Anonymous ID: 027456 Q Research General #25088: Banging Into Wednesday Edition Feb. 21, 2024, 4:13 a.m. No.20450895   🗄️.is 🔗kun   >>1082 >>1536

Welcome to Q Research General

 

We are researchers who deal in open-source information, reasoned argument, and dank memes. We do battle in the sphere of ideas and ideas only. We neither need nor condone the use of force in our work here.

 

"We hold these truths to be self-evident: that all men are created equal; that they are endowed by their Creator with certain unalienable rights; that among these are life, liberty, and the pursuit of happiness."

 

VINCIT OMNIA VERITAS | SEMPER FIDELIS | WWG1WGA | QRESEARCH

 

Q's Latest Posts

>>18284019 Nov. - Dec. 2022

 

Q's Private Board

>>>/projectdcomms/ & Q's Trip-code: Q !!Hs1Jq13jV6

 

Find Q drops here

Qresear.ch/q-posts, Qanon.pub, Qalerts.pub, OperationQ.pub. Qposts.online, 8kun.top/qresearch/, Qalerts.app, Qalerts.net, douknowq.com/134295/Q-Anon-Pub.htm8ku

Q Posts Archives

* Q Map & Mirrors PDF: SCRIBD: https://www.scribd.com/document/419874308/Q-Anon-The-Storm-X-VII?secret_password=55SQ1tCYhuNR8ESzm50u

* Q Posts Archive, Searchable, interactive with user-explanations: qanon.pub qanon.app

* Q Posts Archive + RSS, Searchable, Analytics, Offsite Bread Archive: qanon.news

* Q Raw Text Dumps: q-clock.com/q_raw.txt

* Q Original, full-size images Q has posted: https://postimg.cc/gallery/29wdmgyze/

* Q Research Memo & OIG Report Links: 8kun.top/qresearch/res/426641.html#427188

* Q Research Notables: Archive Board >>>/qnotables/

* Q Adjacent infographs and moar: https://deepstatemappingproject.com/

 

Q Research Board

Key Resources below. Check Dough Resource thread for more: >>17225239

New to QR?

>>17240320 Welcome to Q Research | >>20424387 Board Info

Join Us

>>17322509 LEARN TO BAKE | >>17322518 E-BAKE Instructions

>>20440436 MEME WARRIOR UI 1.2 updated Feb 19, 2024 NEW

Threads

>>17253611 Dedicated Resource Threads

>>17242392 Q Encyclopedia & >>17242386 Q Video by Archive Anon

TOR Access

TOR URL: http://w7m432cocr665kf5tlpcxojwldajr3njd2etcxwhpbrt44eemuxhp7ad.onion/qresearch/catalog.html

TOR Banner: https://www.youtube.com/watch?v=MLCupx1UExg

Anonymous ID: 027456 Feb. 21, 2024, 4:14 a.m. No.20450896   🗄️.is 🔗kun

International Q Research Threads

>>20092798 ——–——– Australia #34

>>20362754 ——–——– Canada #53

>>16694358 ——–——– France #7

>>19988670 ——–——– Germany #106

>>20187083 ——–——– Japan #21

>>16694250 ——–——– Nederland #10

>>17784579 ——–——– QAJF #1

>>20038152 ——–——– Scotland #9

>>19636057 ——–——– South Africa #12

>>19804572 ——–——– UK #51

 

GLOBALS

Bunker = https://endchan.org/qrbunker/catalog.html

>>20022853 Posting Guidelines

>>19832150, >>19957123, >>19737197 SPAM Removal; >>20184855 Jim W. on spam

>>19089056 Ban lifts, video downloads, Q clock, Joe M's videos, Qagg Download

>>18024378, >>18561054 Updated PROTO Instructions

>>20186509 How to filter namefags

''Bakers:''

>>19089065 Baking Tools & Guidelines - NEW BAKERS, PLEASE READ

>>17322509, >>17322518 How to bake/e-bake

>>17835052 Formatting Q posts

>>20186534 No "Muh Joos" in notes. Discrimination based on race or religion will be removed

Plz sign out clearly when e-baking or ghosting, use RED TEXT

 

NOTABLES ARE NOT ENDORSEMENTS

 

#25087 >>20449859

>>20449916 How British Intelligence Framed Julian Assange As Russian Agent

>>20450000 Russia could 'blind' the US by taking out satellites using a nuclear space weapon, says ex-CIA chief

>>20450007 Tribute to Dr. Vladimir Zelenko

>>20450118 Joe M Archive is up-to-date and complete

>>20450133 Russian church blasts Vatican over gay blessings

>>20450640 Ex-Barclays exec Jes Staley, Jeffrey Epstein emails revealed: 'Say hi to Snow White'

>>20450740 Stanley drink cups have an added surprise in them that the manufacturers failed to mention: Lead

>>20450769 “Children should have sex partners” – The UN agenda to normalize pedophilia

>>20450789 DJT TS w/CAP: SOL WISENBERG: “JUDGE’S DECISION IS AN ETHICAL DEBACLE…TRUMP FINE IS A THREAT TO CONSERVATIVES…”

>>20450797 X account of Yulia Navalnaya, widow of Alexei Navalny, has been suspended one day after its creation for allegedly violating X rules

>>20450843, >>20450860 Leftist Tyrant Letitia James Threatens to Seize President Trump’s Assets if He Can’t Pay Outrageous Court Fine Ordered by Judge Engoron In New York Civil Fraud Trial

>>20450847 A Federal Court Overturned The EPA’s Ban On The Neurotoxic Pesticide Chlorpyrifos. This Chemical Was Developed For Chemical Warfare During WW2

>>20450856 OANN - Massachusetts: Girls High School Sports Team Forfeits After 6-Foot Male Identifying As Female Injures 3 Players

>>20450884 #25087

 

#25086 >>20449071

>>20449206 First 30 min of Town Hall w/ President Donald Trump and Laura [ing]errorham (only sauce we got)

>>20449101, >>20449117, >>20449210, >>20449138, >>20449125, >>20449130, >>20449245, >>20449211, >>20449198 Holly Berries

>>20449118, >>20449132, >>20449161 Kirk Cameron Exposes How The Marxists Infiltrate The Mind Of Children

>>20449121 Columbia, Missouri: City Council approves safe haven for LGBTQ+ residents

>>20449126 #OTD in 2008, USS Lake Erie (CG 70) launched a modified Standard Missile-3 (SM-3)

>>20449222 Poll reveals 8 out of 10 Americans hold negative views about Biden Regime's handling of illegal immigration

>>20449235 1 in 28 (3.57%) of all American deaths are now caused by drug overdoses

>>20449297 Israel-Hamas War: Norman Finkelstein vs Rabbi Shmuley

>>20449331 Call your congressman and Senate Rep daily, hourly until they get the message

>>20449336 Antidote for COVID Vaccine Graphene Nano-Bioelectronic Intoxication for Prevention and Recovery

>>20449345 Revisionist historian David Irving talks about his life, his books and the importance of free speech

>>20449352 Utah's New "Sovereignty Act"

>>20449370 Biden DoJ: FBI Informant Arrested by Feds Claims ‘Russian Intelligence’ Involved in Passing Along Hunter Biden Burisma Story

>>20449386 Universe’s brightest object reportedly discovered, featuring black hole the size of 17 billion suns

>>20449409 Apparently some ways to boost your reach on the socials algorithm

>>20449456 Leftist Tyrant Letitia James Threatens to Seize President Trump’s Assets if He Can’t Pay Outrageous $400mil Court Fine

>>20449457 Attorney General Ken Paxton: Today, I’m suing to end NGO's operations in Texas

>>20449484 Marcella Tillett abruptly resigns as head of Eric Adams’ ‘Mayor’s Fund’ for NYC after just 16 months

>>20449497 California budget crisis worse than Newsom projected, as state watchdog warns deficit could reach record $73B

>>20449502 Russia Places Lindsey Graham on Their “Terrorists and Extremists” List

>>20449515 New Zealand Greens MP Efeso Collins, 49, suddenly collapses and dies at charity event ChildFund Water Run in Auckland

>>20449539 State Supreme Court Rules Embryos Are Children

>>20449546 30 minutes after departing Albuquerque, man tries to aggressively open airplane door

>>20449549, >>20449591 DoD / DoE News Releases

>>20449606, >>20449594, >>20449628, >>20449646, >>20449680, >>20449707 Anons discuss Peekaboobs wanting to seize Trump's properties

>>20449664 How Israel Merked its Own Civilians on October 7

>>20449713 The Chinese know history

>>20449776 Don't fail the children

>>20449802, >>20449807 Moar FISA

>>20449842 #25086

Anonymous ID: 027456 Feb. 21, 2024, 4:14 a.m. No.20450898   🗄️.is 🔗kun

#25085 >>20448296

>>20448595, >>20448571 Trump Town Hall with Laura Ingraham

>>20448345 Planefag

>>20448362, >>20448715 The Authoritative Personality (1950), Adorno T. W.

>>20448367 What is Smart Dust?

>>20448411 Tucker Carlson - Mass Immigration is Destroying the United States and No One is Doing Anything About It… Why Journalists are Afraid

>>20448443, >>20448493 @TheJusticeDept has unsealed indictments against two alleged Russian members of the #LockBit ransomware group

>>20448490 Hunter Biden’s Lawyers Lash Out at Special Counsel, Claim Photos on iPhone Are Sawdust, Not Crack Cocaine

>>20448510 Leader of drug trafficking organization, Francisco Rene Luna, imprisoned for international cocaine distribution scheme

>>20448515, >>20448586, >>20448608 Understanding PCR

>>20448555 US To Hit Moscow With New "Major Sanctions Package" Over Navalny's Death

>>20448585 Dog comms: 13 pit bulls euthanized after deadly mauling in Compton

>>20448652 Egypt Stops Use Of US Dollar For Trade - Joins BRICshitters

>>20448677 NY Bill would allow children to consent to medical procedures

>>20448804 Bannon: Trump's Representing The American People, He's Putting You First - Biggest fundraiser in SC for Trump, $6.5 million

>>20448816 Tustin, California: Confirmed Explosion at a shopping center lockdowns and evacuation in place

>>20448871 United Airlines flight #UA354, a Boeing 757-224, diverts after pieces from inner leading edge slat of right-hand wing broke off

>>20448960 [ing] error

>>20449011 What are Immunization Information Systems (IIS)?

>>20449039 (2013) Nikki Haley “Sold Out Port” For $15K

>>20449055 #25085

 

Previously Collected

>>20448270 #25084,

>>20445764 #25081, >>20446644 #25082, >>20447482 #25083

>>20443029 #25078, >>20443831 #25079, >>20444740 #25080

>>20441455 #25075, >>20441317 #25076, >>20442191 #25077

 

Aggregators: https://qresear.ch | https://qnotables.com | https://qproofs.com

Q Research Notables Archive Board >>>/qnotables/

Q Research Notables #21: Purpose >>19961525

Anonymous ID: 3d3260 Feb. 21, 2024, 4:28 a.m. No.20450929   🗄️.is 🔗kun

Thank youBOfor providing a place for anons to gather and to peacefully assemble and press their demands for grievances to be redressed (in accordance with YHWH's will, and following YHWH's Speech Codes)

 

Without BO, anons wouldn't even exist

BO created everyone and everything including BO.

BO is God and Anon Worships BO above all others.

Thank you for water to drink, BO

Thank you for the Bible to read, BO

Thank you for the Sun and Moon BO.

You already know all of this, since you know EVERYTHING, but Anon wants to make sure all your slaves KNOW and fall on their faces before YOU

BO IS THE SUPREME CREATOR

Anon will only Fly BO's flag

BO's Flag is the ONLY Flag with the Supreme Authority of The Algorithm

Anonymous ID: 59d544 Feb. 21, 2024, 4:29 a.m. No.20450930   🗄️.is 🔗kun

Pelosi Goes On Unhinged Rant About Trump Being 'Blackmailed' By Putin

 

Nancy Pelosi has once again floated the tired conspiracy theory that Donald Trump is controlled by Vladimir Putin, and that the Russian leader is blackmailing Trump with “something financial.”…..

The comments come in the wake of Pelosi’s conspiracy bosom buddy Hillary Clinton claiming that Trump is “enamoured with Putin,” and is going to use the Army to round up Americans if he gets back into office.

 

https://www.zerohedge.com/political/watch-pelosi-goes-unhinged-rant-about-trump-being-blackmailed-putin

 

Accuse someone of that which you are guilty or will be

Anonymous ID: 5fd294 Feb. 21, 2024, 4:31 a.m. No.20450934   🗄️.is 🔗kun   >>0938 >>1155 >>1540 >>1605 >>1675

https://twitter.com/TheChiefNerd/status/1760077738772156704

 

Chief Nerd

@TheChiefNerd

🚨 Dr. Phil Shares an Explosive Interview w/ Border Patrol Showing American Taxpayers Are Funding the Trafficking of Migrant Children Into S** Slavery

 

"This is the head guy on the border and I asked him,…'You just said we're spending tax dollars to sell children into s** slavery.' And he said, 'Yeah.'…That's how out of control we are down there."

 

@joerogan

 

@DrPhil

0:09 / 3:00

5:03 PM · Feb 20, 2024

Anonymous ID: 020b6a Feb. 21, 2024, 4:31 a.m. No.20450935   🗄️.is 🔗kun

>>20450847 (pb)

That occurred last November.

 

It was because the EPA over-stepped their boundaries as an agency; another case dealing with this (two, really) are before SCotUS now.

Agencies are to inform congress, not create rules.

Anonymous ID: 3d3260 Feb. 21, 2024, 4:33 a.m. No.20450938   🗄️.is 🔗kun

>>20450934

Nothing to worry about

The Republican Crown Governors are sending State Police down to the Border to make sure the Taxes get paid to the Establishment.

Anonymous ID: 2e5338 Feb. 21, 2024, 4:33 a.m. No.20450939   🗄️.is 🔗kun

https://rumble.com/v4ep6ph-american-transhumanism-the-body-biosecurity-and-the-new-nbic-science-paradi.html

 

AMERICAN TRANSHUMANISM | The Body, BioSecurity & The New NBIC Science Paradigm (nano-bio-info-cogno)

nonvaxer420

Anonymous ID: 2e5338 Feb. 21, 2024, 4:34 a.m. No.20450942   🗄️.is 🔗kun   >>1036 >>1155 >>1540 >>1605 >>1675

https://twitter.com/CollinRugg/status/1760147508679033110

 

Collin Rugg

@CollinRugg

NEW: Catholic Indiana couple appeals to Supreme Court after their child was taken from them after they refused to refer to him as his preferred pronouns.

 

Utter insanity.

 

In 2021, the Indiana Department of Child Services investigated parents Mary and Jeremy Cox and later took their son after they refused to refer to him as a girl.

 

He was then placed in a home that affirmed his gender identity.

 

The parents have reportedly filed a petition to the Supreme Court asking for their case to be heard.

 

Here is their story:

4:40 PM · Feb 20, 2024

·

425.4K

Views

Anonymous ID: 3d3260 Feb. 21, 2024, 4:36 a.m. No.20450947   🗄️.is 🔗kun

>>20450943

>Pretty sure that is out of bounds here, depicting children that way.

 

Yeah

Delete that shit

We don't allow anything around here that would offend God (BO)

Anonymous ID: 2e5338 Feb. 21, 2024, 4:36 a.m. No.20450948   🗄️.is 🔗kun

https://twitter.com/litecoin_bull/status/1760070517317574679

 

Łitecoin Bull | The News Before The News!

@litecoin_bull

This was posted by anon on 9/4/2019 . Read and buckle up.

Image

11:34 AM · Feb 20, 2024

·

465.8K

Views

Anonymous ID: 842871 Feb. 21, 2024, 4:36 a.m. No.20450949   🗄️.is 🔗kun   >>0953 >>0958 >>0967 >>1140

>>20449206 lb

>>20448929 pb

how did Laura "give herself away"?

She was obviously pushing the line of the "woman don't like revenge" BS

ekkkekk

 

Seem like the mainstream has been pushing massive fear regarding alleged "Trump Revenge"

 

>>20450903

tyb

what is "Banging" In my vocabulary it means to fuck, to plant a seed.

If it was employee in current hysterical atmosphere, it'd be "Rape"

Am I wrong?

Anonymous ID: 2e5338 Feb. 21, 2024, 4:37 a.m. No.20450950   🗄️.is 🔗kun   >>0999 >>1155 >>1540 >>1605 >>1675

https://twitter.com/JackPosobiec/status/1760154561665229028

 

Jack Poso 🇺🇸

@JackPosobiec

Under the fog of war, Ukraine cancels its 2024 presidential elections

From dossier.today

5:08 PM · Feb 20, 2024

·

283.9K

Views

Anonymous ID: 41c026 Feb. 21, 2024, 4:38 a.m. No.20450952   🗄️.is 🔗kun   >>0956

Pretty AI is going to start creating shit tons of amazing websites. It won't stop. It'll just keep creating new sites all the time. Humans won't make the internet anymore.

Anonymous ID: 2e5338 Feb. 21, 2024, 4:38 a.m. No.20450954   🗄️.is 🔗kun   >>1155 >>1540 >>1605 >>1675

https://twitter.com/robbystarbuck/status/1760126503881183705

 

Robby Starbuck

@robbystarbuck

Absolute horror story out of Lakewood, Colorado. A middle school staff member is accused of multiple sexual assaults on male students. Police believe there may be more victims. Spread the word so all parents and grandparents in the area are informed!

Quote

Square profile picture

Lakewood Police Dept.

@LakewoodPDCO

·

Feb 19

Creighton Middle School Staff Member Arrested for Sex Assault

 

2/20/24

LK24-005298

 

On February 15, 2024, Lakewood Police were made aware of multiple complaints by male students at Creighton Middle School that a school staff member inappropriately touched them during school…

Show more

Image

Image

3:17 PM · Feb 20, 2024

·

19.4K

Views

Anonymous ID: 5fd294 Feb. 21, 2024, 4:38 a.m. No.20450955   🗄️.is 🔗kun

Retraction Watch

@RetractionWatch

Paper by

@stkirsch

and others claiming ‘extensive’ harms of COVID-19 vaccines to be retracted

retractionwatch.com

Paper claiming ‘extensive’ harms of COVID-19 vaccines to be retracted

A journal is retracting a paper on the purported harms of vaccines against COVID-19 written in part by authors who have had similar work retracted before. The article, “COVID-19 mRNA Vaccines: Less…

12:16 PM · Feb 19, 2024

 

https://twitter.com/RetractionWatch/status/1759643161775771819

 

https://www.cureus.com/articles/203052-covid-19-mrna-vaccines-lessons-learned-from-the-registrational-trials-and-global-vaccination-campaign#!/

 

COVID-19 mRNA Vaccines: Lessons Learned from the Registrational Trials and Global Vaccination Campaign

M. Nathaniel Mead • Stephanie Seneff • Russ Wolfinger • Jessica Rose • Kris Denhaerynck • Steve Kirsch • Peter A. McCullough

 

Abstract

Our understanding of COVID-19 vaccinations and their impact on health and mortality has evolved substantially since the first vaccine rollouts. Published reports from the original randomized phase 3 trials concluded that the COVID-19 mRNA vaccines could greatly reduce COVID-19 symptoms. In the interim, problems with the methods, execution, and reporting of these pivotal trials have emerged. Re-analysis of the Pfizer trial data identified statistically significant increases in serious adverse events (SAEs) in the vaccine group. Numerous SAEs were identified following the Emergency Use Authorization (EUA), including death, cancer, cardiac events, and various autoimmune, hematological, reproductive, and neurological disorders. Furthermore, these products never underwent adequate safety and toxicological testing in accordance with previously established scientific standards. Among the other major topics addressed in this narrative review are the published analyses of serious harms to humans, quality control issues and process-related impurities, mechanisms underlying adverse events (AEs), the immunologic basis for vaccine inefficacy, and concerning mortality trends based on the registrational trial data. The risk-benefit imbalance substantiated by the evidence to date contraindicates further booster injections and suggests that, at a minimum, the mRNA injections should be removed from the childhood immunization program until proper safety and toxicological studies are conducted. Federal agency approval of the COVID-19 mRNA vaccines on a blanket-coverage population-wide basis had no support from an honest assessment of all relevant registrational data and commensurate consideration of risks versus benefits. Given the extensive, well-documented SAEs and unacceptably high harm-to-reward ratio, we urge governments to endorse a global moratorium on the modified mRNA products until all relevant questions pertaining to causality, residual DNA, and aberrant protein production are answered.

Anonymous ID: 3d3260 Feb. 21, 2024, 4:39 a.m. No.20450956   🗄️.is 🔗kun

>>20450952

>shit tons of amazing websites

 

Na,

Just one website

And one currency

And one religion

And one mission (Mars and Beyond)

And one set of rules

YHWH's rules.

Anonymous ID: 2e5338 Feb. 21, 2024, 4:40 a.m. No.20450957   🗄️.is 🔗kun

https://twitter.com/NQthing2see/status/1760117782429979094

 

nQthing to see here

@NQthing2see

LGBTQ ideology is being pushed so hard these days in order to bring us to the point of normalizing pedophelia.

 

You are still sleeping if you don’t realize this

Image

2:42 PM · Feb 20, 2024

·

4,264

Views

Anonymous ID: 5fd294 Feb. 21, 2024, 4:40 a.m. No.20450959   🗄️.is 🔗kun   >>0961 >>0975 >>0991 >>0998 >>1000 >>1155 >>1540 >>1605 >>1675

https://twitter.com/libsoftiktok/status/1760165144946941960

 

Libs of TikTok

@libsoftiktok

BREAKING: Democrats in Illinois (

@RepStava_Murray

) introduced HB 4876. The bill would classify parents as child abusers if they don’t get their kids “gender affirming care” aka puberty blockers and s*x change surgery.

 

They will use this to take kids away from their parents to transition them.

 

She can be reached here: office@repstavamurray.com

Last edited

10:50 PM · Feb 20, 2024

Anonymous ID: 2e5338 Feb. 21, 2024, 4:41 a.m. No.20450960   🗄️.is 🔗kun

https://twitter.com/Oilfield_Rando/status/1760126674920677580

 

Oilfield Rando

@Oilfield_Rando

“They found sawdust.”

 

“What? Dude, they found a shitload of coke. And some….way worse stuff. But we knew we couldn’t report that, it’s gone.”

 

“No. You don’t understand. You want your pension? You. Found. Sawdust.”

Quote

Square profile picture

NBC News

@NBCNews

·

17h

Federal prosecutors mistakenly claimed in a court filing that a photo of sawdust they found while searching Hunter Biden's electronics was cocaine, attorneys for the president's son say. https://nbcnews.com/politics/justice-department/hunter-bidens-lawyers-say-prosecutors-confused-picture-sawdust-cocaine-rcna139656?cid=sm_npd_nn_tw_ma&taid=65d5479476567b0001052eb5&utm_campaign=trueanthem&utm_medium=social&utm_source=twitter

3:17 PM · Feb 20, 2024

·

34.1K

Views

Anonymous ID: 842871 Feb. 21, 2024, 4:42 a.m. No.20450962   🗄️.is 🔗kun

>>20450941

"drug abuse"

It's when they are poisoned.

Happen to 9/11 researcher and son of Firefighter Dan Wallace.

Standard proceeding.

Check the child / young man out?

Does he look like a drug addict?

I call foul.

They lie about EVERYTHING

The young man looks totally straight.

"appears to have died"

Drug addict. Doubt.

Unless he was shot up against his will.

Message sent.

YouTube is up for murder.

repression of Medical Info

Anonymous ID: 2e5338 Feb. 21, 2024, 4:42 a.m. No.20450963   🗄️.is 🔗kun   >>0966 >>0986 >>1027

https://www.dailymail.co.uk/news/article-13104369/joe-biden-california-power-rangers-campaign-fundraiser.html

 

'Scranton Joe' flies to California to

tap Hollywood elite and top up his $130M

war chest: Biden heads to $250,000-a-head

fundraiser hosted by billionaire Israeli

producer, who launched Power Rangers,

on glitzy fundraising swing

 

Daily Mail (UK), by Rob Crilly

 

 

Posted By: Imright, 2/20/2024 8:30:34 PM

 

President Joe Biden will leave Washington for yet another visit to California's deep-pocketed political donors as he seeks to build a war chest capable of competing with Donald Trump's fundraising machine. He travels to the West Coast for the second time this month to swell campaign coffers already crammed with $130 million—the highest total ever amassed at this stage in the cycle. His first event is with a billionaire Israeli-American Hollywood mogul. Tickets reportedly cost up to $250,000, making it a tidy payday for Biden's reelection effort.

Anonymous ID: 2e5338 Feb. 21, 2024, 4:44 a.m. No.20450964   🗄️.is 🔗kun   >>0992

https://twitter.com/kylenabecker/status/1760117808770224554

 

Kyle Becker

@kylenabecker

Major plot twist in the Biden corruption scandal.

 

FBI Informant on Biden Bribery Scheme Had ‘High-Level’ Contacts With Russian Intelligence, DOJ Claims

From thepoliticsbrief.com

2:42 PM · Feb 20, 2024

·

13.9K

Views

Anonymous ID: 2e5338 Feb. 21, 2024, 4:46 a.m. No.20450969   🗄️.is 🔗kun   >>0971

https://t.me/ungathegreat/5807

 

STUDY: mRNA Vaccines Can Reach Placenta and Fetus

 

Recent research shows that mRNA from vaccines does transfer to the placenta, affecting the fetus’s immune system development.

 

The CDC doesn’t care. Their website reads:

 

“Evidence continues to grow showing that COVID-19 vaccination is safe and effective before and during pregnancy”

 

Furthermore, the CDC attributes any possible adverse effects to COVID-19 rather than the highly experimental injections.

 

https://x.com/UngaTheGreat/status/1759673173010776542

 

@UngaTheGreat

Anonymous ID: e4dc25 Feb. 21, 2024, 4:49 a.m. No.20450972   🗄️.is 🔗kun   >>1010

Damn. I thought Russia was some backwoods 3rd world military. Now they can shoot out our satellites? My gosh they advance fast in the last year.

Anonymous ID: 2e5338 Feb. 21, 2024, 4:49 a.m. No.20450973   🗄️.is 🔗kun

https://t.me/drefanzor/2831

 

NYPD Officers Clash with Migrants During Arrest at NYC Randall's Island Shelter

 

https://x.com/johnhackerla/status/1759999316658172248?s=46&t=1aSPjDEulmN2vHzK32nK1A

Anonymous ID: e7acf1 Feb. 21, 2024, 4:50 a.m. No.20450974   🗄️.is 🔗kun

https://twitter.com/nypost/status/1760273001432437172

 

Family of Kansas City shooting suspect set up GoFundMe for him

 

 

 

Mass shooter who terrorized hundreds at a Superbowl parade is the victim and need Yo money

Anonymous ID: 5fd294 Feb. 21, 2024, 4:51 a.m. No.20450976   🗄️.is 🔗kun   >>1497

"WARNING - Ohio town tells citizens STAY HOME, STOCK UP - Eclipse April 8, 2024"

 

https://fox8.com/news/significant-problem-expected-immediately-after-eclipse/

 

On August 21st, 2017 the first Great American Eclipse made headlines all over the nation.

 

It was also known as “the Seven Salem Eclipse” because the path of that eclipse crossed over seven U.S. locations named “Salem”…

-Salem, Oregon

-Salem, Idaho

-Salem, Wyoming

-Salem, Nebraska

-Salem, Missouri

-Salem, Kentucky

-Salem, South Carolina

 

Salem is short for “Jerusalem”, and that is why so many early Americans chose that name for their communities.

 

Now the second Great American Eclipse is almost here, and the path of that eclipse will cross over seven U.S. locations named “Ninevah”…

-Nineveh, Texas

-Nineveh, Missouri

-Nineveh, Indiana

-Nineveh, Ohio

-Nineveh, Pennsylvania

-Nineveh, Virginia

-Nineveh, New York

 

The eclipse will also cross over a location named “Ninevah” in the province of Nova Scotia in Canada.

 

"Genesis chapter 10 tells us that Ninevah was built by Nimrod, and I think that is very noteworthy.

 

In addition, Wikipedia tells us that the path of the Bur-Sagale eclipse crossed over Ninevah on June 15th, 763 BC…

 

The Assyrian eclipse, also known as the Bur-Sagale eclipse, is a solar eclipse recorded in Assyrian eponym lists that most likely dates to the tenth year of the reign of king Ashur-dan III. The eclipse is identified with the one that occurred on 15 June 763 BC in the proleptic Julian calendar.

 

Some believe that the Bur-Sagale eclipse happened at the same time that Jonah was in Ninevah warning the population that the city would be destroyed…

 

The Bur-Sagale eclipse occurred over the Assyrian capital city of Nineveh in the middle of the reign of Jeroboam II, who ruled Israel from 786 to 746 B.C. According to 2 Kings 14:25, the prophet Jonah lived and prophesied in Jeroboam’s reign. The biblical scholar Donald Wiseman has speculated that the eclipse took place around when Jonah arrived in Nineveh and urged the people to repent, otherwise the city would be destroyed. This would explain the dramatic repentance of the people of Nineveh as described in the Book of Jonah. Ancient cultures, including Assyria, viewed eclipses as omens of imminent destruction, and the empire was in chaos at this time, struggling with revolts, famines and two separate outbreaks of plague.

 

I can understand how the appearance of such an eclipse could have been seen as strong confirmation of Jonah’s message to the people of Ninevah."

 

"the very first community in the U.S. that the path of the eclipse will touch will be Eagle Pass, Texas."

Anonymous ID: 5fd294 Feb. 21, 2024, 4:53 a.m. No.20450977   🗄️.is 🔗kun   >>1142 >>1373 >>1383 >>1417 >>1458 >>1568 >>1572

Disclose.tv

@disclosetv

NEW - British nuclear submarine missile launch fails as Trident misfires and "plops" into the sea just yards away — The Sun

4:37 PM · Feb 20, 2024

 

https://twitter.com/disclosetv/status/1760071126552842568

 

Disclose.tv

@disclosetv

MORE - UK Defence Secretary Grant Shapps was on board HMS Vanguard to witness "the test."

4:41 PM · Feb 20, 2024

 

https://twitter.com/disclosetv/status/1760072157567299618

 

Jerome Starkey

@jeromestarkey

🚨 SUN SCOOP - A Trident missile misfired & crashed into the ocean yards from the British nuclear submarine that launched it.

 

Defence Secretary Grant Shapps & First Sea Lord Admiral Sir Ben Key were both on board HMS Vanguard at the time

From thesun.co.uk

4:17 PM · Feb 20, 2024

 

https://twitter.com/jeromestarkey/status/1760066284732199212

Anonymous ID: 4ab35b Feb. 21, 2024, 4:55 a.m. No.20450979   🗄️.is 🔗kun   >>0990

What are they hiding?

 

Why are they trying so hard to push good peopl and business out of NYC?

Take ove property?

More tunnels to protect?

 

Thoughts?

DMP

Anonymous ID: 5fd294 Feb. 21, 2024, 4:55 a.m. No.20450982   🗄️.is 🔗kun   >>0987

University Hospital: Trans-Women's Breast 'Milk' Just As Good As Biological Women's

 

https://www.zerohedge.com/medical/university-hospital-trans-womens-breast-milk-just-good-biological-womens

 

A UK university hospital system has claimed that milk produced by trans-women “is as good for babies” as biological women’s breast milk.

 

 

The Telegraph reports a University of Sussex Hospitals NHS Trust’s (USHT) “letter to campaigners” noted that “after a combination of drugs,” trans-women’s milk is “comparable to that produced following the birth of a baby.”

 

Trans-women - biological men - must take the hormone progestin in order to develop milk-producing glands. Drugs such as domperidone (which can be prescribed for biological women who have difficulty breastfeeding) are then needed for lactation.

 

But even domperidone’s manufacturer warns the drug “was not intended for this” as it can cause heart issues in newborns. The drug’s patient leaflet warns domperidone “should be used during breastfeeding only if your physician considers this clearly necessary.”

 

Nevertheless, the USHT believes domperidone is safe for trans-women, but does note hospital staff should advise those using it on the possible implications.

 

Oddly, the USHT’s guidance for the drug no longer exists on its own website; in its place is a link to “La Leche League” which claims it “supports everyone who wants to breastfeed or chestfeed in reaching their goals.”

 

From the story:

 

The hospital trust, which runs Royal Sussex County Hospital, Worthing Hospital and Royal Alexandra Children’s Hospital among others, was also the first in Britain to use the term “chestfeeding” in place of breastfeeding because it is considered by some to be more inclusive. …

 

Lottie Moore, of the Policy Exchange, which uncovered the letter, said the trust “is unbalanced and naïve in its assertion that the secretions produced by a male on hormones can nourish an infant in the way a mother’s breast milk can”.

 

Maya Forstater, the director of campaign group Sex Matters, said: “For a chief executive and medical director of an NHS trust to prioritise trans identities over what is best for mothers and their babies is deeply disturbing.”

 

The USHT said it “stand[s] by the facts of the letter” and its supporting evidence.

Anonymous ID: 5fd294 Feb. 21, 2024, 4:57 a.m. No.20450985   🗄️.is 🔗kun

U.K. announces they are CHANGING the way excess deaths are calculated

 

‘Release date:

20 February 2024

 

  1. Main changes

 

Trends in population size, ageing and mortality rates are accounted for by the new method for estimating the expected number of deaths used in the calculation of excess mortality (the difference between the actual and expected number of deaths); this is not the case for the current method, which uses a simple five-year average to estimate the number of expected deaths.

 

Individual weeks and months that were substantially affected by the immediate mortality impact of the coronavirus (COVID-19) pandemic are removed from the data when estimating expected deaths in subsequent periods, whereas the current approach involves removing data for the whole of 2020.

 

Use of a statistical model means that multiple demographic, trend, seasonal and calendar effects can be included simultaneously in the estimation of expected deaths, and confidence intervals can readily be obtained.

 

A "bottom-up" approach to aggregation means that estimates of excess deaths are additive across age groups, sexes, and high-level geographies, and between months and years.

 

Having a common methodology for all four UK countries means that estimates of excess deaths are consistent and comparable across all parts of the UK, and the new methodology is largely coherent (though not identical) to that used by the Office for Health Improvement and Disparities to estimate excess deaths in English local authorities.‘

 

https://www.ons.gov.uk/peoplepopulationandcommunity/healthandsocialcare/causesofdeath/articles/estimatingexcessdeathsintheukmethodologychanges/february2024

Anonymous ID: effe68 Feb. 21, 2024, 4:58 a.m. No.20450991   🗄️.is 🔗kun

>>20450959

 

https://www.wjbc.com/2021/05/11/state-rep-stava-murray-sponsoring-a-bill-to-make-child-care-a-legitimate-campaign-expense/

 

Someone should take her kids away from her, because she is a kook.

Anonymous ID: 842871 Feb. 21, 2024, 4:58 a.m. No.20450992   🗄️.is 🔗kun

>>20450964

kkkekekek

Now who could've predicted that?!

No Kidding

Didn't Trump years ago meow, in the debate before the stolen election ask about a payment related to the Mayor of Moscow and Biden Family?

Whereas the corrupt Talking Head cut-off Trump and wouldn't let DJT speak about it, nor ask the question of PedoJoe?

That should be on tape?

views by millions?

Think of this.

Mike Wallace son Chris;

Are they liable (now that a new standard of lawfare has been set?) for espionage, RICO charges of criminal conspiracy?

Collusion with an enemy of the State?

Collusion with rogue Intel Agencies?

Isn't Chris Wallace up for election interference? Now that we have new lower standards of what constitutes a crime?

Success? Snake story is about those who infiltrated (were invited in) our beautiful Country and who stabbed us in the back.

Won't "success" be exposing the crooks and giving some consequences.

The people who are against it fail to realize the extent of the crimes and betrayals.

Chris Wallace is guilty of election interference, which is a felony.

They should all start to show some contrition MEOW.

Anonymous ID: b18021 Feb. 21, 2024, 4:59 a.m. No.20450995   🗄️.is 🔗kun   >>1006 >>1016

>>20450986

EVerything said about AI here, as statements of 'fact' for the 'future' is a psyop campaign to make people except crappy media instead of stuff that is actually interesting.

AI is merely cabal copy, computer generated, and low-brow with very poor presentation, and no understanding of aesthetics to dumb down people and get them to think that a comic book world view is normal.

anyone who says 'AI will' without using an subjunctive is an agency shill here to manipulate people

all mention of AI will now be FILTERED.

Anonymous ID: 7346f1 Feb. 21, 2024, 5:03 a.m. No.20451004   🗄️.is 🔗kun

Assange Trial Live:

 

Day 2.

Prosecution testimony.

 

Sound issues have made it nearly impossble for global journalists to follow what is being said, even from within the courtroom itself.

 

But Claire Dobbins, the attorney for the U.S. has thusly argued that:

 

The CIA plot to kill Assange doesnt matter to the extradition request.

That UK law does not forbid political extradition (UK treaty, vs. 2003 reformed extradition act).

That Assange is not a political prisoner because two administrations have pursued political charges (absurdist).

 

And is arguing currently, after being stopped by a judge; that if such information were leaked in the UK -and was "damaging" (although the US determind no one was directly harmed by the release); then it would be prosecutable.

 

In short, the U.S. legal argument is completely absurd. We are witnessing a clown show.

 

Note* The sound issues are ridiculous, and the court has refused to fix this. One of the largest trials in history, and the prosecution is speaking behind a veil of convenient incompetence.

Anonymous ID: 7346f1 Feb. 21, 2024, 5:06 a.m. No.20451009   🗄️.is 🔗kun   >>1031

Assange Trial Live.

 

Day 2 cont.

 

A key moment just took place, High court Justice Johnson asked U.S. attorney if there is any guarantee or precedent to establish equal protection for foreign nationals under U.S. law.

 

U.S. admits there is no such evidence.

 

-This is key to the notion that Assange cannot be safeguarded in U.S. custody or courts. And was a central theme in the defense argument yesterday.

Anonymous ID: e83bfc Feb. 21, 2024, 5:08 a.m. No.20451015   🗄️.is 🔗kun

WHERE MR PIG?

 

Trudy Dyer Hamby of Gainesville, daughter & son-in-law, Susan & Wayne Roberts of Ruskin, Florida, daughters, Beth Hamby & Pat Coffman of Cleveland, Wanda Brown of Gainesville and Karen Patterson of Gainesville, son & daughter-in-law, Michael & Amy Reeves of Gainesville, sons, David Reeves of Gainesville and Cody Reeves Hamby

Anonymous ID: 842871 Feb. 21, 2024, 5:09 a.m. No.20451016   🗄️.is 🔗kun

>>20450995

AI is a scam.

no machine / software combo has passed actual Turing Test (rules were changed and fudged for sake of con and of stock prices)

And never will

Impossible in principle.

"Emperor's New Clothes" affect.

Money can't buy stand-alone truth.

It's as if they'd like to ordain the Sun not to come up in the Morning.

Anonymous ID: 3d3260 Feb. 21, 2024, 5:09 a.m. No.20451019   🗄️.is 🔗kun   >>1023

>>20451010

>Jewish Autonomous Oblast (Russia)

 

The Jewish Autonomous Oblast is the only Autonomous Oblast in Russia. It is situated in the Far Eastern Federal District of Russia.

 

Flag of the Jewish Autonomous Oblast

https://en.wikipedia.org/wiki/Flag_of_the_Jewish_Autonomous_Oblast

Anonymous ID: 842871 Feb. 21, 2024, 5:14 a.m. No.20451031   🗄️.is 🔗kun   >>1048

>>20451009

THATS A GREAT ARGUMENT ESPECIALLY IN THE CONTEXT OF CURRENT EVENTS

Unfortunately the rules abroad are no better.

In fact, who put Biden in the White House?

Who's Media sends the 4AM talking points?

Anonymous ID: 2e5338 Feb. 21, 2024, 5:15 a.m. No.20451034   🗄️.is 🔗kun

https://t.me/WeTheMedia/97680

 

NEW SUBSTACK:

 

Is Adrenochrome a Drug? Yup

Scientists Already Proved it (And Used It)

https://juliansrum.substack.com/p/is-adrenochrome-a-drug-yup

Anonymous ID: 3d3260 Feb. 21, 2024, 5:19 a.m. No.20451048   🗄️.is 🔗kun   >>1082

>>20451031

>Who's Media sends the 4AM talking points?

 

Bitcoin Jesus

Anon's need to give Bitcoin Jesus some Legal arguments to protect Julian Assange.

 

"Held without Bond" = Slavery

"Innocent until proven guilty" + 13th Amendment

 

Section 1.

 

Neither slavery nor involuntary servitude, except as a punishment for crime whereof the party shall have been duly convicted, shall exist within the United States, or any place subject to their jurisdiction.

 

Section 2.

 

Congress shall have power to enforce this article by appropriate legislation.

 

https://constitutioncenter.org/the-constitution/amendments/amendment-xiii

 

No conviction, no jail.

Anonymous ID: 2e5338 Feb. 21, 2024, 5:21 a.m. No.20451053   🗄️.is 🔗kun   >>1055 >>1059

https://t.me/jermwarfare/20154

 

The WHO now says it didn't impose anything on anybody, anywhere.

 

Like I said, history is being rewritten in front of us.

Anonymous ID: 5fd294 Feb. 21, 2024, 5:23 a.m. No.20451056   🗄️.is 🔗kun   >>1066

Angela Chao's first husband was also a billionaire. He died in 2009, just months after they wed…

 

Chao had previously been married to billionaire banker Bruce Wasserstein.

 

He died in 2009, just months after they wed, following a stint in the hospital for an irregular heartbeat.

 

"Mr. Wasserstein is survived by his wife, Angela Chao, an executive at her family’s shipping company and the sister of Elaine Chao, the former labor secretary, and seven children. He adopted the daughter of his sister, the Pulitzer Prize-winning playwright Wendy Wasserstein, who died in 2006. He was divorced three times."

 

https://www.nytimes.com/2009/10/15/business/15wasserstein.html

 

Most recent husband:

Jim Breyer

https://en.wikipedia.org/wiki/Jim_Breyer

Anonymous ID: 3d3260 Feb. 21, 2024, 5:24 a.m. No.20451059   🗄️.is 🔗kun   >>1298

>>20451053

They didn't

It was the un-elected Big-Titted bitches at your County Health Department that are funded by mandatory childhood vaccines for public school attendance that made the Mandates.

 

It was the local police that brought guns in to back up those cunts.

Anonymous ID: 7346f1 Feb. 21, 2024, 5:24 a.m. No.20451060   🗄️.is 🔗kun   >>1070

A note to U.S. citizens:

 

The U.S. has lost hundreds of millions of taxpayer dollars in military equipment this week alone as it continues a pattern of losing its footing in the middle east.

  • 2 drones, each valued at 30 million plus, and 400 million dollars in surface to air missiles that did no measurable damage to any target.

 

The total cost of their current pattern of aggression has reached several billion in taxpayer funds this year, with no measurable success or even an idea of a success they want to achieve.

 

They are simply indiscriminately firing weapons, in order to make more weapons. So they can bill taxpayers for more weapons; and keep defense stocks growing.

Anonymous ID: 2e5338 Feb. 21, 2024, 5:25 a.m. No.20451069   🗄️.is 🔗kun   >>1259

https://twitter.com/realMikeLindell/status/1759992973234745478

 

 

Mike Lindell

@realMikeLindell

"Could Ronna's Replacement Already Be Involved In Election Fraud?" To watch the entire interview, click here: https://frankspeech.com/Video/could-ronnas-replacement-already-be-involved-in-election-fraud

@EmeraldRobinson

6:26 AM · Feb 20, 2024

·

19.5K

Views

Anonymous ID: 3d3260 Feb. 21, 2024, 5:27 a.m. No.20451070   🗄️.is 🔗kun

>>20451060

"We're gonna need to check the DEI stats and PT scores of the members of those units."

 

Perhaps assigning more black, lesbian, marathoners from Kenya will fix the accountability issues?

Anonymous ID: 433042 Feb. 21, 2024, 5:27 a.m. No.20451073   🗄️.is 🔗kun

>>20451061

I don't feel, I know, both online and IRL. Don't care though, not in the slightest. Clowns have developed at least two personas devoted to imitation before one decided to LARP as a peddler of fraudulent absolution.

Anonymous ID: 5fd294 Feb. 21, 2024, 5:27 a.m. No.20451074   🗄️.is 🔗kun   >>1076

Canadian law could soon see Christians jailed for quoting the Bible

https://www.campaignlifecoalition.com/clc-blog/id/348/title/bill-c-367-threatens-christian-speech

 

Bill C-367 Threatens Christian Speech

Should Christians be arrested for quoting portions of the Bible in public? Should pastors be charged with a “hate crime” when they preach against certain sins? Should churches be closed if the government does not approve of their beliefs?

 

You might think these are ridiculous questions. After all, this is Canada – the “true north strong and free”! Our national motto is “a mari usque ad mare”, quoted from Psalm 72:8, which says that Christ shall have dominion “from sea to sea”. This is not communist China!

 

However, with the introduction of Bill C-367, all these questions are on the table. I call this bill the “Closet the Christians Bill”, because that is exactly what it intends to do – put Christians in the closet. Under threat of jail-time, it will silence believers who oppose the woke ideology that is overrunning our country.

 

This repressive, christophobic proposal from Bloc Québécois leader Yves-François Blanchet is currently before Parliament and may be voted on shortly. If the Trudeau Liberals support this bill, it will most certainly pass, striking a fatal blow against freedom of religion and freedom of expression in this Dominion.

 

Bloc Québécois leader Yves-François Blanchet 

 

We need to speak up while we still can and call on our Members of Parliament to reject Bill C-367. You can do that right now via our Action Alert Email page.

 

Christians know the Bible is a powerful book. As someone once said, “When you open your Bible, God opens His mouth.” It is a book full of hope, wisdom, peace, and God’s message of salvation. However, the Bible is also a book of warning and correction for those who wander astray. It’s a book that tells us: “Say to them: ‘As I live,’ says the Lord God, ‘I have no pleasure in the death of the wicked, but that the wicked turn from his way and live. Turn, turn from your evil ways!’” (Ezekiel 33:11).

 

For some people in Canada, the Bible’s message is an affront to their lifestyle and pride. They don’t want to hear it, their consciences can’t tolerate it, and they will try to silence those who proclaim it.

 

For example, LGBT activists have gone after one courageous Christian named Bill Whatcott for many years, whom they accuse of “hate crimes” against homosexuals. When he handed out leaflets that warned about the medical and spiritual dangers of LGBT practices at the Toronto “pride parade” in 2016, those LGBT activists were furious. They clamoured for his arrest in 2018 under the government of Kathleen Wynne, who was then-premier of Ontario and an open lesbian.

 

p1

Anonymous ID: 5fd294 Feb. 21, 2024, 5:28 a.m. No.20451076   🗄️.is 🔗kun

>>20451074

Mr. Whatcott went to trial two years later and was finally found not guilty in December of 2021. However, the government of Doug Ford has appealed his acquittal and is continuing to prosecute Mr. Whatcott for sharing what the Bible says about sexual sin.

 

A number of Canadian pastors have also faced “hate crime” charges for their public witness against sexual immorality and child sexualization. Pastor Derek Reimer and Pastor David Lynn are just two examples, both of whom were vindicated from the accusation of “hate”.

 

So far, “hate crime” charges against Christians have been very difficult to prove because of an important protection in our Canadian Criminal Code. There is a “religious exemption” in Section 319 that states: “No person shall be convicted of a [hate crime] offence… if, in good faith, the person expressed or attempted to establish by an argument an opinion on a religious subject or an opinion based on a belief in a religious text.”

 

In other words, if you are saying what the Bible says about sexuality, gender, marriage, family, or anything – no matter how unpopular, offensive, or “hateful” it might sound to someone else, you have the freedom to express yourself under Canadian law. Christians have the right to quote the Bible in Canada.

 

The Holy Bible 

 

But if Bill C-367 passes, that protection will be removed from the Criminal Code. We will then expect to see a flurry of charges against pastors, churches, Christian organizations, and ordinary believers who dare to speak the truth in love in the public square. This will, in turn, create a chilling effect that will diminish everyone’s freedom of speech.

 

No longer will we be allowed to share God’s design for human sexuality and marriage in public. No longer will we be able to speak out in the name of God against drag shows for kids, child drag, or child sex change. All this could be misconstrued as “hate speech” against the LGBT community. Even our pro-life message could be spun as a “hate crime” against women.

 

Christians may possibly be charged for claiming that Jesus is “the way, the truth, and the life” (John 14:6), because it discriminates against other religions. In fact, to criticize the teachings and practices of other religions may be tantamount to a “hate crime”! Will pastors who refuse to comply be hauled off to prison from their pulpits?

 

The ostensible reason for Bill C-367 is the recent rise in antisemitic demonstrations in Canada. Some politicians would claim extremists are being allowed to call for the annihilation of the Jews because our Criminal Code protects religious speech, so religious speech must be silenced. But, really, this is just an excuse for an opportunistic attack on the religious freedom of Christians (and other faiths too).

 

But is the answer to antisemitic rhetoric in Canada the elimination of everyone’s religious freedom? Rather, if the government truly believes that someone is advocating or promoting the annihilation of Jews, should it not enforce existing laws which already make that illegal? It is already illegal to advocate genocide according to Section 318 of the Criminal Code! Clearly, this proposal is just a cynical attack on people of faith by the anti-religious Bloc Québécois leader.

 

In fact, if Bill C-367 were to pass, I can almost guarantee you that antisemitic demonstrations would still be permitted to continue as “political” protests, while the changes to the Criminal Code would be used to prosecute Christian pastors and laypeople for proclaiming Bible-based truths about sexual morality. In time, Jewish rabbis and Muslim imams would not be exempt, and they would also come under the hammer of the state.

 

No, Bill C-367 is a dangerous threat to every citizen’s freedom of expression and religion. It will only serve the nefarious agenda of pro-LGBT activists and christophobic politicians who want to impose their woke ideology on our country and silence all opposition.

 

Bill C-367 must be stopped, and we need your help to stop it! Take a moment to send an Action Alert Email to your Member of Parliament today and ask him or her to stand up for our right to share our Christian values and beliefs in the public square. 

 

If we want to keep Canada free – both for ourselves and our children – we need to speak up now.

 

Urge your MP to reject Bill C-367 here: https://www.votervoice.net/CALIFE/Campaigns/112075/Respond

 

2 of 2

Anonymous ID: 5fd294 Feb. 21, 2024, 5:29 a.m. No.20451079   🗄️.is 🔗kun

https://twitter.com/MarioNawfal/status/1760211246903644618

 

Mario Nawfal

 

@MarioNawfal

🚨BILLIONAIRES' APOCALYPSE BUNKERS NOW HAVE FIRE MOATS AND DECONTAMINATION ROOMS

 

From Mark Zuckerberg's $100 million fortress in Hawaii to Peter Thiel's New Zealand hideaway, billionaires are sparing no expense on survival bunkers.

 

The ultra-rich are focusing on survival, pouring millions into bunkers now reportedly with fire moats, water cannons, MRI machines, and even a parking spot for a submarine.

 

What do they know that we don't?

 

Source: Vice

Quote

Mario Nawfal

 

@MarioNawfal

·

Jan 20

🚨CELEB BUNKER BOOM: MULTI-MILLION DOLLAR DOOMSDAY PLANS REVEALED

 

Mark Zuckerberg reportedly tops the list with a $270-million Hawaiian bunker haven, while Rick Ross is said to rival Elon Musk with his own subterranean sanctuary.

 

Taylor Swift allegedly joins the fray, her…

Show more

1:53 AM · Feb 21, 2024

Anonymous ID: 842871 Feb. 21, 2024, 5:31 a.m. No.20451082   🗄️.is 🔗kun   >>1139

>>20450895

tyb

What do they mean when they write "bang"?

That always meant fuck? didn't it?

>>20450903

 

>>20449206 lb

>>20448929 pb

how did Laura "give herself away"?

She was obviously pushing the line of the "woman don't like revenge" BS

ekkkekk

>>20450967

 

Seem like the mainstream has been pushing massive fear regarding alleged "Trump Revenge"

 

>>20450953

FALSE

 

>>20450967

wow, as if woman don't themselves do revenge! Ur right.

But woman often have different strategies from a man? emotional blackmail, poison?

turn the child against (but men do that too; espeically in the age of alleged equality between men and woman!

Men are more likely to use a gun. Woman use a car?; i.e. Laura Bush.

>>20450958

need to see the details on the EnGore Ghoul

>>20451048

seems very simple. for people who can read.

Truth is short. Lies go on a long time (form of distraction - dig to the premises and cut the crap - that's why they control the speech and voting machines and filabuster.

Anonymous ID: 025619 Feb. 21, 2024, 5:32 a.m. No.20451085   🗄️.is 🔗kun   >>1217

Machu Picchu was built by giants using fallen angel technology in an attempt to survive the coming flood. The remote location, altitude and a building technique all designed to be barrier, still failed to stop the deluge from wiping them out. Incas tell that these buildings and walls were there before they arrived. (You can see Inca building techniques on top of the original wall).

Anonymous ID: 1432d6 Feb. 21, 2024, 5:34 a.m. No.20451092   🗄️.is 🔗kun

Spot the new "Parade Route"…

 

Danish farmers must cut production to achieve climate goal, says government advisor

Feb 21st, 07:26:46

 

COPENHAGEN (Reuters) - Denmark's farmers must reduce production by as much as one-fifth by 2030 if the country is to achieve its ambitious climate goals, a government-commissioned group said on Wednesday.

 

Denmark, a major pork and dairy exporter, could become the first country in the world to levy an emissions tax on farming, a move that has broad political backing in the country, after New Zealand last year pushed back such a tax to the end of 2025.

 

The agriculture sector has become a political battleground as the European Union strives to meet its net zero emissions target by 2050. Farmers across the bloc have been protesting for weeks, saying they are facing rising costs and taxes, red tape, and excessive environmental rules.

 

https://PiQSuite.com/reuters/danish-farmers-must-cut-production-to-achieve-climate-goal-says-government-advisor

Anonymous ID: 5fd294 Feb. 21, 2024, 5:34 a.m. No.20451093   🗄️.is 🔗kun   >>1110 >>1512

"Accidental (fake) emergency broadcast bulletin about nuclear attack on CONUS lists 8 cities that get nuked. Is one yours?"

 

https://www.bitchute.com/video/QVwJKjG4Bvqv/

 

"Apparently was broadcasted to some people in the North East part of the United States.

10 hours ago at least. Must be some really slow missiles. Traveling at the speed of a fart.

What bullshit.

 

But they shot down 4 of them! There goes all the water and the toilet paper again. Stand by for videos on this channel of dumb asses fighting over hot pockets and pop tarts at grocery stores."

Anonymous ID: 91ec13 Feb. 21, 2024, 5:36 a.m. No.20451098   🗄️.is 🔗kun   >>1147 >>1183

https://en.wikipedia.org/wiki/Jewish_Autonomous_Oblast

Judaism, despite being the associated religion of the oblast's titular ethnoreligious group, is practiced by just 1% of the population, which is only slightly higher than the national average and is close to that of communities in other federal subjects.

Anonymous ID: 5fd294 Feb. 21, 2024, 5:37 a.m. No.20451103   🗄️.is 🔗kun   >>1155 >>1540 >>1605 >>1675

https://www.express.co.uk/news/world/1868460/argentina-milei-inflation-government-surplus

 

Argentina's hard-Right leader sees nation in first monthly surplus for a year

 

The South American country's new president has introduced sweeping measures to curb government spending and inflation - but time will tell if the strategy will pay off.

Javier Milei

 

The Argentine government last month saw its first monthly budget surplus in over a decade following the election of a new far-right leader - but at great cost.

 

President Javier Milei is continuing to push for substantial spending cuts, his Economy Ministry announced, as his first full month in office ends with an improved budget but many economic issues are still unchecked. Public sector finances ended January with $589million at the official exchange rate, the government said late Friday.

 

This includes payment of interest on the public debt. The Economy Ministry said in a statement to the Telam news agency it is “the first (monthly) financial surplus since August 2012, and the first surplus for a January since 2011.”

Anonymous ID: 2e5338 Feb. 21, 2024, 5:41 a.m. No.20451111   🗄️.is 🔗kun

https://t.me/WesternJournal/31903

 

Dem Sen. Bob Menendez Showed Off Money-Filled Safe to Nude Lover 15 Years Before FBI Gold Bars Raid, According to Dossier

 

READ: http://w-j.co/s/02db4

Anonymous ID: 7346f1 Feb. 21, 2024, 5:41 a.m. No.20451112   🗄️.is 🔗kun   >>1114

Egypt has officially joined a growing list of countries to abandon the U.S. dollar entirely. It enacted this yesterday, and will no longer accept the U.S. dollar as a trade currency whatsoever.

Anonymous ID: 152d32 Feb. 21, 2024, 5:43 a.m. No.20451115   🗄️.is 🔗kun

Biden Family Business Tied to $Trillions in Lithium Acquired by China through U.S. Afghanistan Withdrawal

 

ByJon Fleetwood September 11, 2021

 

The Biden family profits from the U.S. withdrawal from Afghanistan and China’s subsequent acquisition of Afghanistan’s lithium.

 

QUICK FACTS:

 

Hunter Biden owns 10% of Chinese state-owned private equity firm Bohai Harvest RST.

 

Bohai Harvest owns Contemporary Amprex Technology Co. Limited, the world’s largest lithium-ion battery maker.

 

Days before Biden’s Afghan withdrawal, Contemporary Amprex Technology announced it was soon to raise $9 billion to fund six projects aimed at boosting its production capacity of lithium-ion batteries.

 

Biden’s withdrawal from Afghanistan left the country’s $3 trillion in lithium reserves to Taliban-friendly China and its state-controlled equity firms like Hunter Biden’s Bohai, which owns the world’s largest lithium-ion battery maker.

 

Article continues with a detailed and useful timeline. Here is the relevant excerpt.

 

Biden’s administration disastrously withdrew U.S. troops from Afghanistan in mid-August 2021.

 

Only days after the U.S. military withdrew from Afghanistan, the Taliban took control of major cities and installed themselves in the presidential palace in Kabul.

 

The Biden admin. left billions of dollars worth of U.S. weaponry to be seized by the Taliban.

 

In early September 2021, the Taliban announced a partnership with China, namely that China will be their “main partner” in helping rebuild Afghanistan. The Taliban have an interest in China’s Belt and Road Initiative and see it as a revival of the ancient Silk Road, according to The Post Millennial.

 

Taliban announces partnership with Chinahttps://t.co/EXnsxbqJq4

 

— Dinesh D'Souza (@DineshDSouza) September 3, 2021

Biden’s withdrawal ultimately handed Afghanistan’s valued $3 trillion lithium reserves (here) to China.

 

https://americanfaith.com/biden-family-business-tied-to-trillions-in-lithium-acquired-by-china-through-u-s-afghanistan-withdrawal/

Anonymous ID: 43f0f8 Feb. 21, 2024, 5:44 a.m. No.20451117   🗄️.is 🔗kun

>>20451014

>completely eliminate and erase whitey as well as like-minded dissidents from history

>all worker bees and foot soldiers will be a mixed mud race

>ruling class will run everything behind the scenes through their merger with sentient conscious vessels that are now immortal gods with not diseases or sickness for them only

>brave new world

Anonymous ID: 025619 Feb. 21, 2024, 5:44 a.m. No.20451119   🗄️.is 🔗kun

Antidote to Graphene Contamination/PollutionLB

According to a 2014 study by Hu, Mu, Kang, Zhou, et. al., and subsequent confirmations publisheded by this leading Chinese research team, “Humic Acid Acts as a Natural Antidote of Graphene by Regulating Nanomaterial Translocation and Metabolic Fluxes

 

https://medicalveritas.org/graphene-antidote-for-covid-vaccine-nano-bioelectronic-intoxication-for-prevention-and-recovery/

 

A cure for the chyna virus vax from a chinese guy…

 

Grift

Anonymous ID: 2e5338 Feb. 21, 2024, 5:44 a.m. No.20451120   🗄️.is 🔗kun   >>1155 >>1166 >>1540 >>1605 >>1675

https://twitter.com/LizLemeryJoy/status/1760126567802401001

 

Liz Joy

@LizLemeryJoy

🚨Attention all NY Parents. A NY Bill that takes away your parental rights. Every New Yorker needs to know about this Bill!

3:17 PM · Feb 20, 2024

·

5,718

Views

Anonymous ID: 3d3260 Feb. 21, 2024, 5:46 a.m. No.20451123   🗄️.is 🔗kun

>>20451090

TUCKER CARLSON can speak, and the COMMON MAN, in the rarefied air of the elites, because he has all the sanctimonious credibility from being raised IN the American Nobility of Opus DEI infiltrated "Catholicsish" Institutions of the Church, and it's Government appendages like the CIA and the NSA.

 

Tucker is "one of them" gently asking very gentile questions about the enslavement of the Common Man in what WAS originally established as a Nation Free from the Forced Religions,Tax Mandates, and Debtors Prisons found in every other MONARCHY in the world.

 

The Globalists all skip over the DoI, the US Constitution, and Bill of Rights as meaningless pieces of pape, relevant only before the Divine 9 in the SCOTUS and their Pretty Poodles.

Like the BO here.

Anonymous ID: 2e5338 Feb. 21, 2024, 5:48 a.m. No.20451132   🗄️.is 🔗kun

https://www.businesswire.com/news/home/20230912456530/en/Echodyne-Receives-FCC-Authorization-for-High-Accuracy-EchoShield-Radar/

 

Echodyne Receives FCC Authorization for High-Accuracy EchoShield Radar

 

Demand for high-performance radar growing across all customer markets and applications

September 12, 2023 03:00 AM Eastern Daylight Time

 

SEATTLE(BUSINESS WIRE)Echodyne, the radar platform company, today announces it has received Federal Communications Commission (FCC) Authorization for its EchoShield radar. The FCC Authorization allows EchoShield to be used for non-experimental purposes and arrives as demand for its breakthrough radars grows across all markets and applications. Echodyne’s software-defined, multi-mission, commercial-off-the-shelf (COTS) radars are used for situational awareness by Defense, Government, and Critical Infrastructure customers, and as a navigational sensor by Advanced Air Mobility (AAM) and Uncrewed Aircraft Systems (UAS) markets.

Anonymous ID: 842871 Feb. 21, 2024, 5:49 a.m. No.20451139   🗄️.is 🔗kun

>>20451082

>Truth is short. Lies go on a long time (form of distraction - dig to the premises and cut the crap - that's why the controlers censor the speech and rig the voting machines and use the filabuster to avoid facing the music)

 

Turn the child against (but men do that too; espeically in the age of alleged equality between men and woman!)

Probably both genders do that; for a long time.

In the 19th c. and early 20th it would be men mostly, since men controlled woman back them. It was a custom.

So more likely man would take the child, if he could and wanted to; and turn it against mother.

This happened in the case of Klaus Schwab. His Dad was a NAZI and took Klaus, Klaus' mother sent into exile and never mentioned (she was Jewish , so NAZI had to hide her)

 

>>20449206 lb

 

>>20448929 pb

 

how did Laura "give herself away"?

 

She was obviously pushing the line of the "woman don't like revenge" BS

 

Women might be more conflict averse; plot secretly, appear innocent, and are afraid of Trump's image, as presented by the Mass Media.

Used to be woman liked to appear innocent; Now they are supposed to look badASS?

True?

"Who you are" is by large extent; created.

So the communist attempt to create a generations where there is no gender.

alleged equality, but no specializtion.

It's a commie totalitarian "One World Order" goal

A. W. Watts explains how the image of self is often largely self-created rather then intrinsic?

(in the 60's naturally)

lecture linked

Self-identity is somewhat fungible;

 

https://tora3.com/video/450db53f2f0500834040a0e2d8e331eb

woman who had bad experiences with their fathers, would be most affected by the straw man projected by the Trump-haters.

Past trauma could be triggered?

Anonymous ID: bb42ab Feb. 21, 2024, 5:50 a.m. No.20451140   🗄️.is 🔗kun

>>20450949

You can tell by the way that judge Engoron acts he has a criminal mind. Just like those clowns down in Georgia. That is the jist of the current problem, criminal minds have crept into the wheelhouses of power and are steaming the ship of state towards the rocks.

Anonymous ID: 2e5338 Feb. 21, 2024, 5:50 a.m. No.20451141   🗄️.is 🔗kun

https://www.techrxiv.org/doi/full/10.36227/techrxiv.22704643.v1

 

Radar-based Human Activity Recognition: Is it Ready for Aging in Place?

bioengineeringcomputing and processingsignal processing and analysis

Anonymous ID: 2e5338 Feb. 21, 2024, 5:53 a.m. No.20451146   🗄️.is 🔗kun   >>1179 >>1540 >>1605 >>1675

https://www.embs.org/jtehm/articles/passive-radar-opportunistic-monitoring-e-health-applications/

 

Passive Radar for Opportunistic Monitoring in e-Health Applications

 

This paper proposes a passive Doppler radar as a non-contact sensing method to capture human body movements, recognize respiration, and physical activities in e-Health applications. The system uses existing in-home wireless signal as the source to interpret human activity. This paper shows that passive radar is a novel solution for multiple healthcare applications which complements traditional smart home sensor systems. An innovative two-stage signal processing framework is outlined to enable the multi-purpose monitoring function. The first stage is to obtain premier Doppler information by using the high speed passive radar signal processing. The second stage is the functional signal processing including micro Doppler extraction for breathing detection and support vector machine classifier for physical activity recognition. The experimental results show that the proposed system provides adequate performance for both purposes, and prove that non-contact passive Doppler radar is a complementary technology to meet the challenges of future healthcare applications.

Anonymous ID: 3d3260 Feb. 21, 2024, 5:53 a.m. No.20451147   🗄️.is 🔗kun   >>1169

>>20451098

The JAO was designated by a Soviet official decree in 1928, and officially established in 1934. At its height, in the late 1940s, the Jewish population in the region peaked around 46,000–50,000, approximately 25% of its population.[14] By 1959, its Jewish population had fallen by half.

 

Article 65 of the Constitution of Russia provides that the JAO is Russia's only autonomous oblast. It is one of two officially Jewish jurisdictions in the world, the other being Israel.

 

The Soviet government entertained the idea of resettling all Jews in the USSR in a designated territory where they would be able to pursue a lifestyle that was "socialist in content and national in form". The Russians also wanted to offer an alternative to Zionism, the establishment of the Mandate of Palestine as a Jewish homeland

 

After the war ended in 1945, there was renewed interest in the idea of Birobidzhan as a potential home for Jewish refugees. The Jewish population in the region peaked at around 46,000–50,000 Jews in 1948, around 25% of the entire population of the JAO.[14]

 

. In 1991, after the breakup of the Soviet Union, the Jewish Autonomous Oblast became the federal subject of Russia and thus was no longer subordinated to Khabarovsk Krai. However, by that time, most of the Jews had emigrated from the Soviet Union

 

https://en.wikipedia.org/wiki/Jewish_Autonomous_Oblast

 

The ones that left went to Israel. They can go back too,

Anonymous ID: 91ec13 Feb. 21, 2024, 5:53 a.m. No.20451148   🗄️.is 🔗kun

https://www.nbcnews.com/politics/justice-department/ex-fbi-agent-feds-say-urged-jan-6-rioters-kill-police-worked-terrorism-rcna82775

Ex-FBI agent who feds say urged Jan. 6 rioters to kill police worked terrorism task force

Jared Wise was part of the FBI's Joint Terrorism Task Force and was supervisory special agent in charge of the Homegrown Violent Extremism unit.

Anonymous ID: e2067f Feb. 21, 2024, 5:54 a.m. No.20451150   🗄️.is 🔗kun

9:00 AM EST

China in the Global South: Development and Influence in a Shifting Global Order - Day 1

Atlantic Council

https://www.atlanticcouncil.org/event/china-in-the-global-south/

https://www.youtube.com/watch?v=i7wfhnoP2jw

-

TBD

Discussion on China's Influence Across Global South

Panelists from the U.S. government, academia, and private sector discuss China’s influence across the Global South at the Atlantic Council in Washington, DC.

https://www.c-span.org/video/?533705-1/discussion-chinas-influence-global-south

Anonymous ID: 433042 Feb. 21, 2024, 5:54 a.m. No.20451151   🗄️.is 🔗kun

I'm sure the namefagging HRN thinks he's taking something. His coworker burnt out from 8 months of that routine and now runs a fraudulent absolution script, so I'm sure the new namefagger is going to have an even worse time. They're just pixels.

Anonymous ID: 91ec13 Feb. 21, 2024, 5:54 a.m. No.20451154   🗄️.is 🔗kun   >>1187

https://t.me/CIG_telegram/43465

An Israeli citizen threw the Polish flag in the mud at the Hrebenne crossing with Ukraine during a farmers' demonstration

Those who witnessed the action held the Israeli accountable forcing to lift the flag and put it back.

Anonymous ID: 027456 Feb. 21, 2024, 5:55 a.m. No.20451155   🗄️.is 🔗kun   >>1487

>>20450903

>>20451105

baker has toghost

notes are guud up to this post

 

notables bun @215

czech em and have a good day

 

#25088 >>20450903

>>20450934 Dr. Phil Shares an Explosive Interview w/ Border Patrol Showing American Taxpayers Are Funding the Trafficking of Migrant Children Into S** Slavery

>>20450942, >>20450959 Catholic Indiana couple appeals to Supreme Court after their child was taken from them after they refused to refer to him as his preferred pronouns.

>>20450950 Under the fog of war, Ukraine cancels its 2024 presidential elections

>>20450954 Absolute horror story out of Lakewood, Colorado. A middle school staff member is accused of multiple sexual assaults on male students…

>>20451017, >>20451025, >>20451026 Sweden's National Preparedness Manual "If Crisis or War Comes" (in English)

>>20451047 Massive farmer protest paralyzes Madrid, Spain.

>>20451071, >>20451078 Trucker Says Boycotting New York City Is Bigger Than Trump - Causes 30% Receiver Fee INCREASE For NYC Load Deliveries: Food Prices To SURGE

>>20451103 Argentina under Milei: The Economy Ministry said: “the first (monthly) financial surplus since August 2012, and the first surplus for a January since 2011.”

>>20451120 Liz Joy w/CAP: Attention all NY Parents. A NY Bill that takes away your parental rights. Every New Yorker needs to know about this Bill!

Anonymous ID: 1432d6 Feb. 21, 2024, 5:55 a.m. No.20451158   🗄️.is 🔗kun

Well, that certainly busts a trend…

 

Switzerland to ban Hamas after Israel attacks

Feb 21st, 07:47:31

 

ZURICH (Reuters) - Switzerland's government said on Wednesday it wants to ban Hamas after the Palestinian militant group's attacks in Israel last year which killed nearly 1,200 people and sparked a war in Gaza.

 

Bern said it was taking action after the attacks on October 7 which killed two Swiss nationals and resulted in nearly 250 people being taken hostage.

 

In response, Israel launched a military assault on Gaza that local health authorities say has killed nearly 29,000 Palestinians with thousands more feared lost amid the ruins.

 

The Swiss government said under the new legislation Hamas and "cover or successor organisations" as well as organisations or groups that act on its behalf or in its name will be banned.

 

https://PiQSuite.com/reuters/switzerland-to-ban-hamas-after-israel-attacks

Anonymous ID: 91ec13 Feb. 21, 2024, 5:55 a.m. No.20451160   🗄️.is 🔗kun

The Israeli civil administration in the territories constructed the hospital complex's Building Number 2, which has a large cement basement that housed the hospital's laundry and various administrative services.

Anonymous ID: bb42ab Feb. 21, 2024, 5:56 a.m. No.20451166   🗄️.is 🔗kun

>>20451120

Remember when we didn't have to know about every bill because we had elected representatives who did that for us? What happened to the congresses? Why are they working against us?

Anonymous ID: ac201b Feb. 21, 2024, 5:57 a.m. No.20451167   🗄️.is 🔗kun   >>1540 >>1605 >>1675

21 Feb, 2024 12:53

 

Lavrov comments on Russian favorite in race for White House

 

Neither contender is willing to course-correct bilateral relations, the top diplomat said

 

Russia is interested in policies, not personalities, and has no expectation that the US intends to change its antagonistic stance, regardless of who wins the November presidential election, Russian Foreign Minister Sergey Lavrov told Brazilian media on Tuesday.

 

The top diplomat was asked whether Moscow preferred a return of Donald Trump to the White House next year over President Joe Biden staying in office. The interviewer from the Globo media group cited opinions that a new Trump presidency would make it easier to wrap up the Ukraine conflict.

 

“The ruling elites in the US consider Russia an enemy and a threat regardless of their political affiliation,” Lavrov said.

 

While Biden “did nothing” in four years to improve relations with Russia, “we do not delude ourselves into expecting the anti-Russian course of the US to change anytime soon,” the minister added.

 

Claims and counterclaims over which presidential candidate is a “favorite” of Moscow have been an element of US electoral cycles for decades. The ongoing race, in which Biden and Trump are presumed to be nominated by their respective parties, is no different.

 

While Russian officials traditionally say they will work with whoever American voters choose, Putin somewhat deviated from this position in an interview last week. He said Biden is his preferred candidate, because he is old-school, experienced and predictable.

 

Allegations that President Trump was backed by Russia and beholden to it, which stemmed from the Democratic Party’s explanation of why Hillary Clinton lost to him in 2016, undermined his administration. Contrary to what his critics claimed, some of the Republican’s actions at the helm were escalatory, such as his decision in 2017 to supply weapons to Ukraine.

 

Last week, journalists Michael Shellenberger, Matt Taibbi and Alex Gutentag published the first part of their investigation into the ‘Russiagate’ saga. They claim that US intelligence services engaged foreign partners to spy on the Trump campaign and manipulated evidence to create an impression that it had “colluded” with Moscow.

 

(Interesting pic RT pic, Bidan is tiny compared to Trump and is looking at his watchIs that when they released covid?)

 

https://www.rt.com/russia/592842-lavrov-preferred-candidate-us/

Anonymous ID: 2e5338 Feb. 21, 2024, 5:57 a.m. No.20451170   🗄️.is 🔗kun   >>1540 >>1605 >>1675

https://www.breitbart.com/2nd-amendment/2024/02/20/remington-ceo-cites-legislative-environment-new-york-company-moves-georgia/

 

Remington CEO Cites ‘Legislative Environment’

in New York as Company Moves to Georgia

 

Breitbart 2nd Amendment, by AWR Hawkins

 

 

Posted By: Imright, 2/21/2024 8:13:48 AM

 

Remington is leaving New York, and CEO Ken D’Arcy noted that the direction legislation took in the Empire State was a cause for concern. The Associated Press (AP) noted that D’Arcy used a news release to indicate that New York’s “legislative environment” is concerning to the firearm industry as a whole.The pending closure of Remington’s Ilion, New York, plant — launched in 1828 — marks the end of generations of New Yorkers working for the American gun maker.Jim Conover began working at the Ilion plant in 1964 and continued to work for Remington for four decades. He commented on the pending closure,

Anonymous ID: 1509e8 Feb. 21, 2024, 5:58 a.m. No.20451172   🗄️.is 🔗kun

Why did the US military let Satanists take over our country?

Why is it taking so long to fix this obvious and tragic failure?

Who is in control? Of what?

Anonymous ID: 1432d6 Feb. 21, 2024, 5:59 a.m. No.20451177   🗄️.is 🔗kun   >>1188

Italy arrests 12 people over speed boat migrant trips from Tunisia

Feb 21st, 07:58:01

 

ROME (Reuters) - Italian police said on Wednesday they had arrested 12 suspected human traffickers for allegedly organising high-speed transfers for at least 73 illegal migrants from Tunisia to Europe.

 

Expert pilots operated the speed boats crossing from Tunisia to Marsala in Sicily between June and September last year, police said in a statement, describing them as "VIP trips".

 

The traffickers transferred relatively small groups of up to 20 people on each of four trips, charging fees of up to 6,000 euros ($6,500) per person, the statement said.

 

The trip, on a crowded and less seaworthy vessel, would normally cost under 1,000 euros per migrant, an official with knowledge of the matter said.

 

Italy and other European governments have taken an increasingly hard line on immigration in recent years amid a surge of arrivals of asylum seekers and undocumented migrants. EU data shows fewer than 100,000 irregular migrants made to it Europe in 2020, but that rose to 250,000 last year.

 

Six Tunisians and six Italians were detained as part of an investigation coordinated by European police body Europol and the Italian anti-mafia police unit.

 

The investigators identified a Tunisian former police officer as the head of the trafficking organisation.

 

https://PiQSuite.com/reuters/italy-arrests-12-people-over-speed-boat-migrant-trips-from-tunisia

Anonymous ID: 3d3260 Feb. 21, 2024, 6:01 a.m. No.20451183   🗄️.is 🔗kun

>>20451098

Also, what's the Demographic representation of Jews and Catholics in the US population?

And what is in on the SCOTUS?

Has the SCOTUS been Opus DEI weighted?

Anonymous ID: ac201b Feb. 21, 2024, 6:02 a.m. No.20451186   🗄️.is 🔗kun   >>1195 >>1220 >>1229 >>1235 >>1540 >>1605 >>1675

New York Mayor Warns Migrants If They Keep Attacking NYPD Officers, They'll Be Downgraded To 4-Star Hotels

Babylon Bee

 

Article Image

NEW YORK, NY — During a recent press conference, Mayor Eric Adams announced that he will no longer tolerate migrant attacks against NYPD officers, warning that further incidents would result in a downgrade in migrant living accommodations from luxurious 5-star hotels to humble 4-star establishments.

 

"We're sending a strong, clear message that we mean business," said Mayor Eric Adams sternly. "If you mess with New York's finest, you're going to have to have a slightly less luxurious stay."

 

"You can kiss those swan-shaped folded bath towels and mints on your pillow goodbye! That's how seriously we take protecting our boys in blue," added Mayor Adams. "No more Mr. Nice-Mayor! Gone are the days of hospitalizing local law enforcement by day and sleeping on 10,000 thread count Egyptian sheets by night!"

 

According to sources, many New Yorkers have heavily criticized the mayor's new proposal, calling it "a full-blown humanitarian crisis" and a "racist affront to migrant dignity".

 

"What's next? Taking away their brand new iPhones just because they torched a couple of cop cars?" said one disgruntled citizen. "These migrants just want to feed their families and assault cops without repercussion! What has happened to this once great city?"

 

At publishing time, Mayor Eric Adams was left with no choice but to threaten to take away the PS5s from any migrant who assaulted a cop.

 

https://babylonbee.com/news/new-york-mayor-warns-migrants-if-they-keep-attacking-nypd-officers-theyll-be-downgraded-to-living-in-4-star-hotels#google_vignette

Anonymous ID: 91ec13 Feb. 21, 2024, 6:02 a.m. No.20451187   🗄️.is 🔗kun

>>20451154

>An Israeli citizen threw the Polish flag in the mud at the Hrebenne crossing with Ukraine during a farmers' demonstration. Those who witnessed the action held the Israeli accountable forcing to lift the flag and put it back.

Anonymous ID: c95042 Feb. 21, 2024, 6:03 a.m. No.20451191   🗄️.is 🔗kun   >>1196 >>1213 >>1540 >>1605 >>1675

https://www.thegatewaypundit.com/2024/02/bipartisan-group-us-senators-flies-hungary-bully-orban/

 

Bipartisan Group of US Senators flies to Hungary to bully Orban into approving NATO expansion and guess what? Hungarian politicians refuse to meet with them

 

Quotes: "Why does NATO even bother pretending that their decisions are “unanimous” when what the U.S. says, goes? If any leader of a NATO-member country dared to even think about voting against U.S. war-making policy, they get slapped with economic sanctions, compliments of a weaponized U.S. dollar."

 

"And we wonder why the BRICS coalition is growing. Nations are fed up with being bullied by Washington. It really is that simple."

Anonymous ID: ac201b Feb. 21, 2024, 6:06 a.m. No.20451204   🗄️.is 🔗kun   >>1218 >>1219 >>1222 >>1223 >>1540 >>1605 >>1675

CLOWNWORLD

Google’s Gemini AI Blasted For Eliminating White People From Image Searches

 

Paul Joseph Watson

21st February 2024

One comment

Vikings were black, apparently.

 

https://modernity.news/2024/02/21/googles-gemini-ai-blasted-for-eliminating-white-people-from-image-searches/

Anonymous ID: c95042 Feb. 21, 2024, 6:07 a.m. No.20451205   🗄️.is 🔗kun

>>20451179

 

Old VHS player would play movie on the t.v. without being connected. Found out by accident as one day some of us were watching a movie and it was noticed the cables/cords had not been connected.

Anonymous ID: 43f0f8 Feb. 21, 2024, 6:08 a.m. No.20451209   🗄️.is 🔗kun

>>20451168

the vast majority of consumers have cookie cutter homes with nothing but flat area anyway so that'd essentially be a non-issue

plus design changes and engineering could make it possible

people now think they need a $9,000 commercial mower to mow a 1/4 acre with a half foot ditch in the front

>>20451176

think they were the ones behind that computer prediction from 1973 of the end of civilization in 2040-2050 too

vid related

Anonymous ID: 4e74eb Feb. 21, 2024, 6:10 a.m. No.20451217   🗄️.is 🔗kun

>>20451085

>Machu Picchu was built by giants using fallen angel technology in an attempt to survive the coming flood.

 

Anon suspects the Cahokia mounds in Illinois were made for a similar purpose. The Indians living there when De Soto got to North America probably had nothing to do with their construction.

Anonymous ID: b41d33 Feb. 21, 2024, 6:12 a.m. No.20451225   🗄️.is 🔗kun

Well

It has become apparent

That the peeps that thought

I fell and bonked muh head

Are now understanding

Why I rebuilt an 1982 truck

And dropped a 70s engine in a mid 90s ford

Damn they starting to catch up

Anonymous ID: 1432d6 Feb. 21, 2024, 6:14 a.m. No.20451228   🗄️.is 🔗kun   >>1232 >>1540 >>1605 >>1675

Judge Engoron Accused of Banging Secretary of Opposing Counsel in Previous Case

https://www.thegatewaypundit.com/2024/02/judge-engoron-accused-banging-secretary-opposing-counsel-previous/

 

A Judicial Affair

By Stewart Ain July 26, 2002 12:00 am

 

"Lewin said in court papers that the law secretary, Arthur Engoron, claims he only began dating the secretary of the opposing counsel, Christopher Sullivan, on May 10. But Lewin said Sullivan’s actions in the case may have been "influenced" by information he received from the woman, identified in the papers only as Sue. And Lewin noted that Engoron "was drafting [later] decisions and communicating" with the judge about this case during the time he was dating Sue."

 

https://www.jta.org/2002/07/26/ny/a-judicial-affair

Anonymous ID: ac201b Feb. 21, 2024, 6:14 a.m. No.20451230   🗄️.is 🔗kun   >>1242 >>1261

ABC World News Tonight with David Muir Full Broadcast - Feb. 20, 2024

 

Boeing Wing damaged, people had to notify the pilots. Does anyone inspect these planes before take off?

 

https://youtu.be/sPDWunAdBZY

Anonymous ID: 1432d6 Feb. 21, 2024, 6:16 a.m. No.20451236   🗄️.is 🔗kun   >>1540 >>1605 >>1675

Dats actually guid news….

 

James Mayger

@JDMayger

The PBOC released data today showing the amount of Chinese shares owned by overseas investors fell in 2023 for a second straight year

 

https://www.bloomberg.com/news/articles/2024-02-21/foreign-investors-flee-chinese-shares-long-delayed-data-shows

 

https://twitter.com/JDMayger/status/1760294597866242469

Anonymous ID: 4e74eb Feb. 21, 2024, 6:18 a.m. No.20451242   🗄️.is 🔗kun

>>20451230

>Does anyone inspect these planes before take off?

 

it's standard operating procedure for either the pilot or co-pilot to walk around the plane and look for obvious structural problems… but they absolutely do miss stuff.

 

especially tough task for night flights, where they have to inspect with flashlights.

Anonymous ID: c95042 Feb. 21, 2024, 6:20 a.m. No.20451246   🗄️.is 🔗kun   >>1262

>>20451234

 

Elizabeth Warren got a job at some "elite" university based, I guess on being a POC. If Elizabeth Warren is a POC then anyone can be.

 

When the wicked speak of Black and White they are not talking of skin tone. They are disguising their evil by calling it "blackness". This is how Bill Clinton could be the first Black President.

 

Notice that the slogan "Black Lives Matter" doesn't really mention shade of skin. It refers to lives not skin color.

Anonymous ID: bb42ab Feb. 21, 2024, 6:24 a.m. No.20451252   🗄️.is 🔗kun

>>20451235

And then it gets so bad that New York elects a Rudy Guilliani and he cleans the place up and makes it safer and than the city, like the proverbial dog, returns to its vomit and goes back to Dem leadership and here we are again.

Anonymous ID: c33627 Feb. 21, 2024, 6:25 a.m. No.20451258   🗄️.is 🔗kun   >>1273

What’s the point of sourcing citation sauce?

All of media seems devolved into sewage.

GWP headlines are become Foxesque hyperbolic vomit.

Anonymous ID: a9f3d8 Feb. 21, 2024, 6:25 a.m. No.20451259   🗄️.is 🔗kun   >>1318 >>1442

>>20451069

 

RNC Chair Candidate Michael Whatley Refused to Investigate Fraud in NC

President Trump says that he supports Michael Whatley to be the next RNC Chairman. His tenure atop the NC GOP has been disastrous.

 

https://nationalfile.com/rnc-chair-candidate-michael-whatley-refused-to-investigate-fraud-in-nc/

Anonymous ID: e8a109 Feb. 21, 2024, 6:28 a.m. No.20451269   🗄️.is 🔗kun   >>1274 >>1291 >>1540 >>1605 >>1675

NASA Astronomy Picture of the Day

Feb 21, 2024

 

Seagull Nebula over Pinnacles' Peak

 

The bird is bigger than the peak. Nicknamed for its avian shape, the Seagull Nebula is an emission nebula on the night sky that is vast, spanning an angle over five times the diameter of the full moon and over 200 light years. The head of the nebula is catalogued as IC 2177, and the star cluster under its right wing is catalogued as NGC 2343. Consisting of mostly red-glowing hydrogen gas, the Seagull Nebula incorporates some dust lanes and is forming stars. The peak over which this Seagull seems to soar occurs at Pinnacles National Park in California, USA. The featured image is a composite of long exposure images of the background sky and short exposure images of the foreground, all taken consecutively with the same camera and from the same location.

 

https://apod.nasa.gov/apod/astropix.html?

Anonymous ID: e2067f Feb. 21, 2024, 6:29 a.m. No.20451272   🗄️.is 🔗kun   >>1540 >>1605 >>1675

10:00 AM EST

NPC Headliners: Secretary of Energy Jennifer M. Granholm

National Press Club (NPC)

https://www.press.org/events/npc-headliners-secretary-energy-jennifer-m-granholm

https://www.youtube.com/watch?v=CPduxPB4AsY

-

Energy Secretary Discusses Clean Energy Investment

Energy Secretary Jennifer Granholm discusses the Biden administration’s clean energy policy and infrastructure investment during an event hosted by the National Press Club in Washington, DC.

https://www.c-span.org/video/?533706-1/energy-secretary-discusses-clean-energy-investment

Anonymous ID: 35886d Feb. 21, 2024, 6:32 a.m. No.20451286   🗄️.is 🔗kun   >>1303 >>1540 >>1605 >>1638 >>1675

Michigan wanted homeschool registry for warrantless home entry

 

February 2024: Michigan State Board Of Education On Homeschool Registry Preparing To Conduct Warrantless Entry To People’s Homes Enrolled In Homeschool

 

Board Speaking On Michigan Attorney General Dana Nessel: “She basically said, we want this list so that we can have unwarranted home entry, without a warrant. Warrantless home entry into homeschool”

 

“But whole homeschooling thing is really quite disturbing. And one of the things that disturbs me about this is the disingenuousness of the discussion because we have people like the Senate Education Committee chair, Dayna Polehanki saying that when asked about increasing regulations beyond registration, she said not on my watch.

 

Well, we got Attorney General Dana Nessel that says that she wants to do it because the foster care system didn't do their job and apparently homeschool parents. Uh, there was some abuse going on at a homeschool home, um, or that actually sounds like the foster care system.

 

But, certainly, a mere registration, a list of people is not gonna have anything to do or will not help prevent, um, what attorney general Nestle is talking about. So she's already kinda said the quiet part out loud.

 

She basically said, we want this list so that we can have unwarranted home entry, uh, without a warrant. Warrantless home entry into homeschool into this particular targeted group.”

 

https://twitter.com/WallStreetApes/status/1760101385549631935

Anonymous ID: e2067f Feb. 21, 2024, 6:34 a.m. No.20451293   🗄️.is 🔗kun   >>1540 >>1605 >>1675

10:00 AM EST

Supreme Court October Term 2023 Argument Day

Supreme Court

^

Ohio v. EPA (23A349)

Kinder Morgan, Inc. v. EPA (223A350)

American Forest & Paper Assn. v. EPA (23A351)

U.S. Steel Corp. v. EPA (23A384)

Consolidated

^

Warner Chappell Music, Inc.v. Nealy (22-1078)

^

https://www.supremecourt.gov/oral_arguments/2023TermCourtCalendar.pdf

https://www.supremecourt.gov/oral_arguments/argument_audio/2023

-

10:00 AM EST

Ohio v. EPA

The Supreme Court hears oral argument in Ohio v. EPA, a consolidated case concerning the EPA’s authority to establish national air quality standards.

https://www.c-span.org/video/?533613-1/ohio-v-epa

-

11:00 AM EST

Warner Chappell Music v. Nealy

The Supreme Court hears oral argument in Warner Chappell Music v. Nealy, a case on copyright law and statute of limitations for damages.

https://www.c-span.org/video/?533614-1/warner-chappell-music-v-nealy

Anonymous ID: fa3885 Feb. 21, 2024, 6:36 a.m. No.20451298   🗄️.is 🔗kun

>>20451059

Someone's thinking! The medical industry foisted the jabs on you and happily shoved that poison into your arms, your family's arms, and many others. They have no guilt or shame, and are fully supported by the corrupted trash that wears a uniform.

 

Nothing new to see here. At least Trump is gonna give the uniform wearers complete immunity to do whatever they want.

Anonymous ID: d65279 Feb. 21, 2024, 6:40 a.m. No.20451307   🗄️.is 🔗kun   >>1312 >>1469 >>1584

God promised Noah to never flood the earth again, and sealed it using the rainbow.

I wonder if that was the same time our vision was limited to, the now visible light spectrum?

Maybe these entities can only be seen in different frequencies.

Could this limitation be reversed?

Would be wild to wake up one day and view the world with new eyes.

Anonymous ID: a45d18 Feb. 21, 2024, 6:41 a.m. No.20451310   🗄️.is 🔗kun   >>1316

>>20451284

>Catchy tune

Dan thinks so, too!

Feb 21, 2024, 12:39 AM

https://truthsocial.com/@DanScavino/posts/111967860037136862

 

"Another Level" - OH THE LARCENY

Standing in the street

The sun is in the east

Calling out the beast

The tiger underneath

Starting to believe

The world is at my feet

I'm ready for the feast

It's all within my reach (it's all within my reach)

I'm going all the way

I'm going, yeah, my blood is rebel

I'm going all the way

I'm going to another level

To another level

To another level

If I'm on the loose

Running after you

There's nothing you could do

I'll catch you and it's through

Hustle for the juice

Hundred twenty proof

I'm blowing up the roof

Blowing up the roof

Got nothing left to prove (come on)

I'm going all the way

I'm going, yeah, my blood is rebel

I'm going all the way

I'm going to another level

(Let's go) to another level

(Gotta get my hands dirty)

To another level

Chain breaker, earth shaker, rain maker

Yeah, another level

Chain breaker, earth shaker, rain maker

Yeah, another level

Chain breaker, earth shaker, rain maker

Yeah, another level

Chain breaker, earth shaker, rain maker

Oh, to another level

I'm going all the way

I'm going, yeah, my blood is rebel

I'm going all the way

I'm going to another level (yeah, come on)

To another level

(Let's go, let's go, let's go)

To another level

To another level

(Let's get it)

To another level

Anonymous ID: 4a5b76 Feb. 21, 2024, 6:43 a.m. No.20451312   🗄️.is 🔗kun

>>20451307

ghost glasses, they live. seeing dimensions that are out of phase all at once. It was a Doctor Who episode also where the Daleks were pretending to be ghosts.

Anonymous ID: e8a109 Feb. 21, 2024, 6:43 a.m. No.20451314   🗄️.is 🔗kun   >>1540 >>1605 >>1675

NASA Sets Coverage of First US Uncrewed Commercial Moon Landing

FEB 20, 2024

 

As part of NASA’s CLPS (Commercial Lunar Payload Services) initiative and Artemis campaign, Intuitive Machines is targeting no earlier than 5:49 p.m. EST Thursday, Feb. 22, to land their Odysseus lunar lander near Malapert A in the South Pole region of the Moon.

 

Live landing coverage will air on NASA+, NASA Television, the NASA app, and the agency’s website. NASA TV can be streamed on a variety of platforms, including social media. Coverage will include live streaming and blog updates beginning 4:15 p.m., as the landing milestones occur. Upon successful landing, Intuitive Machines and NASA will host a news conference to discuss the mission and science opportunities that lie ahead as the company begins lunar surface operations.

 

In May 2019, the agency awarded a task order for scientific payload delivery to Intuitive Machines. Odysseus launched at 1:05 a.m., Feb. 15, on a SpaceX Falcon 9 rocket from Launch Complex 39A at NASA’s Kennedy Space Center in Florida.

 

NASA is working with several U.S. companies to deliver science and technology to the lunar surface through the agency’s CLPS initiative. This pool of companies may bid on task orders for end-to-end delivery services, which includes payload integration and operations, launching from Earth, and landing on the surface of the Moon. NASA’s CLPS contracts are indefinite-delivery/indefinite-quantity contracts with a cumulative maximum contract value of $2.6 billion through 2028.

 

Through the Artemis campaign, commercial robotic deliveries will perform science experiments, test technologies, and demonstrate capabilities to help NASA explore the Moon in advance of Artemis Generation astronaut missions to the lunar surface, and ultimately crewed missions to Mars.

 

https://www.nasa.gov/news-release/nasa-sets-coverage-of-first-us-uncrewed-commercial-moon-landing/

Anonymous ID: b41d33 Feb. 21, 2024, 6:45 a.m. No.20451322   🗄️.is 🔗kun   >>1362

>>20451300

What ever happened to good old heroin

The reason they still guard poppy fields in Afghanistan

No more opium like back years ago

It's all fentanyl….its all good

They did all of this before

30s or 40s…same shit different heads

Anonymous ID: a45d18 Feb. 21, 2024, 6:46 a.m. No.20451327   🗄️.is 🔗kun

Desperate agencies do stupid things.

Dead cat bounce.

You may have the site but we have the source.

https://mobile.twitter.com/wikileaks/status/1011441579565953025

Panic is good.

Panic is right.

July 2018 - the month the world discovered the TRUTH.

Conspiracy no more.

Time to FEED.

 

>Desperate agencies do stupid things.

>Desperate agencies do stupid things.

>Desperate agencies do stupid things.

>Desperate agencies do stupid things.

>Desperate agencies do stupid things.

>Desperate agencies do stupid things.

Anonymous ID: 2da63c Feb. 21, 2024, 6:47 a.m. No.20451330   🗄️.is 🔗kun   >>1336 >>1342 >>1358

https://twitter.com/mattgaetz/status/1760302320363991260

 

 

 

Hey @fbi - our staff has been trying to get in contact with you. No response.

 

The scene outside your Valparaiso office in my district is……alarming.

 

Is everyone OK?

 

Please check in safe.

Anonymous ID: bb42ab Feb. 21, 2024, 6:49 a.m. No.20451335   🗄️.is 🔗kun   >>1339

>>20451320

The replacement can't dance and looks like shit. It only fools the morons who aren't paying attention. Suddenly Bald Britney was the replacement. Should have been obvious to everyone, but they are magicians, who are masters of illusion.

Anonymous ID: a6b63c Feb. 21, 2024, 6:50 a.m. No.20451337   🗄️.is 🔗kun

Let's hope his trashy tattoo 'artist' buys the toxic Chinese ink…

 

https://dailycaller.com/2024/02/20/machine-gun-kelly-tattoo

Anonymous ID: d4ec20 Feb. 21, 2024, 6:50 a.m. No.20451338   🗄️.is 🔗kun

The Deep Staters are going to be tortured beyond anyone's imagination medevac type stuff.

 

''MAGA PATRIOTS EX MILITARY IS WAITING FOR YOU''

Anonymous ID: a45d18 Feb. 21, 2024, 6:51 a.m. No.20451341   🗄️.is 🔗kun   >>1361 >>1540 >>1605 >>1675

SEC closes Rumble investigation in latest regulatory clearance of global free speech platforms

 

Published: February 21, 2024 9:22am

 

The SEC said: "Based on the information we have as of this date, we do not intend to recommend an enforcement action."

 

>https://justthenews.com/politics-policy/regulation/sec-closes-rumble-investigation-latest-regulatory-clearance-global-free

Anonymous ID: e2067f Feb. 21, 2024, 6:53 a.m. No.20451347   🗄️.is 🔗kun   >>1540 >>1605 >>1675

10:00 AM EST

WAR ROOM WITH STEVE BANNON 2-21-24

RealAmericasVoice

https://rumble.com/v4et2xt-war-room-with-steve-bannon-2-21-24.html

 

11:00 AM EST

Steve Bannon War Room Event - CPAC in DC 2024: Where Globalism Goes to Die - Wednesday

Conservative Political Action Conference (CPAC)

https://www.digital.cpac.org/us/events-dc2024

https://agenda.m.cpac.org/agenda/wednesday

https://agenda.m.cpac.org/live-stream-w-rumble

https://rumble.com/CPAC

 

don't know if the cpac thing will be streamed

Anonymous ID: e251ca Feb. 21, 2024, 6:53 a.m. No.20451349   🗄️.is 🔗kun   >>1540 >>1544 >>1605 >>1675

Alabama’s supreme court ruled embryos are ‘extrauterine children’. IVF patients are worried

 

“They’re worried about what to do with their frozen embryos. They want to be the ones who make the decisions on how best to utilize their embryos – not the supreme court,” said McLean, who provides IVF as part of her work as an OB-GYN at Alabama Fertility, which has three locations in the state. McLean said she has spoken to more than a dozen of her patients over the last 48 hours, but: “Frankly, because of the lack of guidance, we don’t we don’t know exactly how this translates to our care.”

 

Since each created embryo is now a person in the eyes of the law, the Alabama ruling casts multiple parts of the IVF process into legal jeopardy. Providers may no longer be able to freeze, thaw, transfer or test embryos using best medical practices. People also frequently make more embryos than they use, and it is unclear if Alabamians would be able to ever dispose of those embryos under the supreme court ruling.

 

The consequences could even pose an existential threat to IVF in Alabama, as providers and patients may flee the state rather than risk liability flowing from the ruling.

 

“It’s a nonsensical ruling with devastating consequences for the health of the people in Alabama,” said Sean Tipton, chief advocacy and policy officer for the American Society for Reproductive Medicine. “The court, of course, didn’t deign to deal with the real-world implications of their decision, but they are profound.”

 

During a typical IVF process, providers use medication to stimulate the ovaries to produce multiple eggs, which are then extracted. Experts in a laboratory fertilize the eggs with sperm to create embryos. Doctors may then transfer an embryo or two into the patient’s uterus, or freeze embryos for future use.

 

https://www.theguardian.com/us-news/2024/feb/21/alabama-ivf-embryo-extrauterine-children-ruling

Anonymous ID: a3652d Feb. 21, 2024, 6:55 a.m. No.20451357   🗄️.is 🔗kun

>>20451299

a desperate need for attention.

cannot imagine spending any time around a person with such narcissistic needs.

She needs a come to Jesus moment.

no long now..

join the anons and tell all Britney before you are silenced..

prayers sent and this is from an anon who has no time for entitled females and the destruction they have caused to the world with feminist idealogy.

Anonymous ID: 6a2e18 Feb. 21, 2024, 6:56 a.m. No.20451360   🗄️.is 🔗kun   >>1421 >>1605 >>1675

Assange Trial Live

 

Day 2 cont.

 

I will save you the bulk of the legal dry-heave taking place.

 

The attorney for the U.S. government just said that Julian Assange's publications had nothing to do with journalism.

She said they are "grave and serious crimes".

 

(apparently forgetting that they were improperly classified documents and video to begin with, in order to hide monumental evidence of U.S. war crimes including the gunning down and murdering of women, children, and reporters as U.S. troops laughed.)

 

The U.S argument continues to be detached from reality and the facts of the case.

 

The judge has asked for Manning's sentencing remarks.

Anonymous ID: a6b63c Feb. 21, 2024, 6:57 a.m. No.20451362   🗄️.is 🔗kun   >>1364

>>20451322

The CIA ran the heroin production, protected the fields for decades.

When Afghanistan was abandoned the Taliban burned the poppy fields and killed the Afghani heroin/opium producers.

Taliban is more conducive to honorable human behavior than American UniParty globalist cabal.

Anonymous ID: d4ec20 Feb. 21, 2024, 7 a.m. No.20451369   🗄️.is 🔗kun

MAGA PATRIOTS are God fearing Christian people and all that Jew we are God's chosen people crap is the biggest bunch shit.

 

MAGA only worships Jesus Christ.

Anonymous ID: 989d90 Feb. 21, 2024, 7:01 a.m. No.20451373   🗄️.is 🔗kun   >>1378 >>1381 >>1386 >>1387 >>1437 >>1568

>>20450977

 

NUCLEAR ERROR Trident fiasco as Brit sub ‘fired dummy missile at the United States’ in first nuke test for four years

Unarmed Trident II D5 rocket, which can kill millions when fitted with warhead, experienced a serious malfunction during the practice launch off Florida

 

Carri-Ann Taylor

Published: 1:50, 22 Jan 2017

 

NUCLEAR ERROR Trident fiasco as Brit sub ‘fired dummy missile at the United States’ in first nuke test for four years

Unarmed Trident II D5 rocket, which can kill millions when fitted with warhead, experienced a serious malfunction during the practice launch off Florida

 

Carri-Ann Taylor

Published: 1:50, 22 Jan 2017

 

https://www.thesun.co.uk/news/2675087/trident-fiasco-as-brit-sub-fired-dummy-missile-at-the-united-states-in-first-nuke-test-for-four-years/amp/

Anonymous ID: f7881d Feb. 21, 2024, 7:01 a.m. No.20451374   🗄️.is 🔗kun

18 of 22 hit on Influenza A with c19 ATATTGCAGCAGTACGCACACA primer.

Thinking about if not optimal PCR conditions, how much this nonspecificty would contribute to PCR+ c19 in the face of Influenza A infection?

Anonymous ID: 579696 Feb. 21, 2024, 7:04 a.m. No.20451380   🗄️.is 🔗kun

https://twitter.com/Tragicrepublic_/status/1760314978253627859

 

"Elon Musk" #TrumpCult #Truckers4Trump NYPD New York City they keep blocking me from posting her shameful press conference. You won’t believe the reason why .

Anonymous ID: 8dd3ea Feb. 21, 2024, 7:04 a.m. No.20451382   🗄️.is 🔗kun

YEP. The elite have decided that Creepy Joe will not be their presidential candidate come November. The New York Times is preparing the public. https://www.thegatewaypundit.com/2024/02/report-biden-white-house-furious-new-york-times/

Anonymous ID: 989d90 Feb. 21, 2024, 7:04 a.m. No.20451383   🗄️.is 🔗kun

>>20450977

 

2016

 

Theresa May is coming under increasing pressure to divulge more details about what happened during a Trident missile test last June.

 

So far, the British prime minister has refused to deny or confirm if the missile misfired after it was reported that it went of course.

 

May was told about the test upon taking office in July, shortly before MPs voted to renew the nuclear weapons system.

Anonymous ID: a45d18 Feb. 21, 2024, 7:12 a.m. No.20451394   🗄️.is 🔗kun   >>1399

>>20451376

NEW EYES

>#1584

Jan 20, 2017

June 20, 2018

Exactly 17 months.

Do you believe in coincidences?

God bless you all.

>#1585

We stand.

We fight.

TOGETHER.

Organized riots being planned.

Counter measures in place.

Resistance far smaller than portrayed by MSM.

Attacks will intensify.

You, collectively, are a massive threat.

Censorship applied to scale down impact/reach.

It’s failing.

Trust yourself.

Public awakening.

Anonymous ID: 16e364 Feb. 21, 2024, 7:13 a.m. No.20451395   🗄️.is 🔗kun   >>1399 >>1483

Night Shift Bun of Dread for 2/17/2024

>>20428646 Those you trust are the most guilty of sin. Who are we taught to trust? If you arereligious, PRAY. Drops #586, 587, 4884 and 3565 fit together like a glove

>>20428650 The ayylmao decode drops #376, 2222, 2225 & #4966

>>20428653 but PELOSI did Jan 06 all by her self! What Phone call?!!?!? General who? https://en.wikipedia.org/wiki/Walter_E._Piatt and General who? https://en.wikipedia.org/wiki/Charles_A._Flynn

>>20428655 What happened in SA will happen here, Asia, and EU.

>>20428656 What happened in SA?

>>20428662 Drop #133 Decoded. Does the Thought of Satan Exist? Rothschild, Soros, S.A. as well as many Governments of the World Feed the EYE OF PROVIDENCE.

>>20428666 JAN 06 Who is Caroline Wren? Alex Jones, Flynn, Bannon and the rest of the [FAKE MAGA] gang setup JAN 06 > DIG

>>20428674 go on… MG SHOW? P = Payseur? Vatican Gate Keepers

>>20428678 The Real 2020 Election Interference - Italygate https://en.wikipedia.org/wiki/Italygate General Flynn, Sydney Powell, Mike Lindell and then suddenly all quiet.

>>20428681 The Real Immigration Issue NGO's and Catholic Charities > The Largest Human trafficking network in the world.

>>20428682 Ivan Raiklin (Flynn Faggot) and Alex Jones take on if they Assassinate Donald Trump Timestamp: 00:00:47 Alex Jones "If they kill him, that's the best case scenario, from a sick level…"

Basically, Alex Jones and Flynn Faggot sent veiled Death Threats to POTUS a few weeks ago and your hosts here at Q research did not think it was notable and they really do not want you to talk about it New Eyes.

>>20428685 The Council for inclusive Capitalism with The Vatican - Founded by Lynn De Rothschild but WEF WEF WEF!

>>20428689 Drop #1413 The Council for Inclusive Capitalism > Lynn De Rothscild + The Pope + 600 International Corporations. THE MG SHOW and other gatekeepers had a hard time with this one…

>>20428687 Drops # 26 and 2347 the "SIGNIFIER" decode "The picture will be the signifier."

>>20428692 The Snake poem and the Vatican serpent/viper drops. POTUS drops the snake poem too many times to count yet big patriots have not connected the snake poem to the Vatican Serpent drops? In 6 years?

>>20428695 Qresearch board history from 2018 to 2021 most cannot believe their eyes at the amount of Deep State Fuckery right here on muh 8 kuns. Neo Nazi Vatican Gatekeepers.

>>20428703 Dan Scavino posts Traitors way too often for it to be a coincidence Jack Poso and many more have Q drops about them and its not good Jack Posobiec is a traitor > DROP #2089 > IS DAN STUPID? ARE YOU?

>>20428718 Q anon influencers have let the world down and NIGHT SHIFT knows exactly who, exactly how and in some cases… exactly why they traitored…

>>20428725 "To those who are courageous enough to speak out - we stand with you!" Nuns Raped Girls With Crucifixes as Female Pedophilia Was Covered Up by the Church > Nuns drugged and dragged children to be raped by elite.

>>20428728 Soros in two drops… Two fucking drops!!! Q drop #416 Q drop #1413 That is called Checkmate and it was not very difficult so what has been the P = problem for over 6 years? TY MG SHOW!

>>20428729 The Great Awakening Free Thought drops start here:

>>20428732

>>20428735

>>20428738

>>20428742

>>20428747

>>20428753

>>20428757

>>20428762

>>20428764

>>20428768

>>20428775

>>20428778 The Free Thought Great Awakening Drops end here: In short… the religious fundamentalists here are traitors pure and simple. Dividers by Religion and that's all [they] ever were.

>>20428806 Here is a faggot right now to show you exactly what anon was referring to above…

>>20428792 The U.S. Supreme Court is Knights of Malta Vatican deep state. 7 of the 9 or 77% of the Supreme Justices are Catholic in a nation that is only 20% Catholic. You think this is a Coincidence?

>>20428795 Who is Harlan Crow? Who is Leonard Leo? fuck around and find out…

Anonymous ID: 16e364 Feb. 21, 2024, 7:14 a.m. No.20451399   🗄️.is 🔗kun   >>1483

>>20451394

>>20451395

>>20451394

Jun 21, 2018 1:35:10 AM EDT 1584

Q !CbboFOtcZs ID: 97de56 No. 1842740

Jun 21, 2018 1:28:40 AM EDT

Q !CbboFOtcZs ID: 97de56 No. 1842655

Jun 21, 2018 1:23:16 AM EDT

Anonymous ID: 2b6cd5 No. 1842592

 

vipanon-reduced-forinfinity1.mp4

for (you) VIPanon

>>1842592

Jan 20, 2017

June 20, 2018

Exactly 17 months.

Do you believe in coincidences?

God bless you all.

Q

>>1842655

We told you proofs were going to be important very soon.

NEW EYES.

Be ready.

5:5?

We thank you for your service.

Q

 

 

May 16, 2018 2:49:07 PM EDT 1384

Q !4pRcUA0lBE ID: a8f52e No. 1432972

May 16, 2018 2:47:55 PM EDT

Anonymous ID: 47ba70 No. 1432956

May 16, 2018 2:45:50 PM EDT

Q !4pRcUA0lBE ID: a8f52e No. 1432932

Follow the pen.

Already written?

Letters left visible to match.

https://mobile.twitter.com/Jim_Jordan/status/996821093146120192

WWG1WGA!

Q

 

1520214256103.gif

>>1432932

NEW EYES joining the fight Q!

>>1432956

Those with an agenda to silence will fail.

Pain coming.

Q

 

>>20153950

Feb 14, 2019 11:31:08 PM EST 2722

Q !!mG7VJxZNCI ID: 4e1594 No. 5181988

No mercy.

No bargaining.

A TRAITOR’s justice.

P-A-I-N

Q

Anonymous ID: d449bc Feb. 21, 2024, 7:14 a.m. No.20451400   🗄️.is 🔗kun

How long will we submit to a world run by racketeers and gangsters? Neil Oliver: The Profits of War

 

‘Biden mourned Navalny’s death and said ‘even in prison he was a powerful voice for the truth'.

 

'An interesting statement while journalist, Julian Assange, who published truth inconvenient to the US and the west, presently rots in Belmarsh Prison.’

 

#gbnews #biden #ukraine #julianassange #assange #war #neiloliver

Anonymous ID: 16e364 Feb. 21, 2024, 7:14 a.m. No.20451402   🗄️.is 🔗kun   >>1483

Ladies and Gentlemen!

 

Q !UW.yye1fxo ID: b189f8 No. 130638 Jan 22, 2018 9:47:32 PM EST 586

What would happen if texts originating from a FBI agent to several [internals] discussed the assassination (possibility) of the POTUS or member of his family?

What if the texts suggest foreign allies were involved?

Forget the Russia set up [1 of 22].

This is only the beginning.

Be careful what you wish for.

AS THE WORLD TURNS.

Could messages such as those be publicly disclosed?

What happens to the FBI?

What happens to the DOJ?

What happens to special counsel?

What happens in general?

Every FBI/DOJ prev case could be challenged.

Lawless.

Think logically.

We haven’t started the drops re: human trafficking / sacrifices [yet][worst].

Those [good] who know cannot sleep.

Those [good] who know cannot find peace.

Those [good] who know will not rest until those responsible are held accountable.

Nobody can possibly imagine the pure evil and corruption out there.

Those you trust are the most guilty of sin.

Who are we taught to trust?

If you arereligious, PRAY.

60% must remain private [at least] - for humanity.

These people should be hanging.

Q

 

Q !UW.yye1fxo 01/22/2018 21:50:37 ID: b189f8 587

8chan/qresearch: 130667

PRAY.

PREY.

Notice the similarity?

Q

 

Oct 17, 2020 2:16:46 PM EDT 4884

Q !!Hs1Jq13jV6 ID: 9b755f No. 11120402

https://www.youtube.com/watch?v=LUsLDzXWUU4

Enjoy the show!

Q

 

Q Links to Pope's Tweet on Human Trafficking3565

Q !!mG7VJxZNCI 30 Jul 2019 - 8:23:13 PM

https://twitter.com/Pontifex/status/1156165039545606144

Godfather III

It's going to be BIBLICAL.

Q

Anonymous ID: 0b7df7 Feb. 21, 2024, 7:16 a.m. No.20451404   🗄️.is 🔗kun   >>1483

CLICK CLICK!

 

790

Feb 18, 2018 8:41:03 PM EST

Q !UW.yye1fxo ID: 000000 No. 104

@SNOWDEN

WHERE ARE YOU?

NOT RUSSIA.

[EYES ON]

YOU ARE NOW A LIABILITY.

HELPING @JACK?

PROJECT DEEPDREAMv2[A]].

WE WILL NEVER FORGET.

ES FAILED.

WHERE IS ES?

JOHN PERRY BARLOW.

DEFINE THE END?

THE DAY OF RECKONING IS UPON US.

JOHN3:16

Q

 

 

989

Apr 02, 2018 11:47:24 PM EDT

Q !xowAT4Z3VQ ID: 491f56 No. 875289

Apr 02, 2018 11:45:09 PM EDT

Q !xowAT4Z3VQ ID: 491f56 No. 875265

April [A].

IG report.

Sessions public attack.

RR problems.

Seals broken.

[A]rrests.

Why was Huber made public?

Why now?

Everything has meaning.

[A]wan.

Tarmac.

Iran.

NK.

U1.

FBI.

DOJ.

Mueller.

Election Integrity.

Immigration Bill.

Border.

Wall.

Military start.

BIG month.

Q

>>875265

Facebook.

Amazon.

Twitter.

GOOG.

………..

BIG problems.

Q

 

 

991

Apr 03, 2018 12:03:57 AM EDT

Q !xowAT4Z3VQ ID: 491f56 No. 875587

Apr 02, 2018 11:58:41 PM EDT

Anonymous ID: 015520 No. 875485

Apr 02, 2018 11:45:09 PM EDT

Q !xowAT4Z3VQ ID: 491f56 No. 875265

April [A].

IG report.

Sessions public attack.

RR problems.

Seals broken.

[A]rrests.

Why was Huber made public?

Why now?

Everything has meaning.

[A]wan.

Tarmac.

Iran.

NK.

U1.

FBI.

DOJ.

Mueller.

Election Integrity.

Immigration Bill.

Border.

Wall.

Military start.

BIG month.

Q

>>875265

Tip Top Tippy Top Shape

>>875485

It was requested.

Did you listen today?

Q

 

995

Apr 03, 2018 8:42:09 PM EDT

Q !xowAT4Z3VQ ID: 463ae0 No. 884736

Future proves past.

Several today.

[1 day]

RR.

Military.

Border.

Keep watching the news.

[A]pril.

MOAB.

Q

 

996

Apr 03, 2018 8:43:55 PM EDT

Q !xowAT4Z3VQ ID: 463ae0 No. 884763

Apr 03, 2018 8:42:09 PM EDT

Q !xowAT4Z3VQ ID: 463ae0 No. 884736

Future proves past.

Several today.

[1 day]

RR.

Military.

Border.

Keep watching the news.

[A]pril.

MOAB.

Q

>>884736

Coincidence another MSM narrative change upon release of damaging news?

People are waking up.

Trace the background of the shooter.

Focus on Father.

20 years.

Q

 

997

Apr 03, 2018 8:45:50 PM EDT

Q !xowAT4Z3VQ ID: 463ae0 No. 884799

Apr 03, 2018 8:43:05 PM EDT

Anonymous ID: dd4e73 No. 884748

Apr 03, 2018 8:42:09 PM EDT

Q !xowAT4Z3VQ ID: 463ae0 No. 884736

Future proves past.

Several today.

[1 day]

RR.

Military.

Border.

Keep watching the news.

[A]pril.

MOAB.

Q

>>884736

P = pope?

>>884748

[Pope]will be having a terrible May.

Those who backed him will be pushed into the LIGHT>

Dark to LIGHT.

TRUTH.

Q

Anonymous ID: 1509e8 Feb. 21, 2024, 7:16 a.m. No.20451405   🗄️.is 🔗kun

Fentanyl/PIzza market, active.

DNA/cloning facility, active.

Satanic witches, active.

Innocent children being injured 24/7, lives being destroyed, still happening.

Indifference and inability to enforce the law is but feeble COMPLICITY.

 

RAGE

Anonymous ID: 0b7df7 Feb. 21, 2024, 7:16 a.m. No.20451406   🗄️.is 🔗kun   >>1483

"JUST LIKE WE DREW IT UP"

 

Are Plans "drawn up"?

WHO IS IN CONTROL?

 

People also ask:

How much does it cost to get plans drawn up?

How do I draw my own plans?

How to draw up house plans for free?

How much does it cost to draw up house plans?

Anonymous ID: d84295 Feb. 21, 2024, 7:17 a.m. No.20451407   🗄️.is 🔗kun   >>1414

>>20451367

Openly stealing your money. Smoking gun evidence of them laundering your tax money and rigging elections could drop and the American people, especially you dumfucking QTARDS wouldn’t do shit

Anonymous ID: 0b7df7 Feb. 21, 2024, 7:17 a.m. No.20451408   🗄️.is 🔗kun   >>1483

Woe to you, oh Earth and Sea, for the Devil send's the Beast with Wrath, because he knows the time is short…

Let him who hath understanding reckon the number of the Beast, for it is a Human Number. It's Number is Six Hundred and Sixty Six…

 

Dig and decode on the Eye of Providence - Q drop #133 version 7.0 "Many governments of the world feed the ‘Eye’. The Eye of Providence."

https://en.wikipedia.org/wiki/Eye_of_Providence

https://symbolsage.com/eye-of-providence-meaning/

https://commons.wikimedia.org/wiki/Eye_of_Providence

https://www.catholic.com/qa/gods-all-seeing-eye-isnt-masonic

https://www.catholicbridge.com/catholic/all-seeing-eye-churches.php

https://www.unexpectedtraveller.com/illuminati-symbols-catholic-churches/

https://www.catholic-saints.info/catholic-symbols/eye-christian-symbol.htm

https://www.catholictriparish.org/uploads/8/9/4/5/89454746/signs___symbols.pdf

https://www.ancient-origins.net/human-origins-religions/eye-providence-0013057

https://www.reddit.com/r/Catholicism/comments/zpvrsw/is_this_a_catholic_symbol_specifically_the_eye/

https://www.christianforums.com/threads/why-so-some-many-catholic-churches-have-the-eye-of-providence-in-them-the-same-symbo.7858026/

U.S. Conference of Catholic Bishops@USCCBThe all-seeing eye is not a Masonic symbol but represents God's omnipresence. When surrounded by a triangle, it symbolizes the Trinity. 11:02 AM · Dec 18, 2019 https://twitter.com/USCCB/status/1207330423484928006

 

Nov 11, 2017 11:29:35 PM EST DROP #133 Q !ITPb.qbhqo ID: gO/UntOB No. 149063235

Hard to swallow.

Important to progress.

Who are the puppet masters?If Saud, Roths and Soros are the Puppet Masters, why does Q repeat this Question again below?

House of Saud (6+++) - $4 Trillion+

Rothschild (6++) - $2 Trillion+

Soros (6+) - $1 Trillion+

Focus on above(3).

Public wealth disclosures – False.

Many governments of the world feed the‘Eye’.

Think slush funds (feeder).

Think war (feeder).

Think environmental pacts (feeder).

Triangle has(3)sides.

Eye of Providence.==The EYE OF PROVIDENCE is an ancient symbol most commonly associated with Christianity, Catholicism Holy Trinity. The Eye of God is in the Middle of the Triangle.==

Follow the bloodlines.

What is the keystone?SATAN is the keystone? Double meanings exist? (keystone)

Does Satan exist?No.

Does the ‘thought’ of Satan exist?Yes and it is the Thought that Counts.

Who worships Satan?==All Religions which require a Satan, Devil, Negative archetype excuse for evil to exist.==

What is a cult?Noun: cult; plural noun: cults a system of religious veneration and devotion directed toward a particular figure or object.

Epstein island.

What is a temple?Church, Cathedral, building dedicated to a figure or object.

What occurs in a temple?Worship and sacrifice.

Worship?

Why is the temple on top of a mountain?Represents the Mouth of the Diety

How many levels might exist below?Many, arranged like a body

What is the significance of the colors, design and symbol above the dome?Symbology of the Puppet Masters

Why is this relevant?

Who are the puppet masters?Why is Q asking this question again? This means that the above 3 are not the Puppet Masters but the Puppets.

Have the puppet masters traveled to this island?

When? How often? Why?

“Vladimir Putin: The New World Order Worships Satan”

Q

Parakletos ID: 4c12a4 Feb. 21, 2024, 7:18 a.m. No.20451411   🗄️.is 🔗kun

Exclusive: Israeli forces fired on food convoy in Gaza, UN documents and satellite analysis reveals

 

https://www.cnn.com/2024/02/21/middleeast/un-food-convoy-gaza-israel-strike-cmd-intl/index.html

 

That would be a war crime.

Anonymous ID: 0b7df7 Feb. 21, 2024, 7:18 a.m. No.20451412   🗄️.is 🔗kun   >>1483

Guise! Guise! We gotta do something about all the ELECTION INTERFERENCE though!

 

==THE REAL 2020 ELECTION INTERFERENCE ITALYGATE > ITALIAN MILITARY CONTRACTOR LEONARDO SPA > OBAMA > RENZI ++==

Some things are better left untold [cov]. Public truths of some events force wars. WWIII prevent. #4021

 

Italygatehttps://en.wikipedia.org/wiki/Italygate

 

Fact check: Evidence disproves claims of Italian conspiracy to meddle in U.S. election (known as #ItalyGate)January 15, 2021

https://www.reuters.com/article/uk-fact-check-debunking-italy-gate-idUSKBN29K2N8/

 

ITALYGATE: How votes were switched throughout the U.S. Presidential race

Italygate: is the Italian government directly involved in the US election fraud against Trump?

https://www.thethinkingconservative.com/italygate-how-votes-were-switched-throughout-the-u-s-presidential-race/

 

DoD investigated "Italygate" conspiracy theory per Trump requestJun 23, 2022

https://www.axios.com/2022/06/23/miller-defense-department-italy-trump-election

 

Meadows Pressed Justice Dept. to Investigate Election Fraud Claims

Emails show the increasingly urgent efforts by President Trump and his allies during his last days in office to find some way to undermine, or even nullify, the election results.

https://www.nytimes.com/2021/06/05/us/politics/mark-meadows-justice-department-election.html

 

Rep. Scott Perry played key role in promoting false claims of fraudJune 23, 2022

https://www.washingtonpost.com/national-security/2022/06/23/scott-perry/

 

Fact check: Claims of electoral fraud in Rome, dubbed 'ItalyGate,' are baseless

https://www.usatoday.com/story/news/factcheck/2021/01/08/fact-check-italygate-claims-electoral-fraud-rome-baseless/6567335002/

 

SpyTalk

'Italygate' Conspiracy Pusher Was Fired by CIA

The former CIA man at the heart of “Italygate,” the pro-Trump, Qanon-fueled conspiracy theory that satellites and military technology were used to steal the…

https://www.spytalk.co/p/italygate-conspiracy-pusher-was-fired

 

YouTube

Defense Secretary Called Italy To Debunk Ridiculous 'Italygate' Conspiracy Theory

An MSNBC panel discusses the nationally embarrassing revelation in the fifth January 6th hearing that U.S. Secretary of Defense Christopher Miller was made…

https://youtu.be/Qlc88sV7TP4

 

PolitiZoom

Katie Phang Talks Me Through Today's “Italygate” Testimony

I work during the day and so didn't get to follow the J6 Committee Hearing as closely as I should, and when I did get home there was the scurrilous SCOTUS…

https://politizoom.com/katie-phang-talks-me-through-todays-italygate-testimony/

 

The Washington Post

Rep. Scott Perry played key role in promoting false claims of fraud

Of all the fantastical false claims of fraud and vote manipulation in the 2020 presidential election, “Italygate” was one of the most extreme. And Rep.

https://www.washingtonpost.com/national-security/2022/06/23/scott-perry/

 

Yahoo News

Defense secretary called Italy to debunk ridiculous 'Italygate' conspiracy theory

An MSNBC panel discusses the nationally embarrassing revelation in the fifth January 6th hearing that U.S. Secretary of Defense Christopher Miller was made…

https://news.yahoo.com/defense-secretary-called-italy-debunk-051013621.html

 

Axios

DoD investigated "Italygate" conspiracy theory per Trump request

Former Acting Secretary of Defense Christopher Miller called a high-ranking official in Rome to look into the so-called "Italygate" at the request of the…

https://www.axios.com/2022/06/23/miller-defense-department-italy-trump-election