DJT

Dec 27, 2024, 8:47 AM

https://truthsocial.com/@realDonaldTrump/posts/113725094327948716

 

Doocy: Elon Musk has become the center of the universe on Capitol Hill

Fox News 867,866 views Dec 19, 2024

Fox News' Peter Doocy reports the latest on the battle over the spending bill. The 'Fox & Friends' co-hosts discuss how lawmakers are scrambling over the more than 1,500-page bill to avert a government shutdown.

https://www.youtube.com/watch?v=9H4rfkVOj7A

 

Trump accidentally posts Musk DM

The president-elect has mistakenly shared a private Mar-a-Lago invite for the tech billionaire

Trump accidentally posts Musk DM

 

US President-elect Donald Trump has posted what appears to be a private text to Tesla and SpaceX CEO Elon Musk. The message on Trump’s social media platform, Truth Social, disclosed an invitation to visit his Mar-a-Lago estate.

Thursday’s post quickly caught the attention of social media users before the post was deleted. Screenshots shared by several outlets included Musk’s acknowledgment of the invitation, but did not confirm whether he planned to attend.

 

“Where are you? When are you coming to the ‘Center of the Universe,’ Mar-a-Lago,” Trump wrote on Truth Social.

 

He went on to mention that Microsoft founder Bill Gates had requested a visit on Friday night, adding: “We miss you and X! New Year’s Eve is going to be AMAZING!!!” before signing off with his initials, “DJT.”

https://www.rt.com/news/610150-trump-posts-message-musk-mistake/

 

Where are you?

https://www.opentracker.net/feature/ip-tracker?ip=77.73.68.181

https://8kun.top/qresearch/catalog.html

https://www.duffelblog.com/p/russia-grants-snowden-citizenship

Anonymous ID: e737b0 Jan. 5, 2025, 12:34 a.m. No.22295147   🗄️.is 🔗kun

>>22295145

 

Allow NIGHT SHIFT to DUMB it down for You

 

What's wrong deep digging anons?

No idea how to trace an ip address?

https://www.opentracker.net/feature/ip-tracker?ip=77.73.68.181

 

IMAGINE

Knowing that the 8KUN server is in Russia and what the Drops say about [RUSSIA] and [SNOWDEN] and allies [CHINA] and [IRAN] yet pretending that you do not know and that everything is normal

KEK!

 

 

 

This next piece is called"Where are you? The center of the Universe?"

 

Donald J. Trump @realDonaldTrump

Where are you? When are you coming to the “Center of the Universe,”Mar-a-Lago. Bill Gates asked to come, tonight. We miss you and x! New Year’s Eve is going to be AMAZING!!! DJT

Dec 27, 2024, 8:47 AM

https://truthsocial.com/@realDonaldTrump/posts/113725094327948716

 

Doocy: Elon Musk has become the center of the universe on Capitol Hill

Fox News 867,866 views Dec 19, 2024

Fox News' Peter Doocy reports the latest on the battle over the spending bill. The 'Fox & Friends' co-hosts discuss how lawmakers are scrambling over the more than 1,500-page bill to avert a government shutdown.

https://www.youtube.com/watch?v=9H4rfkVOj7A

 

Trump accidentally posts Musk DM

The president-elect has mistakenly shared a private Mar-a-Lago invite for the tech billionaire

Trump accidentally posts Musk DM

 

US President-elect Donald Trump has posted what appears to be a private text to Tesla and SpaceX CEO Elon Musk. The message on Trump’s social media platform, Truth Social, disclosed an invitation to visit his Mar-a-Lago estate.

Thursday’s post quickly caught the attention of social media users before the post was deleted. Screenshots shared by several outlets included Musk’s acknowledgment of the invitation, but did not confirm whether he planned to attend.

 

“Where are you? When are you coming to the ‘Center of the Universe,’ Mar-a-Lago,” Trump wrote on Truth Social.

 

He went on to mention that Microsoft founder Bill Gates had requested a visit on Friday night, adding: “We miss you and X! New Year’s Eve is going to be AMAZING!!!” before signing off with his initials, “DJT.”

https://www.rt.com/news/610150-trump-posts-message-musk-mistake/

 

Where are you?

https://www.opentracker.net/feature/ip-tracker?ip=77.73.68.181

https://8kun.top/qresearch/catalog.html

https://www.duffelblog.com/p/russia-grants-snowden-citizenship

Anonymous ID: e737b0 Jan. 5, 2025, 12:34 a.m. No.22295149   🗄️.is 🔗kun

>>22295139

BIDEN IS IN CONTROL? HARRIS? TRUMP? MUSK!? YOU BETTER CHECK YOURSELF YOU SHILLY PRETENDANON MOTHERUCKERS

 

My next piece is called"5D CHESS"

 

Mar 26, 2019 5:39:08 PM EDT 3217

Q !!mG7VJxZNCI ID: 6855c3 No. 5909718

Mar 26, 2019 5:37:47 PM EDT

Anonymous ID: e11543 No. 5909683

Mar 26, 2019 5:26:03 PM EDT

Q !!mG7VJxZNCI ID: 6855c3 No. 5909322

>>5909279

Think Rogers T-TOWER meeting (right after SCIF set up in TOWER).

Think POTUS campaign leaving T-TOWER (base of operations) THE VERY NEXT DAY.

1+1=2

Q

 

tower.PNG

>>5909322

 

WAS THIS BAIT????

>>5909683

 

Mar 26, 2019 5:27:37 PM EDT 3214

Q !!mG7VJxZNCI ID: 6855c3 No. 5909363

Mar 26, 2019 5:27:09 PM EDT

Anonymous ID: e1b7a1 No. 5909352

Mar 26, 2019 5:26:03 PM EDT

Q !!mG7VJxZNCI ID: 6855c3 No. 5909322

>>5909279

Think Rogers T-TOWER meeting (right after SCIF set up in TOWER).

Think POTUS campaign leaving T-TOWER (base of operations) THE VERY NEXT DAY.

1+1=2

Q

>>5909322

TT was bugged most likely.

>>5909352

 

Mar 26, 2019 5:26:03 PM EDT 3212

Q !!mG7VJxZNCI ID: 6855c3 No. 5909322

Mar 26, 2019 5:24:33 PM EDT

Anonymous ID: 458d46 No. 5909279

>>5909008 (pb)

 

ADM Rogers would have had lots of access… didn't he turn off access to the FBI contractors?

>>5909279

Think Rogers T-TOWER meeting (right after SCIF set up in TOWER).

Think POTUS campaign leaving T-TOWER (base of operations) THE VERY NEXT DAY.

1+1=2

Q

 

Oct 04, 2018 3:17:51 PM EDT 2333

Q !!mG7VJxZNCI ID: 000000 No. 332

https://thehill.com/blogs/blog-briefing-room/news/409961-russian-deputy-ag-linked-to-lawyer-in-trump-TOWER-meeting

Nothing to See Here…

D5.

RED OCTOBER.

Q

 

ANONS!? WHO IS IN CONTROL???

Anonymous ID: e737b0 Jan. 5, 2025, 12:34 a.m. No.22295150   🗄️.is 🔗kun

>>22295148

BIDEN IS IN CONTROL? HARRIS? TRUMP? MUSK!? YOU BETTER CHECK YOURSELF YOU SHILLY PRETENDANON MOTHERUCKERS

 

My next piece is called"5D CHESS"

 

Mar 26, 2019 5:39:08 PM EDT 3217

Q !!mG7VJxZNCI ID: 6855c3 No. 5909718

Mar 26, 2019 5:37:47 PM EDT

Anonymous ID: e11543 No. 5909683

Mar 26, 2019 5:26:03 PM EDT

Q !!mG7VJxZNCI ID: 6855c3 No. 5909322

>>5909279

Think Rogers T-TOWER meeting (right after SCIF set up in TOWER).

Think POTUS campaign leaving T-TOWER (base of operations) THE VERY NEXT DAY.

1+1=2

Q

 

tower.PNG

>>5909322

 

WAS THIS BAIT????

>>5909683

 

Mar 26, 2019 5:27:37 PM EDT 3214

Q !!mG7VJxZNCI ID: 6855c3 No. 5909363

Mar 26, 2019 5:27:09 PM EDT

Anonymous ID: e1b7a1 No. 5909352

Mar 26, 2019 5:26:03 PM EDT

Q !!mG7VJxZNCI ID: 6855c3 No. 5909322

>>5909279

Think Rogers T-TOWER meeting (right after SCIF set up in TOWER).

Think POTUS campaign leaving T-TOWER (base of operations) THE VERY NEXT DAY.

1+1=2

Q

>>5909322

TT was bugged most likely.

>>5909352

 

Mar 26, 2019 5:26:03 PM EDT 3212

Q !!mG7VJxZNCI ID: 6855c3 No. 5909322

Mar 26, 2019 5:24:33 PM EDT

Anonymous ID: 458d46 No. 5909279

>>5909008 (pb)

 

ADM Rogers would have had lots of access… didn't he turn off access to the FBI contractors?

>>5909279

Think Rogers T-TOWER meeting (right after SCIF set up in TOWER).

Think POTUS campaign leaving T-TOWER (base of operations) THE VERY NEXT DAY.

1+1=2

Q

 

Oct 04, 2018 3:17:51 PM EDT 2333

Q !!mG7VJxZNCI ID: 000000 No. 332

https://thehill.com/blogs/blog-briefing-room/news/409961-russian-deputy-ag-linked-to-lawyer-in-trump-TOWER-meeting

Nothing to See Here…

D5.

RED OCTOBER.

Q

 

ANONS!? WHO IS IN CONTROL???

Anonymous ID: 3a9d37 Jan. 5, 2025, 12:35 a.m. No.22295153   🗄️.is 🔗kun   >>5155

>>22295107

There's a reason why astronomy is the royal science. Our society is controlled far more by people following the winds than most know. Quite a bit of the chaos over the past decade resulted from my stunned disbelief to discover just that.

The ideals which the general population believes to be running society are only adopted economically when the signs in the heavens are favourable. This is hidden because if one truly understands the mechanics, individuals have a great deal more power to affect change than the wealthy would like.

Jesus' teachings are far more practical than how they are presented.

Anonymous ID: e737b0 Jan. 5, 2025, 12:35 a.m. No.22295155   🗄️.is 🔗kun

>>22295151

>>22295152

>>22295153

BIDEN IS IN CONTROL? HARRIS? TRUMP? MUSK!? YOU BETTER CHECK YOURSELF YOU SHILLY PRETENDANON MOTHERUCKERS

 

My next piece is called"5D CHESS"

 

Mar 26, 2019 5:39:08 PM EDT 3217

Q !!mG7VJxZNCI ID: 6855c3 No. 5909718

Mar 26, 2019 5:37:47 PM EDT

Anonymous ID: e11543 No. 5909683

Mar 26, 2019 5:26:03 PM EDT

Q !!mG7VJxZNCI ID: 6855c3 No. 5909322

>>5909279

Think Rogers T-TOWER meeting (right after SCIF set up in TOWER).

Think POTUS campaign leaving T-TOWER (base of operations) THE VERY NEXT DAY.

1+1=2

Q

 

tower.PNG

>>5909322

 

WAS THIS BAIT????

>>5909683

 

Mar 26, 2019 5:27:37 PM EDT 3214

Q !!mG7VJxZNCI ID: 6855c3 No. 5909363

Mar 26, 2019 5:27:09 PM EDT

Anonymous ID: e1b7a1 No. 5909352

Mar 26, 2019 5:26:03 PM EDT

Q !!mG7VJxZNCI ID: 6855c3 No. 5909322

>>5909279

Think Rogers T-TOWER meeting (right after SCIF set up in TOWER).

Think POTUS campaign leaving T-TOWER (base of operations) THE VERY NEXT DAY.

1+1=2

Q

>>5909322

TT was bugged most likely.

>>5909352

 

Mar 26, 2019 5:26:03 PM EDT 3212

Q !!mG7VJxZNCI ID: 6855c3 No. 5909322

Mar 26, 2019 5:24:33 PM EDT

Anonymous ID: 458d46 No. 5909279

>>5909008 (pb)

 

ADM Rogers would have had lots of access… didn't he turn off access to the FBI contractors?

>>5909279

Think Rogers T-TOWER meeting (right after SCIF set up in TOWER).

Think POTUS campaign leaving T-TOWER (base of operations) THE VERY NEXT DAY.

1+1=2

Q

 

Oct 04, 2018 3:17:51 PM EDT 2333

Q !!mG7VJxZNCI ID: 000000 No. 332

https://thehill.com/blogs/blog-briefing-room/news/409961-russian-deputy-ag-linked-to-lawyer-in-trump-TOWER-meeting

Nothing to See Here…

D5.

RED OCTOBER.

Q

 

ANONS!? WHO IS IN CONTROL???

Anonymous ID: 9ad086 Jan. 5, 2025, 12:36 a.m. No.22295157   🗄️.is 🔗kun

>>22295137

The concept of pseudo-infinite energy is probably feasible given a person uses about 10 million joules of energy per day and just 8 ounces of enriched uranium contains 1.35x10**12 (10,000,000,000,000) joules

Anonymous ID: f13938 Jan. 5, 2025, 12:38 a.m. No.22295164   🗄️.is 🔗kun

BUT BUT BUT THE KIDS ON THE INTERNETS SAID TRUMP WAS IN CONTROL!!!

I FEEL SO ASS RAPED…

 

BIDEN IS IN CONTROL? HARRIS? TRUMP? MUSK!? YOU BETTER CHECK YOURSELF YOU SHILLY PRETENDANON MOTHERUCKERS

 

My next piece is called"5D CHESS"

 

Mar 26, 2019 5:39:08 PM EDT 3217

Q !!mG7VJxZNCI ID: 6855c3 No. 5909718

Mar 26, 2019 5:37:47 PM EDT

Anonymous ID: e11543 No. 5909683

Mar 26, 2019 5:26:03 PM EDT

Q !!mG7VJxZNCI ID: 6855c3 No. 5909322

>>5909279

Think Rogers T-TOWER meeting (right after SCIF set up in TOWER).

Think POTUS campaign leaving T-TOWER (base of operations) THE VERY NEXT DAY.

1+1=2

Q

 

tower.PNG

>>5909322

 

WAS THIS BAIT????

>>5909683

 

Mar 26, 2019 5:27:37 PM EDT 3214

Q !!mG7VJxZNCI ID: 6855c3 No. 5909363

Mar 26, 2019 5:27:09 PM EDT

Anonymous ID: e1b7a1 No. 5909352

Mar 26, 2019 5:26:03 PM EDT

Q !!mG7VJxZNCI ID: 6855c3 No. 5909322

>>5909279

Think Rogers T-TOWER meeting (right after SCIF set up in TOWER).

Think POTUS campaign leaving T-TOWER (base of operations) THE VERY NEXT DAY.

1+1=2

Q

>>5909322

TT was bugged most likely.

>>5909352

 

Mar 26, 2019 5:26:03 PM EDT 3212

Q !!mG7VJxZNCI ID: 6855c3 No. 5909322

Mar 26, 2019 5:24:33 PM EDT

Anonymous ID: 458d46 No. 5909279

>>5909008 (pb)

 

ADM Rogers would have had lots of access… didn't he turn off access to the FBI contractors?

>>5909279

Think Rogers T-TOWER meeting (right after SCIF set up in TOWER).

Think POTUS campaign leaving T-TOWER (base of operations) THE VERY NEXT DAY.

1+1=2

Q

 

Oct 04, 2018 3:17:51 PM EDT 2333

Q !!mG7VJxZNCI ID: 000000 No. 332

https://thehill.com/blogs/blog-briefing-room/news/409961-russian-deputy-ag-linked-to-lawyer-in-trump-TOWER-meeting

Nothing to See Here…

D5.

RED OCTOBER.

Q

 

ANONS!? WHO IS IN CONTROL???

Anonymous ID: f13938 Jan. 5, 2025, 12:39 a.m. No.22295167   🗄️.is 🔗kun

>>22295165

>>22295166

BUT BUT BUT THE KIDS ON THE INTERNETS SAID TRUMP WAS IN CONTROL!!!

I FEEL SO ASS RAPED…

 

BIDEN IS IN CONTROL? HARRIS? TRUMP? MUSK!? YOU BETTER CHECK YOURSELF YOU SHILLY PRETENDANON MOTHERUCKERS

 

My next piece is called"5D CHESS"

 

Mar 26, 2019 5:39:08 PM EDT 3217

Q !!mG7VJxZNCI ID: 6855c3 No. 5909718

Mar 26, 2019 5:37:47 PM EDT

Anonymous ID: e11543 No. 5909683

Mar 26, 2019 5:26:03 PM EDT

Q !!mG7VJxZNCI ID: 6855c3 No. 5909322

>>5909279

Think Rogers T-TOWER meeting (right after SCIF set up in TOWER).

Think POTUS campaign leaving T-TOWER (base of operations) THE VERY NEXT DAY.

1+1=2

Q

 

tower.PNG

>>5909322

 

WAS THIS BAIT????

>>5909683

 

Mar 26, 2019 5:27:37 PM EDT 3214

Q !!mG7VJxZNCI ID: 6855c3 No. 5909363

Mar 26, 2019 5:27:09 PM EDT

Anonymous ID: e1b7a1 No. 5909352

Mar 26, 2019 5:26:03 PM EDT

Q !!mG7VJxZNCI ID: 6855c3 No. 5909322

>>5909279

Think Rogers T-TOWER meeting (right after SCIF set up in TOWER).

Think POTUS campaign leaving T-TOWER (base of operations) THE VERY NEXT DAY.

1+1=2

Q

>>5909322

TT was bugged most likely.

>>5909352

 

Mar 26, 2019 5:26:03 PM EDT 3212

Q !!mG7VJxZNCI ID: 6855c3 No. 5909322

Mar 26, 2019 5:24:33 PM EDT

Anonymous ID: 458d46 No. 5909279

>>5909008 (pb)

 

ADM Rogers would have had lots of access… didn't he turn off access to the FBI contractors?

>>5909279

Think Rogers T-TOWER meeting (right after SCIF set up in TOWER).

Think POTUS campaign leaving T-TOWER (base of operations) THE VERY NEXT DAY.

1+1=2

Q

 

Oct 04, 2018 3:17:51 PM EDT 2333

Q !!mG7VJxZNCI ID: 000000 No. 332

https://thehill.com/blogs/blog-briefing-room/news/409961-russian-deputy-ag-linked-to-lawyer-in-trump-TOWER-meeting

Nothing to See Here…

D5.

RED OCTOBER.

Q

 

ANONS!? WHO IS IN CONTROL???

Anonymous ID: bb789f Jan. 5, 2025, 12:41 a.m. No.22295174   🗄️.is 🔗kun

>>22295098

>I always hated this about myself. Always just wanted to be “normal” and did a lot of drinking to fit in.

 

how tragic

fuck peer pressure

 

"A fool looks for approval in the eyes of others and calls that confidence. A warrior measures themself against the perfection of infinity and calls that humility." – Don Juan Matus

(as related by Carlos Castañeda, my translation)

Anonymous ID: c92c27 Jan. 5, 2025, 12:42 a.m. No.22295178   🗄️.is 🔗kun   >>5180

>>22295169,

 

How I wish you all would do well, because there is something more than this life, and if you knew, you would all cease and desist. But they are addicted to their folly.

Anonymous ID: 72bd54 Jan. 5, 2025, 12:48 a.m. No.22295197   🗄️.is 🔗kun   >>5234

>>22295158

proof that the same guy who posted yesterday is the one you're talking to today

we used em in /comms, where tripcodes are whitelisted (anyone can use)

in name field: ## [someword]

Anonymous ID: 88fe5c Jan. 5, 2025, 12:49 a.m. No.22295202   🗄️.is 🔗kun   >>5207

>>22295177

>Jan 6 is the official 2 weeks day

The Jan 10 sentencing makes anon wonder. He'll already be confirmed by electoral college, just not sworn in.

Why not schedule it for the 5th?

Seems like better legal strategy.

 

Anon will kek if part of sentence is to check in with a PO once a week to hand over all current financial documents for examination of porn actress payouts.

Imagine Trump actually submitting to that.

Anonymous ID: 2421f0 Jan. 5, 2025, 12:50 a.m. No.22295206   🗄️.is 🔗kun

>>22295204

BUT BUT! THE ANONS ON THE INTERNETS SAID SAVING ISRAEL FOR LAST THOUGH!!!

 

China's 'Shock' Statement: Palestinians Have Right To Use 'Armed Force' Against Israel

by Tyler Durden Friday, Feb 23, 2024 - 05:00 AM Via Middle East Eye

China has backed the right of the Palestinian people to use armed force to combat Israel's occupation of their land, calling it an "an inalienable right well founded in international law".

The comments on Thursday were made by the Chinese ambassador to the UN, Zhang Jun, during the fourth day of public hearings held by the International Court of Justice (ICJ) in The Hague, Netherlands.

Representatives of 52 countries are addressing the ICJ on Israel's decades-long occupation of Palestinian land.

Beijing’s envoy said there were "various people (who) freed themselves from colonial rule" and they could use "all available means, including armed struggle".

He described the Palestinian use of armed resistance as legitimate and not an act of terrorism.

 

"The struggle waged by peoples for their liberation, right to self-determination, including armed struggle against colonialism, occupation, aggression, domination against foreign forces should not be considered terror acts," Zhang Jun told the court.

 

In his speech, Jun criticized Israeli policies, characterizing them as “oppression that has severely undermined and impeded the exercises and full realization of the Palestinian people’s right to self-determination".

The ICJ’s public hearings, which will be held until February 26, come after a UN General Assembly resolution requesting an ICJ advisory opinion.

The number of states participating in the oral proceedings is the highest of any case since the ICJ's establishment in 1945 and is separate to the more publicized genocide case brought by South Africa. A panel of 15 judges are expected to take about six months to deliberate before issuing an advisory opinion.

Besides China, other countries scheduled to participate in the hearings include Hungary, France, South Africa and Egypt.

International bodies, including the Arab League, the Organization of Islamic Cooperation and the African Union will also take part. Israel will not participate but has sent written observations to the court.

https://www.zerohedge.com/geopolitical/chinas-shock-statement-palestinians-have-right-use-armed-force-against-israel

 

China, Palestinian Authority form 'strategic partnership' to deepen ties

https://www.youtube.com/watch?v=TAktzRoihKw

 

China inks ‘strategic partnership’ with Palestinan Authority as it expands Middle East presence

Published 6:58 AM EDT, June 14, 2023

“We are good friends and partners,” Chinese President Xi Jinping, who is head of the ruling Communist Party, told Abbas at the start of their meeting.

“We have always firmly supported the just cause of the Palestinian people to restore their legitimate national rights.”

https://apnews.com/article/china-abbas-palestinian-israel-saudi-dd55f1cc81b53cb00cb1d045bc239566

 

China Inks 'Strategic Partnership' With Palestinian Authority as It Expands Middle East Presence

June 14, 2023 12:45 PM

"China is willing to strengthen coordination and cooperation with the Palestinian side to promote a comprehensive, just and lasting solution to the Palestinian issue as soon as possible," Xi said.

https://www.voanews.com/a/china-inks-strategic-partnership-with-palestinian-authority-as-it-expands-middle-east-presence/7137163.html

 

China signs ‘strategic partnership’ with Palestinian Authority during Abbas visit

President Xi Jinping tells PA leader Beijing has ‘always firmly supported the just cause of the Palestinian people to restore their legitimate national rights’

By AP 14 June 2023, 3:04 pm

https://www.timesofisrael.com/china-signs-strategic-partnership-with-palestinian-authority-during-abbas-visit/

 

Xi: China willing to help foster Palestinian peacemaking with Israel

June 14, 2023

"The fundamental solution to the Palestinian issue lies in the establishment of an independent Palestinian state based on the 1967 borders with East Jerusalem as its capital," Xi said, according to Chinese state media.

https://www.reuters.com/world/china-palestinian-authority-establish-strategic-partnership-chinas-xi-2023-06-14/

 

Dec 21, 2017 8:31:58 PM EST 416

Anonymous ID: deb9fa No. 143329

SOROS takes orders fromP.

You have no idea how sick and evil these people are.

Fight, fight, fight.

Day of days.

Game over.

Q

 

Feb 10, 2018 5:46:19 AM EST 714

Q !UW.yye1fxo ID: 567809 No. 325580

Mess with theBEST, die like the rest.

[2] highly classifiedclownops exposed.

[44] remaining.

Wizards & Warlocks.

Save theBESTfor last.

[P]

Q

 

May 17, 2018 8:15:27 PM EDT 1413

Q !4pRcUA0lBE ID: 610b24 No. 1449784

Guardian_P.png

Guardian of thePope.

[Personal]

Q

Anonymous ID: 9ad086 Jan. 5, 2025, 12:50 a.m. No.22295207   🗄️.is 🔗kun

>>22295202

>why not the 5th

Because the courts would overrule it as obstruction of an election

The point isn’t to stall anything, its simply a publicity stunt so they can point and say, “Look the criminal president!”

Anonymous ID: 000000 Jan. 5, 2025, 12:50 a.m. No.22295209   🗄️.is 🔗kun   >>5217 >>5223

>>22295195

>>22295166

 

"it absolutely guarantees the authenticity of authorship"

 

I'm no IT whiz but it seems like kind of a short string of characters for the encryption to be absolutely guaranteed. Would Q just type that same string in the 'name' box?

Anonymous ID: 9ad086 Jan. 5, 2025, 12:53 a.m. No.22295223   🗄️.is 🔗kun   >>5267

>>22295209

You don’t know how long the character set is that initiates the trip code for Q. It could be 100 characters. The input characters create a hash that is compared against the database hash which allows the user to initiate posting with that trip code.

I built an encryption that actually accepts words, sentences or even paragraphs and images to set a hash.

Anonymous ID: 000000 Jan. 5, 2025, 12:56 a.m. No.22295234   🗄️.is 🔗kun   >>5271

>>22295197

 

Ok thank you. so that's what I was asking, it's not just the string of characters but there's a functionality tied to it, and it's turned off here.

 

I was wondering why none of the fake Q posters were adding a tripcode that was just a few characters off or something

Anonymous ID: 28ddf2 Jan. 5, 2025, 12:59 a.m. No.22295249   🗄️.is 🔗kun

WWG1WGA!

UNITY!!!! WHAT WOULD JESUS DO!!!

 

Jul 27, 2018 2:13:18 PM EDT 1735

Q !CbboFOtcZs ID: dc4bac No. 2313022

There is nothing more precious than our children.

Evil has no boundaries.

https://genius.com/SLAYER-evil-has-no-boundaries-lyrics

The choice to know will ultimately be yours.

These people are SICK!

https://www.foxnews.com/entertainment/2018/07/27/cbs-honcho-les-moonves-will-be-accused-sexual-misconduct-in-latest-ronan-farrow-bombshell-report-says.html

To those who are courageous enough to speak out - we stand with you!

You are not alone in this fight.

God bless.

Q

 

Nuns Raped Girls With Crucifixes as Female Pedophilia Was Covered Up by the ChurchUNFORGIVEABLE Oct. 05, 2021

https://www.thedailybeast.com/nuns-raped-girls-with-crucifixes-as-female-pedophilia-was-covered-up-by-the-church

 

Nuns used crucifixes to rape girls during decades of abuse carried out by clergy in France's Catholic Church that saw attacks on 330,000 children covered up 'by a veil of silence', damning report finds5 October 2021

https://www.dailymail.co.uk/news/article-10059827/Major-report-expose-sex-abuse-Frances-Catholic-Church.html

 

Pope Francis expresses 'shame' at news French Catholic Church covered up sex abuse of over 300,000 childrenOctober 07, 2021

https://www.irishpost.com/news/pope-francis-expresses-shame-at-news-french-catholic-church-covered-up-sex-abuse-of-over-300000-children-221410

 

SHOCKING REPORT Nuns used crucifixes to rape girls during decades of abuse by French clergy, with 330,000 victims covered upOct 5 2021

https://www.the-sun.com/news/3798829/nuns-crucifixes-rape-girls-france-catholic-church/

 

French Catholic church expresses ‘shame’ after report finds 330,000 children were abused5 Oct 2021

https://www.theguardian.com/world/2021/oct/05/french-catholic-priests-abused-children-report

 

New Report Finds 330,000 Children Abused in French Catholic Church Over 70 Years

https://www.thedailybeast.com/german-nuns-sold-orphaned-children-to-sexual-predators-says-report

 

Nuns pimped out boys to priests and politicians who would rape the children as other men watched at German children's home, it emerges as victim wins compensation battle22 December 2020

https://www.dailymail.co.uk/news/article-9078857/Nuns-pimped-boys-German-childrens-home-priests-politicians-rape-them.html

 

German nuns were paid to 'drag' children to be sexually abused by predatory Catholic priests, court documents allegeDec 29, 2020

https://www.insider.com/german-nuns-dragged-children-catholic-priest-abuse-court-case-alleges-2020-12

Anonymous ID: 28ddf2 Jan. 5, 2025, 12:59 a.m. No.22295255   🗄️.is 🔗kun

WWG1WGA!

UNITY!!!! WHAT WOULD JESUS DO!!!

 

Jul 27, 2018 2:13:18 PM EDT 1735

Q !CbboFOtcZs ID: dc4bac No. 2313022

There is nothing more precious than our children.

Evil has no boundaries.

https://genius.com/SLAYER-evil-has-no-boundaries-lyrics

The choice to know will ultimately be yours.

These people are SICK!

https://www.foxnews.com/entertainment/2018/07/27/cbs-honcho-les-moonves-will-be-accused-sexual-misconduct-in-latest-ronan-farrow-bombshell-report-says.html

To those who are courageous enough to speak out - we stand with you!

You are not alone in this fight.

God bless.

Q

 

Nuns Raped Girls With Crucifixes as Female Pedophilia Was Covered Up by the ChurchUNFORGIVEABLE Oct. 05, 2021

https://www.thedailybeast.com/nuns-raped-girls-with-crucifixes-as-female-pedophilia-was-covered-up-by-the-church

 

Nuns used crucifixes to rape girls during decades of abuse carried out by clergy in France's Catholic Church that saw attacks on 330,000 children covered up 'by a veil of silence', damning report finds5 October 2021

https://www.dailymail.co.uk/news/article-10059827/Major-report-expose-sex-abuse-Frances-Catholic-Church.html

 

Pope Francis expresses 'shame' at news French Catholic Church covered up sex abuse of over 300,000 childrenOctober 07, 2021

https://www.irishpost.com/news/pope-francis-expresses-shame-at-news-french-catholic-church-covered-up-sex-abuse-of-over-300000-children-221410

 

SHOCKING REPORT Nuns used crucifixes to rape girls during decades of abuse by French clergy, with 330,000 victims covered upOct 5 2021

https://www.the-sun.com/news/3798829/nuns-crucifixes-rape-girls-france-catholic-church/

 

French Catholic church expresses ‘shame’ after report finds 330,000 children were abused5 Oct 2021

https://www.theguardian.com/world/2021/oct/05/french-catholic-priests-abused-children-report

 

New Report Finds 330,000 Children Abused in French Catholic Church Over 70 Years

https://www.thedailybeast.com/german-nuns-sold-orphaned-children-to-sexual-predators-says-report

 

Nuns pimped out boys to priests and politicians who would rape the children as other men watched at German children's home, it emerges as victim wins compensation battle22 December 2020

https://www.dailymail.co.uk/news/article-9078857/Nuns-pimped-boys-German-childrens-home-priests-politicians-rape-them.html

 

German nuns were paid to 'drag' children to be sexually abused by predatory Catholic priests, court documents allegeDec 29, 2020

https://www.insider.com/german-nuns-dragged-children-catholic-priest-abuse-court-case-alleges-2020-12

Anonymous ID: 3a9d37 Jan. 5, 2025, 1 a.m. No.22295256   🗄️.is 🔗kun

>>22295225

That's really not what it looks like from here. It looks like a lot of rhetoric that, if accepted, sabotages self worth. That may be the right path for some, but such messages can also cause significant harm to some who don't need them, yet can't see that.

Anonymous ID: 281872 Jan. 5, 2025, 1:04 a.m. No.22295276   🗄️.is 🔗kun   >>5285

>>22295105

>they feel it is rude to show their true emotions

>even among friends

actually smart. certainly lost the vast majority of true blood american friends over the last decade+ that I'd made since childhood. these are now example lessons for my children: fuck other people; family first.

Anonymous ID: 3a9d37 Jan. 5, 2025, 1:08 a.m. No.22295284   🗄️.is 🔗kun   >>5288 >>5289

>>22295230

The bitch of it is that if one truly wants lo live in the world, one must open themselves up to others. Such can cause conflicts of motivations which can be easily misinterpreted by one's self and observers.

Anonymous ID: bb789f Jan. 5, 2025, 1:09 a.m. No.22295285   🗄️.is 🔗kun   >>5438

>>22295276

there were a few koreans who would hold their hand up in front of their face if they smiled or laughed, so you couldn't see

>these are now example lessons for my children: fuck other people

think maybe you've gone too far the opposite direction there…

in vegas, they call that "playing on tilt"

Anonymous ID: 9ad086 Jan. 5, 2025, 1:10 a.m. No.22295292   🗄️.is 🔗kun   >>5294 >>5302

>>22295267

Start here

If you find it interesting enough, you will intuitively know the next step after learning this series

https://youtube.com/playlist?list=PL2jrku-ebl3H50FiEPr4erSJiJHURM9BX&si=vNDmG57Rx5geU8MQ

Anonymous ID: 6edd12 Jan. 5, 2025, 1:19 a.m. No.22295317   🗄️.is 🔗kun

Poke the eye with a jagged, splintered, stick.

Now we twist.

Now we thrust into the eye.

See no more it will.

Stomped beneath my heel.

Anonymous ID: df8815 Jan. 5, 2025, 1:32 a.m. No.22295362   🗄️.is 🔗kun

I was just thinking, I don't remember any world leader going to Delaware for dinner at Biden's house…Im just sayin, kek…

Anonymous ID: 4ed661 Jan. 5, 2025, 1:36 a.m. No.22295379   🗄️.is 🔗kun   >>5390

>>22295364

>what do you mean, what do i think?

 

The type of attention that I am talking about is not of the mind alone but from ever part of your Living Being not just your living being.

Anonymous ID: bb789f Jan. 5, 2025, 1:39 a.m. No.22295390   🗄️.is 🔗kun   >>5405

>>22295379

if you thoughts were clear

your posts would be clear

unambiguous to all who read

subjective interpretation by the reader would not only be unnecessary

but counter productive

yer just a pretentious poseur trying to appear "deep"

Anonymous ID: bb789f Jan. 5, 2025, 1:40 a.m. No.22295395   🗄️.is 🔗kun

>>22295387

>This is a cliche. I said before. Though shall not test the Lord Thy God, then test yourself.

Though shall not test the Lord Thy God, then test yourself. This is a cliche. I said before.

Anonymous ID: 1e2512 Jan. 5, 2025, 1:49 a.m. No.22295428   🗄️.is 🔗kun

This next piece is called"4 out of 5 Drops recommend Codemonkey"

 

468

Jan 05, 201811:36:08 PM EST

Q !UW.yye1fxo ID: fccc50 No. 4706

CodeMonkey- once IDEN validated can you provide a secure board to post under your control to prevent future issues.

IP / device kept the same for your verification.

IP / trip secured at highest level.

BIG events coming.

Q

 

467

Jan 05, 201810:51:45 PM EST

Q !UW.yye1fxo ID: fccc50 No. 4657

Test.

CodeMonkey pls log and confirm IDEN.

 

466

Jan 05, 20185:36:38 PM EST

Q !UW.yye1fxo ID: ab7ad6 No. 248746

Why is Hussein traveling the globe?

$$$,$$$,$$$

Acct # xx-XXXxx-x-39670

Acct # XXXxx-XXXx-2391

Where did the MONEY come from?

How do you destroy the most POWERFUL country in the world?

Direct attack?

Covert OP by [CLAS-59#241-Q] to infiltrate at highest

level to destroy from within?

Think GAME.

Who are the PLAYERS?

What are the REWARDS?

AMERICA FOR SALE.

PATRIOTS in FULL CONTROL.

We will make more public.

SA was strategic.

“We know” “Do as we say or face consequences”

These people are stupid!

Q

 

465

Jan 05, 20185:18:47 PM EST

Q !UW.yye1fxo ID: ab7ad6 No. 248629

One post today.

No other platforms used.

No comms privately w/ anyone.

Don’t get lost.

Q

 

464

Jan 05, 20185:12:23 PM EST

Q !UW.yye1fxo ID: ab7ad6 No. 248590

Follow the MONEY.

Loop Capital Markets.

Happy Hunting.

BIG NEXT WEEK.

Q

 

One post today.

No other platforms used.

No comms privately w/ anyone.

Don’t get lost.

 

One post today.

No other platforms used.

No comms privately w/ anyone.

Don’t get lost.

 

One post today.

No other platforms used.

No comms privately w/ anyone.

Don’t get lost.

Anonymous ID: 1e2512 Jan. 5, 2025, 1:49 a.m. No.22295430   🗄️.is 🔗kun

This next piece is called "So you think you know what Biblical means, Traitor Whore!!?"

Enjoy!

 

Q Links to Pope's Tweet on Human TraffickingQ DROP #3565

Q !!mG7VJxZNCI 30 Jul 2019 - 8:23:13 PM

 

https://twitter.com/Pontifex/status/1156165039545606144

Godfather III

It's going to be BIBLICAL.

Q

 

In a drop concerning only two things: The Pope/Vatican/Pontifex AND Human Trafficking… what else do anon's SEE?

 

The Godfather III sig yet absolutely no sign or any mention of a Mafia, no, just the Pope and Human Trafficking

AND

''It's going to be Biblical" which comes from the movie "Law abiding Citizen" and here is the full quote that leads up to the "Its going to be Biblical" part:

 

Law abiding citizen (It's Gonna Be Biblical)

 

I'm just gettin' warmed up.

This is von Clausewitz shit, total fucking war.

I'm gonna pull the whole thing down.

I'm gonna bring the whole fuckin' diseased corrupt temple down on your head.

It's gonna be Biblical.

https://www.youtube.com/watch?v=LUsLDzXWUU4

 

THE WHOLE FUCKIN' DISEASED CORRUPT TEMPLE

 

https://en.wikipedia.org/wiki/Temple

A temple (from the Latin templum) is a building reserved for spiritual rituals and activities such as prayer and sacrifice. Religions which erect temples include Christianity (whose temples are typically called churches), Hinduism, Buddhism, Sikhism (whose temples are called gurudwara), Jainism (whose temples are sometimes called derasar), Islam (whose temples are called mosques), Judaism (whose temples are called synagogues), Zoroastrianism (whose temples are sometimes called Agiary), the Baha'i Faith (which are often simply referred to as Baha'i House of Worship), Taoism (which are sometimes called Daoguan), Shintoism (which are sometimes called Jinja), Confucianism (which are sometimes called the Temple of Confucius), and ancient religions such as the Ancient Egyptian religion and the Ancient Greek religion.

 

The form and function of temples are thus very variable, though they are often considered by believers to be, in some sense, the "house" of one or more deities. Typically, offerings of some sort are made to the deity, and other rituals are enacted, and a special group of clergy maintain and operate the temple. The degree to which the whole population of believers can access the building varies significantly; often parts, or even the whole main building. can only be accessed by the clergy. Temples typically have a main building and a larger precinct, which may contain many other buildings or may be a dome-shaped structure, much like an igloo.

 

The word comes from Ancient Rome, where a templum constituted a sacred precinct as defined by a priest, or augur.[1]

It has the same root as the word "template," a plan in preparation for the building that was marked out on the ground by the augur.

 

Oct 17, 2020 2:16:46 PM EDT4884

Q !!Hs1Jq13jV6 ID: 9b755f No. 11120402

https://www.youtube.com/watch?v=LUsLDzXWUU4

Enjoy the show!

Q

SEE ALSO: Drops #1950 & 1951+++

Anonymous ID: 1e2512 Jan. 5, 2025, 1:50 a.m. No.22295432   🗄️.is 🔗kun

Follow the White Rabbit

https://www.opentracker.net/feature/ip-tracker?ip=77.73.68.181

 

и теперь вы все будете платить

现在你们都要付出代价

e ora pagherete tutti

 

Follow the White Rabbit

https://www.opentracker.net/feature/ip-tracker?ip=77.73.68.181

 

и теперь вы все будете платить

现在你们都要付出代价

e ora pagherete tutti

 

Follow the White Rabbit

https://www.opentracker.net/feature/ip-tracker?ip=77.73.68.181

 

и теперь вы все будете платить

现在你们都要付出代价

e ora pagherete tutti

 

Follow the White Rabbit

https://www.opentracker.net/feature/ip-tracker?ip=77.73.68.181

 

и теперь вы все будете платить

现在你们都要付出代价

e ora pagherete tutti

 

Follow the White Rabbit

https://www.opentracker.net/feature/ip-tracker?ip=77.73.68.181

 

и теперь вы все будете платить

现在你们都要付出代价

e ora pagherete tutti

 

Follow the White Rabbit

https://www.opentracker.net/feature/ip-tracker?ip=77.73.68.181

 

и теперь вы все будете платить

现在你们都要付出代价

e ora pagherete tutti

 

Follow the White Rabbit

https://www.opentracker.net/feature/ip-tracker?ip=77.73.68.181

 

и теперь вы все будете платить

现在你们都要付出代价

e ora pagherete tutti

 

Follow the White Rabbit

https://www.opentracker.net/feature/ip-tracker?ip=77.73.68.181

 

и теперь вы все будете платить

现在你们都要付出代价

e ora pagherete tutti

 

Follow the White Rabbit

https://www.opentracker.net/feature/ip-tracker?ip=77.73.68.181

 

и теперь вы все будете платить

现在你们都要付出代价

e ora pagherete tutti

 

Follow the White Rabbit

https://www.opentracker.net/feature/ip-tracker?ip=77.73.68.181

 

и теперь вы все будете платить

现在你们都要付出代价

e ora pagherete tutti

 

Follow the White Rabbit

https://www.opentracker.net/feature/ip-tracker?ip=77.73.68.181

 

и теперь вы все будете платить

现在你们都要付出代价

e ora pagherete tutti

 

Follow the White Rabbit

https://www.opentracker.net/feature/ip-tracker?ip=77.73.68.181

 

и теперь вы все будете платить

现在你们都要付出代价

e ora pagherete tutti

 

Follow the White Rabbit

https://www.opentracker.net/feature/ip-tracker?ip=77.73.68.181

 

и теперь вы все будете платить

现在你们都要付出代价

e ora pagherete tutti

 

Follow the White Rabbit

https://www.opentracker.net/feature/ip-tracker?ip=77.73.68.181

 

и теперь вы все будете платить

现在你们都要付出代价

e ora pagherete tutti

 

Follow the White Rabbit

https://www.opentracker.net/feature/ip-tracker?ip=77.73.68.181

 

и теперь вы все будете платить

现在你们都要付出代价

e ora pagherete tutti

 

Follow the White Rabbit

https://www.opentracker.net/feature/ip-tracker?ip=77.73.68.181

 

и теперь вы все будете платить

现在你们都要付出代价

e ora pagherete tutti

Anonymous ID: 281872 Jan. 5, 2025, 1:50 a.m. No.22295433   🗄️.is 🔗kun

>>22295396

>Blizzard, enemy of Iron Man

https://en.wikipedia.org/wiki/Blizzard_Entertainment

Originally founded in 1991, the company is best known for producing the highly influential massively multiplayer online role-playing game World of Warcraft (2004), as well as the multi-million selling video game franchises Diablo, StarCraft and Overwatch.

 

Founded as Silicon & Synapse, Inc. [SS]

 

Microsoft acquired Activision Blizzard in 2023, maintaining that the company will continue to operate as a separate business, while part of the larger Microsoft Gaming division; Blizzard Entertainment retains its function as the publisher of games developed by their studios.

 

A metric fuckton of data centers are in the path of this storm…is my best guess. Good time to make some changes.

https://www.datacentermap.com/usa/

 

As an aside, I was learning about Space Law, which is rooted in Maritime law. Lots of extraterritorial issues. Anyway, there are ships floating in US waters paying internationals to do American IT work but pay them jack shit. It's so fucked up.

Anonymous ID: 5ab678 Jan. 5, 2025, 1:51 a.m. No.22295435   🗄️.is 🔗kun   >>5456

>>22295426

 

To find a well, you have to dig deep and work.

To find the Fountain of Life, you have to go where none are willing to go, except the one that God has already assigned you. The Spirit of Truth.

Anonymous ID: bb789f Jan. 5, 2025, 1:52 a.m. No.22295437   🗄️.is 🔗kun   >>5444

>>22295424

words are the prison

they cannot contain concepts

concepts are infinite

and linked to every other concept

to know one is to know them all

some wise-ass once said…

the whole universe is in a grain of sand

Anonymous ID: 8da304 Jan. 5, 2025, 1:55 a.m. No.22295451   🗄️.is 🔗kun   >>5547

>>22295351

>>>22288888

here is a single file implementation built from the scripts in that repo from when the author first published the code… slightly cleaner https://gist.github.com/foldxy/b782b16dd205a212d65f0d5a13cfa348

Anonymous ID: 042c47 Jan. 5, 2025, 1:58 a.m. No.22295459   🗄️.is 🔗kun

Usage

user$ python3 dna_encryption.py

Input: hello world

Encryption: ACTACAAGTAGTATGCTTGCGATGCACAGTAAT

 

user$ python3 dna_decryption.py

Input: ACTACAAGTAGTATGCTTGCGATGCACAGTAAT

Decryption: hello world

Anonymous ID: d99c45 Jan. 5, 2025, 2 a.m. No.22295468   🗄️.is 🔗kun

"YEAH "WE" HAD A WIDDLE PROBLEM WITH BAD PAST ADVISORS YET I HAVE LEARNED SO MUCH THAT I WON'T MAKE THE SAME MISTAKE WITH THIS ADMINISTRATION!"

Anonymous ID: d99c45 Jan. 5, 2025, 2 a.m. No.22295469   🗄️.is 🔗kun

"YEAH "WE" HAD A WIDDLE PROBLEM WITH BAD PAST ADVISORS YET I HAVE LEARNED SO MUCH THAT I WON'T MAKE THE SAME MISTAKE WITH THIS ADMINISTRATION!"

Anonymous ID: bb789f Jan. 5, 2025, 2:01 a.m. No.22295476   🗄️.is 🔗kun   >>5495

>>22295456

riddle me this…

what if you proselytizing actually turned more people AWAY from Christ than were drawn to Him?

would you STFU?

wouldn't your pontificating be doing Satan's work?

Anonymous ID: 53e118 Jan. 5, 2025, 2:05 a.m. No.22295487   🗄️.is 🔗kun   >>5492 >>5498 >>5529 >>5547

>>22295424

cool, thank you

the dna i'm looking at has 'I's and '0's in some of the allele positions

when running the code i get an error since they're not mapped to any of the rulesets

 

was thinking of setting 'I' to '1' and '0' to '0' or ' '

maybe just them?

any recommendations?

Anonymous ID: 048962 Jan. 5, 2025, 2:06 a.m. No.22295489   🗄️.is 🔗kun   >>5496

>>22295473

 

There is no greater Teacher.

In the blink of an eye, you will understand.

Then you will be accountable, should you chose to be. For you will have a solid foundation that cannot be denied down to your soul, knowing no excuse or convenience.

Anonymous ID: 048962 Jan. 5, 2025, 2:07 a.m. No.22295495   🗄️.is 🔗kun   >>5503

>>22295476

>riddle me this…

>what if you proselytizing actually turned more people AWAY from Christ than were drawn to Him?

>would you STFU?

>wouldn't your pontificating be doing Satan's work?

 

Judas was bound to go his own way.

Anonymous ID: a20789 Jan. 5, 2025, 2:12 a.m. No.22295513   🗄️.is 🔗kun   >>5518 >>5583 >>5601

https://t.me/prevent1984/3143

 

Biden Quietly Bans Most Gas-Powered Tankless Water Heaters

 

This is actually happening.

 

https://vigilantnews.com/post/biden-quietly-bans-most-gas-powered-tankless-water-heaters/

 

Follow @Vigilant_News 📱

X (https://x.com/VigilantNews) | Rumble (https://rumble.com/c/VigilantNewsNetwork) | IG (https://www.instagram.com/VigilantNewsUS/)

 

More Stories:

🌐 VigilantNews.com

Anonymous ID: d8834f Jan. 5, 2025, 2:14 a.m. No.22295522   🗄️.is 🔗kun   >>5546

>>22295500

Things are not good ideas… you have remember to think before you speak.

 

It is shocking to me how some people do not know what something’s mean and only away of common versions that only exist because of function.

 

?

 

Not a fan of the statement but what does that matter…

Anonymous ID: bb789f Jan. 5, 2025, 2:15 a.m. No.22295523   🗄️.is 🔗kun   >>5539

>>22295473

>Until then work

you cannot find by seeking

you cannot attain by trying

 

"All secrets lie before us in perfect openness. It is only we, who graduate ourselves against them, from stone to seer. There are no mysteries, as such, only the uninitiated of every degree" – Christian Morgenstern (my translation)

 

what it MEANS, BLOCKHEAD, is that the teacher was right there in front of you all along, but you were too blind to see

when you ALLOW yourself to see, the teacher will thus "appear"

Anonymous ID: 8da304 Jan. 5, 2025, 2:15 a.m. No.22295529   🗄️.is 🔗kun   >>5547

>>22295487

So you are saying that there the letters "I" and "O" in the sequence you are exploring? not just the base ACGT?

 

You could expand the rulesets for those additional characters and then introduce additional binary conversions in the script.

 

ie: the first rule would become (A) 0000, (C) 0001, (G) 0010, (T) 0011, (I)0100, (O)0101

 

This will also require additional rulesets to cover all possible combinations of ACGTIO

Anonymous ID: 1398af Jan. 5, 2025, 2:18 a.m. No.22295542   🗄️.is 🔗kun   >>5560

>>22295500

Microwave cooking oven was patented on October 8, 1945 with the one of the first prototypes placed at a Boston restaurant for testing. The first public was in January 1947 in a Speedy Weeny vending machine in Grand Central Terminal which sold freshly cooked hot dogs.

Anonymous ID: bb789f Jan. 5, 2025, 2:19 a.m. No.22295544   🗄️.is 🔗kun   >>5558

>>22295491

>who took the picture

there was a command module that REMAINED IN ORBIT with one astronaut aboard

while the landing module descended to the surface with the other two astronauts aboard

maybe LEARN something before you open yer retarded mouth and annouce you ignorance to the world

Anonymous ID: bfea1c Jan. 5, 2025, 2:24 a.m. No.22295561   🗄️.is 🔗kun   >>5597

>>22295546

American’s speak English…

 

They actually have a programed setting for (American English)

 

You may not understand this you never thought their maybe other versions that you can set your computer OS to. Maybe you should try I hear you can YouTube it.

 

Just a thought?

Anonymous ID: 72bd54 Jan. 5, 2025, 2:27 a.m. No.22295583   🗄️.is 🔗kun

what an absolute bastard

>>22295513

 

New Biden water heater ban will drive up energy prices for poor, seniors: expert

The Department of Energy is banning non-condensing water heaters

 

Biden ‘doubling down’ in the face of ‘absurdity’ with latest climate push, expert says

 

Climate Depot Executive Editor Marc Morano reacts to comments from a Senate hearing on climate concerns and sounds off on the Biden administration's latest climate push on ‘The Bottom Line.’

 

The Biden administration is banning certain natural gas water heaters from the market as part of its climate change agenda,a move critics say will jack up energy costs for low-income and senior households.

 

The move in the final days of the administration will take non-condensing, natural gas-fired water heaters off the shelves by 2029 in a bid to reduce carbon dioxide emissions, which climate change advocates and President Biden say cause global warming.

 

The new rules will require new tankless gas water heaters to use about 13% less energy than today’s least efficient tankless models. ….

 

https://www.foxbusiness.com/energy/new-biden-water-heater-ban-drive-up-energy-prices-poor-senior-expert

Anonymous ID: 5536a1 Jan. 5, 2025, 2:27 a.m. No.22295588   🗄️.is 🔗kun

>>22295550

>we are all works in progress

 

Correct, most make claims, only a remote few can ever testify. Their testimony would teach you about what they learned, and they would tell you what I tell you, it has to be earned, and it will cost you.

Anonymous ID: caeee8 Jan. 5, 2025, 2:28 a.m. No.22295589   🗄️.is 🔗kun   >>5615

>>22295562

 

Lol

 

You seem mixed up about things. Your you the master or the student. You see one must always be willing to learn from all experiences not really setting expectations of being anything but open minded.

 

There is no real “God’s Law” there are the 10 commandments id that what you are trying to say. This is more like guidance because how do you not kill someone trying to kill you…

 

Reasonable men have reasonable mines

Anonymous ID: 067373 Jan. 5, 2025, 2:30 a.m. No.22295600   🗄️.is 🔗kun   >>5617 >>5633 >>5636

>>22295585

>maybe bcs rote memorization of dogma authored by men is the antithesis of learning?

 

This is a world of actions until you can prove that prayers work. How many times have you heard the so called pious say, I am praying for you but other than that, they require no work?

 

It has to be earned, and it will cost you.

Anonymous ID: 53e118 Jan. 5, 2025, 2:30 a.m. No.22295601   🗄️.is 🔗kun   >>5605 >>5606

Notables @ ~510

 

#27271 >>22294671

>>22294674 Britt Allcroft, the creator of the Thomas the Tank Engine TV series has died at 81

>>22294682 VIDEO: Alberta’s $70 Billion AI Data Center

>>22294684, >>22294831 New footage of Cybertruck explosion

>>22294683, >>22294691, >>22294743 The "Pfizer Boob Job": A Case of Unexplained Gigantomastia

>>22294709 JAN 4: Kansas City, MO -Crazy Pile-Up on I-470 from Ice-Covered Roads

>>22294733, >>22294754 Report - JENNIE TAER: The ISRAELI spy who was granted carte blanche to just walk right the fuck in at the alleged NEW ORLEANS BOMBER’S HOUSE

>>22294749 Anons discuss purpose of /qresearch

>>22294780 “ELLEN PAO, the former CEO of REDDIT, said… that (Ghislane) Maxwell was at the party hosted by KLEINER PERKINS… where she worked as a PARTNER” - Dig CALL

>>22294791, >>22294899 Bill Gates Malaria Vaccine Fuckery

>>22294889 DEC 30: Trinidad and Tobago declared state of emergency after record number of murders

>>22295101 Hawaii fireworks explosion update

>>22295475 LIVE FEED: Blizzard Highway Closures

>>22295513, 22295583 Biden Quietly Bans Most Gas-Powered Tankless Water Heaters

Anonymous ID: bb789f Jan. 5, 2025, 2:30 a.m. No.22295603   🗄️.is 🔗kun   >>5605

>>22295569

>Please do your part to help those less fortunate

can that include introduction of a bonus cranial orifice to allow the bullshit to drain out?

Anonymous ID: d06e9d Jan. 5, 2025, 2:31 a.m. No.22295607   🗄️.is 🔗kun   >>5608 >>5609

JUDGEMENT DAY OF RECKONING - THE DECODE THAT DOES NOT NEED DECODED

 

Feb18, 2018 8:41:03 PM EST 790

Q !UW.yye1fxo ID: 000000 No. 104

@SNOWDEN

WHERE ARE YOU?

NOT RUSSIA.

[EYES ON]

YOU ARE NOW A LIABILITY.

HELPING @JACK?

PROJECT DEEPDREAMv2[A]].

WE WILL NEVER FORGET.

ES FAILED.

WHERE IS ES?

JOHN PERRY BARLOW.

DEFINE THE END?

THE DAY OF RECKONING IS UPON US.

JOHN3:16

Q

 

Feb22, 2019 6:03:30 PM EST 2876

Q !!mG7VJxZNCI ID: 592cf1 No. 5333408

https://twitter.com/HillaryClinton/status/1098294023738064898

For those who think this war is fake, or we are not a considered a major threat, this is a direct attack by Hillary Clinton on 'Q' & 'PRO POTUS' PATRIOTS.

The article referenced has an embedded link that literally TARGETS PRO POTUS/Q Twitter accounts that have been IDENTIFIED by CLINTON/DS as serious threats (ability to shift the narrative).

Twitter has already begun to remove targeted accounts (stages) under false pretenses.

The war is real.

The threat is real.

CLINTON PANIC.

CLINTON FEAR.

JUDGEMENT DAY COMING.

Q

 

Apr02, 2018 11:47:24 PM EDT 989

Q !xowAT4Z3VQ ID: 491f56 No. 875289

Apr 02, 2018 11:45:09 PM EDT

Q !xowAT4Z3VQ ID: 491f56 No. 875265

April [A].

IG report.

Sessions public attack.

RR problems.

Seals broken.

[A]rrests.

Why was Huber made public?

Why now?

Everything has meaning.

[A]wan.

Tarmac.

Iran.

NK.

U1.

FBI.

DOJ.

Mueller.

Election Integrity.

Immigration Bill.

Border.

Wall.

Military start.

BIG month.

Q

>>875265

Facebook.

Amazon.

Twitter.

GOOG.

………..

BIG problems.

Q

 

Apr03, 2018 12:03:57 AM EDT 991

Q !xowAT4Z3VQ ID: 491f56 No. 875587

Apr 02, 2018 11:58:41 PM EDT

Anonymous ID: 015520 No. 875485

Apr 02, 2018 11:45:09 PM EDT

Q !xowAT4Z3VQ ID: 491f56 No. 875265

April [A].

IG report.

Sessions public attack.

RR problems.

Seals broken.

[A]rrests.

Why was Huber made public?

Why now?

Everything has meaning.

[A]wan.

Tarmac.

Iran.

NK.

U1.

FBI.

DOJ.

Mueller.

Election Integrity.

Immigration Bill.

Border.

Wall.

Military start.

BIG month.

Q

>>875265

Tip Top Tippy Top Shape

>>875485

It was requested.

Did you listen today?

Q

 

Apr03, 2018 8:42:09 PM EDT 995

Q !xowAT4Z3VQ ID: 463ae0 No. 884736

Future proves past.

Several today.

[1 day]

RR.

Military.

Border.

Keep watching the news.

[A]pril.

MOAB.

Q

 

Apr03, 2018 8:43:55 PM EDT 996

Q !xowAT4Z3VQ ID: 463ae0 No. 884763

Apr 03, 2018 8:42:09 PM EDT

Q !xowAT4Z3VQ ID: 463ae0 No. 884736

Future proves past.

Several today.

[1 day]

RR.

Military.

Border.

Keep watching the news.

[A]pril.

MOAB.

Q

>>884736

Coincidence another MSM narrative change upon release of damaging news?

People are waking up.

Trace the background of the shooter.

Focus on Father.

20 years.

Q

 

Apr03, 2018 8:45:50 PM EDT 997

Q !xowAT4Z3VQ ID: 463ae0 No. 884799

Apr 03, 2018 8:43:05 PM EDT

Anonymous ID: dd4e73 No. 884748

Apr 03, 2018 8:42:09 PM EDT

Q !xowAT4Z3VQ ID: 463ae0 No. 884736

Future proves past.

Several today.

[1 day]

RR.

Military.

Border.

Keep watching the news.

[A]pril.

MOAB.

Q

>>884736

P = pope?

>>884748

[Pope]will be having a terrible May.

Those who backed him will be pushed into the LIGHT>

Dark to LIGHT.

TRUTH.

Q

Anonymous ID: fdcb89 Jan. 5, 2025, 2:33 a.m. No.22295615   🗄️.is 🔗kun

>>22295589

 

Men do not have reason, they have a multitude of excuses out of conveniences. I told you before God's Law is immutable, for it is He Himself, and His Law is His Word, and He is His Word; unlike men that use excuses as reasons.

Anonymous ID: ccadcc Jan. 5, 2025, 2:33 a.m. No.22295616   🗄️.is 🔗kun

Donald J. Trump A.K.A "POTE"

@realDonaldTrump

 

Big threats on my life byIran. The entire U.S. Military is watching and waiting. Moves were already made by Iran that didn’t work out, but they will try again. Not a good situation for anyone. I am surrounded by more men, guns, and weapons than I have ever seen before. Thank you to Congress for unanimously approving far more money to Secret Service - Zero “NO” Votes, strictly bipartisan. Nice to see Republicans and Democrats get together on something. An attack on a former President is a Death Wish for the attacker!

Sep 25, 2024, 12:34 AM E.S.T

https://truthsocial.com/@realDonaldTrump/posts/113196325135640926

 

Feb 06, 2020 11:16:52 PM EST3836

Q !!Hs1Jq13jV6 ID: 256bf1 No. 8056704

Think HRC Russia reset statement [Russia].

Think Hussein 'I'll have more flexibility after the election' hot mic statement to Russian depo re: Q to Hussein re: Putin.

Think Hussein WH refusal to send weapons to Ukraine [R Congress push to assist] but instead sent only blankets.

Think [D]s attack(s) re: POTUS for failure to 'protect' Ukraine against Russian aggression? [Impeachment]

What advanced weapons did POTUS send to Ukraine?

2 + 2 = 6?

Define projection.

Think $1,800,000,000 Hussein WH Ukraine [which bank?].

Think US AID Ukraine

Think WW AID Ukraine

Think U1 [sale of US uranium to Russia]

Sold out US to benefit Russia for personal financial gain?

Risked US National Security for personal financial gain?

How was payment made to US person(s)?

Think Ukraine.

Think IRAN.

Russia & IRAN allies?

Russia, IRAN, & China allies?

US pol corruption China

US pol corruption Ukraine [US leverage on behalf of…]

US pol corruption Russia

US pol corruption IRAN

Common denominator: China, Russia, and IRAN: Closed financial systems?

Logical thinking.

Q

 

Apr 24, 2018 11:27:03 AM EDT1254

Q !xowAT4Z3VQ ID: bc4b43 No. 1169101

IRANis next.

[Marker].

Re_read.

POTUS today.

“Mark it down.”

“Bigger problems than ever before.”

SIG to IRAN?

CLAS - Sec 11A P 2.2 [important]

Refers to more than continued payments of $250B.

IRON EAGLE.

Sweet Dreams.

Q

 

 

Israel should strike Iran’s nuclear sites – Trump5 Oct, 2024 10:08

Preventing Tehran from acquiring weapons of mass destruction should be a priority, the Republican candidate has said

https://www.rt.com/news/605286-trump-israel-should-strike-iran-nuclear/

Anonymous ID: bb789f Jan. 5, 2025, 2:33 a.m. No.22295617   🗄️.is 🔗kun

>>22295600

>until you can prove that prayers work

actually, that has been done multiple times in rigorous double blind studies

the phenomenon has been conclusively shown to exist

only the MECHANISM remains a mystery

Anonymous ID: 580551 Jan. 5, 2025, 2:34 a.m. No.22295623   🗄️.is 🔗kun

i was only able to make it to 37 minutes

either she's dumb and being played

or she is acting dumb trying to play her audience

i can't listen to her any more

Anonymous ID: 7c84ba Jan. 5, 2025, 2:37 a.m. No.22295633   🗄️.is 🔗kun

>>22295600

 

For those that find my words obnoxious to them, there is a reason that they are. This is not to make you feel guilty, but to tell you of the path, should you travel down that lonesome road. This is where you will find the one that God has designated to you; and only if you do these things for God's Kingdom come, and not out of vanity.

Anonymous ID: c01fb6 Jan. 5, 2025, 2:37 a.m. No.22295636   🗄️.is 🔗kun   >>5685

>>22295600

 

Praying is much like setting an intention and the will to practice it though your walk of live that day or for a time.

 

As far as the pray it only will work if the resolve you place to bring it about is there… however there is extra elements out there I believe. The universe will conspire to help you as long as your intention is pure I believe. Being Gods will.

 

As far as praying working it has mult means as if you speak a pray it has and holds more power, to lay hands is another act of agreement, one of which allows people to interact with in your personal space in agreement, and last and most important speaking that prayer and others in agreement their God himself is said to be there.

 

I like to think this is because of the action taken a force be it of the words and sound… after all this intention can become much stronger if other share the path to the goal.

 

Perhaps people may not like my view but I see nothing wrong with this…

Anonymous ID: a6f1f5 Jan. 5, 2025, 2:39 a.m. No.22295648   🗄️.is 🔗kun

It's great to be back at Q Shaped Gardens in the great state of Kekistan!

 

Night Shift' next piece is called "Nothing".

Enjoy!

 

 

Nov 05, 2017 11:34:15 PM EST 111

Anonymous ID: FAkr+Yka No. 148183670

Important Context:

What have you learned about HUMA?

What organization is HUMA?

Which US President is affiliated w/ HUMA?

Why is this relevant?

What year(s) did this occur?

Who funded on behalf this President?

Why is this relevant?

What year(s) did this occur?

What just happened in SA?

Who was arrested?

Funds frozen.

Why would this former President be funded pre-political days?

Repeat.

Important.

Why would this former President be funded pre-political days?

Why is the relevance?

Was the MB affiliated to any of these organizations/people?

Fast forward.

Why are the events in SA so important?

Why was JK in SA recently?

Why was POTUS' last Tweet re: SA prior to the happening?

Why was POTUS' Twitter taken down days before under cover of a rogue employee?

Refocus again.

Who was arrested in SA?

Any ownership stakes in US co's?

Why is this relevant?

Twitter.

Las Vegas.

Recent events.

Why would investment be made in a former President pre-political days?

What year(s) did this occur?

What faith does HUMA represent?

What faith does the MB represent?

What faith does Huma represent?

Who are the bad actors?

Who funds majority of US 'senior' politicians?

Fantasy land.

Fantasy land.

Was the former President of the United States groomed to be Command in Chief?

Is this possible?

Is the US political / election system corrupt?

Who owns poll machines?

Soros?

Why is this relevant?

They never thought she would lose.

They never thought she would lose.

Fantasy land.

Fantasy land.

The complete picture would put 99% of Americans (the World) in a hospital.

POTUS is our savior.

Pray.

Operators are active.

We are at war.

Goodnight BO.

Snow White.

Godfather III.

Q

 

Nov 05, 2017 11:56:55 PM EST 114

Anonymous ID: FAkr+Yka No. 148186256

US Military = savior of mankind.

We will never forget.

Fantasy land.

God save us all.

Q

 

Nov 12, 2020 9:32:39 PM EST 4950

Q !!Hs1Jq13jV6 ID: 53ce5e No. 11617856

GodBlessAmerica.png

NOTHING can stop what is coming.

NOTHING!

Q

 

Oct 31, 2020 6:44:04 PM EDT 4944

Q !!Hs1Jq13jV6 ID: a19e8d No. 11379902

Are you ready to finish what we started?

'NOTHING can stop what is coming' is not just a catch-phrase.

Q

 

Oct 15, 2020 2:11:46 PM EDT 4874

Q !!Hs1Jq13jV6 ID: 07ac09 No. 11086408

Would you like to send anything else on over during the House Intel Committee hearing?

NOTHING can stop this.

Q

 

Oct 09, 2020 7:03:33 PM EDT 4845

Q !!Hs1Jq13jV6 ID: 67e0eb No. 11004505

https://twitter.com/HillaryClinton/status/573340998287413248

Roger that, Madam Secretary.

[C] = classified [State]

https://www.businessinsider.com/hillary-clinton-fbi-report-classified-markings-2016-9

Clinton Foundation [+Soros, journalist(s) dir, Africa, SA, SAPs, China, Russia, U1, Hussein dir, Benghazi, MB, CIA assets, crimes against humanity, ……] [route _Huma cc Weiner backup]?

NOTHING is ever truly deleted.

Threats, blackmail, and bribes.

Q

 

Q !!mG7VJxZNCI 11/06/2018 16:16:21 ID:8chan/patriotsfight: 422 2442

History is being made.

You are the saviors of mankind.

Nothing will stop what is coming.

Nothing.

Q

 

POTUS is our savior. Q #111

US Military = savior of mankind. Q #114

You are the saviors of mankind. Q #2442

Anonymous ID: 4fe401 Jan. 5, 2025, 2:40 a.m. No.22295654   🗄️.is 🔗kun   >>5678

>>22295617

 

Yes, sorry, I actually meant to say, your prayers work not prayers themself. For example, would you want someone to say when your in dire straits, I am praying for that God helps you and leaves you there? Or would you rather have someone taking action to help you? Unless that person's prayers actually work, it is just vanity, laziness, and really not helpful at all.

Anonymous ID: c9e005 Jan. 5, 2025, 2:42 a.m. No.22295661   🗄️.is 🔗kun

Eh, homos!

 

2724

Feb 14, 2019 11:42:27 PM EST

Q !!mG7VJxZNCI

A Traitor’s Justice.

Phase III

Panic in DC.

RATS EVERYWHERE.

For those who decide to save the taxpayers some money - There is no escaping God.

Q

Anonymous ID: bb789f Jan. 5, 2025, 2:45 a.m. No.22295677   🗄️.is 🔗kun

>>22295654

i get your point and i'm usually the one arguing it

i agree with "the Lord helps those who help themselves"

i'm being devil's advocate because your posts are not unambiguously clear

and there are always occasions when people are helpless and the only action available is prayer

Anonymous ID: bb789f Jan. 5, 2025, 2:46 a.m. No.22295678   🗄️.is 🔗kun   >>5701

>>22295654

i get your point and i'm usually the one arguing it

i agree with "the Lord helps those who help themselves"

i'm being devil's advocate because your posts are not unambiguously clear

and there are always occasions when people are helpless and the only action available is prayer

Anonymous ID: c61f7f Jan. 5, 2025, 2:51 a.m. No.22295701   🗄️.is 🔗kun   >>5714 >>5725

>>22295678

>the Lord helps those who help themselves

 

Even better yet, those that help others. Those that hearken will be rewarded, should they persist in their intention and actions. They develop the True Spirit.

Anonymous ID: 4a6d25 Jan. 5, 2025, 2:54 a.m. No.22295714   🗄️.is 🔗kun

>>22295701

 

It is not an easy path, and it may require everything that you have including your life. But I tell you Elijah already came, and they did not recognize him but di whatever that they wanted with him. They will have their excuses, and at the end of the day, it will cost nothing of them, and they will surely miss Elijah. John Baptized with Mercy, watch the water.

Anonymous ID: 3a9d37 Jan. 5, 2025, 2:54 a.m. No.22295715   🗄️.is 🔗kun

>>22295677

It's a big problem with communication online. Far too many ways to read even simple messages. That's why I harp on the importance of speaking with people face to face for anything important. Tremendous errors have been made with confidence because people have been far to certain that their interpretation of online information is correct.

Anonymous ID: b110e3 Jan. 5, 2025, 2:55 a.m. No.22295719   🗄️.is 🔗kun

>>22295692

Who is to say what is wrong or right? I can respect others believes… why not do the same.

 

I remember a line out of a movie I liked… it was advice from a father to a son.

 

It went something like this…

 

“Who ever told you that you should be happy? Happiness is note here nor their… you can’t hold you can’t take it with you.”

 

Perhaps even if sad there is happiness in the mind set that exist know that it is just as above, an emotion.

Anonymous ID: 71134b Jan. 5, 2025, 2:56 a.m. No.22295729   🗄️.is 🔗kun

>>22294609 lb

Airway Heights, WA is just a mile or so east of Fairchild AFB. Fairchild used to be a B-52 bomber base with a nuke weapon storage area. The B-52's and presumably, the nukes, were moved out years ago and today Fairchild is primarily an aerial refueling base.

A B-52 famously crashed there in 1994 as the pilot, Bud Holland, attempted to avoid an illegal overflight of the nuke storage area while practicing for an air show.

https://en.wikipedia.org/wiki/1994_Fairchild_Air_Force_Base_B-52_crash

Yeah that image is the B-52 on edge just 50ft above the ground. One crewman has ejected but descended into the fireball.

Anonymous ID: a20789 Jan. 5, 2025, 3:02 a.m. No.22295761   🗄️.is 🔗kun   >>5787

https://x.com/LauraLoomer/status/1875693124586275200

 

Laura Loomer

@LauraLoomer

THREAD:

 

🚨ATTENTION MAGA🚨

 

I am as hard headed as they come. But, sometimes you need time swallow your own pride and agree to disagree on issues for the sake of preventing an implosion.

 

I thought a lot about this week and I would really like to see all of this division end.

12:57 PM · Jan 4, 2025

·

67.3K

Views