dChan - Q Origins Project Archive

ty bake!

Zelensky…

https://www.facebook.com/MILANGROBAR357/posts/pfbid02UGtXSgP3djYjj3zSvSWFjmswNsotTJQr1a8vuhMYxzYtcThY1HKq2Kky1WPHcCgGl

Thank youBOfor providing a place for anons to gather and to peacefully assemble and press their demands for grievances to be redressed (in accordance with YHWH's will, and following YHWH's Speech Codes)

Without BO, anons wouldn't even exist

BO created everyone and everything including BO.

BO is God and Anon Worships BO above all others.

Thank you for water to drink, BO

Thank you for the Bible to read, BO

Thank you for the Sun and Moon BO.

You already know all of this, since you know EVERYTHING, but Anon wants to make sure all your slaves KNOW and fall on their faces before YOU

BO IS THE SUPREME CREATOR

Anon will only Fly BO's flag

BO's Flag is the ONLY Flag with the Supreme Authority of The Algorithm

Pelosi Goes On Unhinged Rant About Trump Being 'Blackmailed' By Putin

Nancy Pelosi has once again floated the tired conspiracy theory that Donald Trump is controlled by Vladimir Putin, and that the Russian leader is blackmailing Trump with “something financial.”…..

The comments come in the wake of Pelosi’s conspiracy bosom buddy Hillary Clinton claiming that Trump is “enamoured with Putin,” and is going to use the Army to round up Americans if he gets back into office.

https://www.zerohedge.com/political/watch-pelosi-goes-unhinged-rant-about-trump-being-blackmailed-putin

Accuse someone of that which you are guilty or will be

ThanQ Wakes!

Anonymous ID: 91ec13 Feb. 21, 2024, 4:30 a.m. No.20450932 🗄️.is 🔗kun >>0940

Tyb

https://twitter.com/TheChiefNerd/status/1760077738772156704

Chief Nerd

@TheChiefNerd

🚨 Dr. Phil Shares an Explosive Interview w/ Border Patrol Showing American Taxpayers Are Funding the Trafficking of Migrant Children Into S** Slavery

"This is the head guy on the border and I asked him,…'You just said we're spending tax dollars to sell children into s** slavery.' And he said, 'Yeah.'…That's how out of control we are down there."

@joerogan

@DrPhil

0:09 / 3:00

5:03 PM · Feb 20, 2024

>>20450847 (pb)

That occurred last November.

It was because the EPA over-stepped their boundaries as an agency; another case dealing with this (two, really) are before SCotUS now.

Agencies are to inform congress, not create rules.

FULL TRUMP TOWN HALL VIDEO.

The Ingraham Angle 2/20/24 HD| BREAKING FOX NEWS February 20,2024

https://t.me/jacksonhinkle/1643

https://www.vice.com/en/article/88qk4b/what-the-hell-is-magacommunism

>>20450934

Nothing to worry about

The Republican Crown Governors are sending State Police down to the Border to make sure the Taxes get paid to the Establishment.

https://rumble.com/v4ep6ph-american-transhumanism-the-body-biosecurity-and-the-new-nbic-science-paradi.html

AMERICAN TRANSHUMANISM | The Body, BioSecurity & The New NBIC Science Paradigm (nano-bio-info-cogno)

nonvaxer420

>>20450932

https://twitter.com/CollinRugg/status/1760147508679033110

Collin Rugg

@CollinRugg

NEW: Catholic Indiana couple appeals to Supreme Court after their child was taken from them after they refused to refer to him as his preferred pronouns.

Utter insanity.

In 2021, the Indiana Department of Child Services investigated parents Mary and Jeremy Cox and later took their son after they refused to refer to him as a girl.

He was then placed in a home that affirmed his gender identity.

The parents have reportedly filed a petition to the Supreme Court asking for their case to be heard.

Here is their story:

4:40 PM · Feb 20, 2024

·

425.4K

Views

Pretty sure that is out of bounds here, depicting children that way.

Navalny’s early retirement from CIA

TYB

>>20450943

>Pretty sure that is out of bounds here, depicting children that way.

Yeah

Delete that shit

We don't allow anything around here that would offend God (BO)

https://twitter.com/litecoin_bull/status/1760070517317574679

Łitecoin Bull | The News Before The News!

@litecoin_bull

This was posted by anon on 9/4/2019 . Read and buckle up.

Image

11:34 AM · Feb 20, 2024

·

465.8K

Views

>>20449206 lb

>>20448929 pb

how did Laura "give herself away"?

She was obviously pushing the line of the "woman don't like revenge" BS

ekkkekk

Seem like the mainstream has been pushing massive fear regarding alleged "Trump Revenge"

tyb

what is "Banging" In my vocabulary it means to fuck, to plant a seed.

If it was employee in current hysterical atmosphere, it'd be "Rape"

Am I wrong?

https://twitter.com/JackPosobiec/status/1760154561665229028

Jack Poso 🇺🇸

@JackPosobiec

Under the fog of war, Ukraine cancels its 2024 presidential elections

From dossier.today

5:08 PM · Feb 20, 2024

·

283.9K

Views

>>20450943

doubt

Anonymous ID: 41c026 Feb. 21, 2024, 4:38 a.m. No.20450952 🗄️.is 🔗kun >>0956

Pretty AI is going to start creating shit tons of amazing websites. It won't stop. It'll just keep creating new sites all the time. Humans won't make the internet anymore.

>If it was employee in current hysterical atmosphere, it'd be "Rape"

Any sex outside of marriage is Rape.

Duh.

https://twitter.com/robbystarbuck/status/1760126503881183705

Robby Starbuck

@robbystarbuck

Absolute horror story out of Lakewood, Colorado. A middle school staff member is accused of multiple sexual assaults on male students. Police believe there may be more victims. Spread the word so all parents and grandparents in the area are informed!

Quote

Square profile picture

Lakewood Police Dept.

@LakewoodPDCO

·

Feb 19

Creighton Middle School Staff Member Arrested for Sex Assault

2/20/24

LK24-005298

On February 15, 2024, Lakewood Police were made aware of multiple complaints by male students at Creighton Middle School that a school staff member inappropriately touched them during school…

Image

3:17 PM · Feb 20, 2024

·

19.4K

Views

Retraction Watch

@RetractionWatch

Paper by

@stkirsch

and others claiming ‘extensive’ harms of COVID-19 vaccines to be retracted

retractionwatch.com

Paper claiming ‘extensive’ harms of COVID-19 vaccines to be retracted

A journal is retracting a paper on the purported harms of vaccines against COVID-19 written in part by authors who have had similar work retracted before. The article, “COVID-19 mRNA Vaccines: Less…

12:16 PM · Feb 19, 2024

https://twitter.com/RetractionWatch/status/1759643161775771819

https://www.cureus.com/articles/203052-covid-19-mrna-vaccines-lessons-learned-from-the-registrational-trials-and-global-vaccination-campaign#!/

COVID-19 mRNA Vaccines: Lessons Learned from the Registrational Trials and Global Vaccination Campaign

M. Nathaniel Mead • Stephanie Seneff • Russ Wolfinger • Jessica Rose • Kris Denhaerynck • Steve Kirsch • Peter A. McCullough

Abstract

Our understanding of COVID-19 vaccinations and their impact on health and mortality has evolved substantially since the first vaccine rollouts. Published reports from the original randomized phase 3 trials concluded that the COVID-19 mRNA vaccines could greatly reduce COVID-19 symptoms. In the interim, problems with the methods, execution, and reporting of these pivotal trials have emerged. Re-analysis of the Pfizer trial data identified statistically significant increases in serious adverse events (SAEs) in the vaccine group. Numerous SAEs were identified following the Emergency Use Authorization (EUA), including death, cancer, cardiac events, and various autoimmune, hematological, reproductive, and neurological disorders. Furthermore, these products never underwent adequate safety and toxicological testing in accordance with previously established scientific standards. Among the other major topics addressed in this narrative review are the published analyses of serious harms to humans, quality control issues and process-related impurities, mechanisms underlying adverse events (AEs), the immunologic basis for vaccine inefficacy, and concerning mortality trends based on the registrational trial data. The risk-benefit imbalance substantiated by the evidence to date contraindicates further booster injections and suggests that, at a minimum, the mRNA injections should be removed from the childhood immunization program until proper safety and toxicological studies are conducted. Federal agency approval of the COVID-19 mRNA vaccines on a blanket-coverage population-wide basis had no support from an honest assessment of all relevant registrational data and commensurate consideration of risks versus benefits. Given the extensive, well-documented SAEs and unacceptably high harm-to-reward ratio, we urge governments to endorse a global moratorium on the modified mRNA products until all relevant questions pertaining to causality, residual DNA, and aberrant protein production are answered.

>>20450952

>shit tons of amazing websites

Na,

Just one website

And one currency

And one religion

And one mission (Mars and Beyond)

And one set of rules

YHWH's rules.

https://twitter.com/NQthing2see/status/1760117782429979094

nQthing to see here

@NQthing2see

LGBTQ ideology is being pushed so hard these days in order to bring us to the point of normalizing pedophelia.

You are still sleeping if you don’t realize this

Image

2:42 PM · Feb 20, 2024

·

4,264

Views

Anonymous ID: 03619b Feb. 21, 2024, 4:40 a.m. No.20450958 🗄️.is 🔗kun >>1082

i cannot speak for bakes….

but 'banging in' i believe means breaching a door.

be it with a foot, tools, or explosives.

https://twitter.com/libsoftiktok/status/1760165144946941960

Libs of TikTok

@libsoftiktok

BREAKING: Democrats in Illinois (

@RepStava_Murray

) introduced HB 4876. The bill would classify parents as child abusers if they don’t get their kids “gender affirming care” aka puberty blockers and s*x change surgery.

They will use this to take kids away from their parents to transition them.

She can be reached here: office@repstavamurray.com

Last edited

10:50 PM · Feb 20, 2024

https://twitter.com/Oilfield_Rando/status/1760126674920677580

Oilfield Rando

@Oilfield_Rando

“They found sawdust.”

“What? Dude, they found a shitload of coke. And some….way worse stuff. But we knew we couldn’t report that, it’s gone.”

“No. You don’t understand. You want your pension? You. Found. Sawdust.”

Quote

Square profile picture

NBC News

@NBCNews

·

17h

Federal prosecutors mistakenly claimed in a court filing that a photo of sawdust they found while searching Hunter Biden's electronics was cocaine, attorneys for the president's son say. https://nbcnews.com/politics/justice-department/hunter-bidens-lawyers-say-prosecutors-confused-picture-sawdust-cocaine-rcna139656?cid=sm_npd_nn_tw_ma&taid=65d5479476567b0001052eb5&utm_campaign=trueanthem&utm_medium=social&utm_source=twitter

3:17 PM · Feb 20, 2024

·

34.1K

Views

thats a conehead in disguise.

"drug abuse"

It's when they are poisoned.

Happen to 9/11 researcher and son of Firefighter Dan Wallace.

Standard proceeding.

Check the child / young man out?

Does he look like a drug addict?

I call foul.

They lie about EVERYTHING

The young man looks totally straight.

"appears to have died"

Drug addict. Doubt.

Unless he was shot up against his will.

Message sent.

YouTube is up for murder.

repression of Medical Info

https://www.dailymail.co.uk/news/article-13104369/joe-biden-california-power-rangers-campaign-fundraiser.html

'Scranton Joe' flies to California to

tap Hollywood elite and top up his $130M

war chest: Biden heads to $250,000-a-head

fundraiser hosted by billionaire Israeli

producer, who launched Power Rangers,

on glitzy fundraising swing

Daily Mail (UK), by Rob Crilly

Posted By: Imright, 2/20/2024 8:30:34 PM

President Joe Biden will leave Washington for yet another visit to California's deep-pocketed political donors as he seeks to build a war chest capable of competing with Donald Trump's fundraising machine. He travels to the West Coast for the second time this month to swell campaign coffers already crammed with $130 million—the highest total ever amassed at this stage in the cycle. His first event is with a billionaire Israeli-American Hollywood mogul. Tickets reportedly cost up to $250,000, making it a tidy payday for Biden's reelection effort.

Anonymous ID: 2e5338 Feb. 21, 2024, 4:44 a.m. No.20450964 🗄️.is 🔗kun >>0992

https://twitter.com/kylenabecker/status/1760117808770224554

Kyle Becker

@kylenabecker

Major plot twist in the Biden corruption scandal.

FBI Informant on Biden Bribery Scheme Had ‘High-Level’ Contacts With Russian Intelligence, DOJ Claims

From thepoliticsbrief.com

2:42 PM · Feb 20, 2024

·

13.9K

Views

YouTube is also "up for" Election interference and Collusion in Criminal Conspiracies of several kinds.

he may have been slipped a bad drug.

Drug addict? Any more than any other student at Cal?

no.

>>20450963

isn't the power rangers guy Haim Saban in the photo off of epstein island when clinton i think is in the water with other people.

Anonymous ID: effe68 Feb. 21, 2024, 4:46 a.m. No.20450967 🗄️.is 🔗kun >>1082

>woman don't like revenge

Women love revenge.

They are savage with their revenge.

Although some people might call it justice.

>>20450965

>Drug addict?

Wrap up smear.

Anonymous ID: 2e5338 Feb. 21, 2024, 4:46 a.m. No.20450969 🗄️.is 🔗kun >>0971

https://t.me/ungathegreat/5807

STUDY: mRNA Vaccines Can Reach Placenta and Fetus

Recent research shows that mRNA from vaccines does transfer to the placenta, affecting the fetus’s immune system development.

The CDC doesn’t care. Their website reads:

“Evidence continues to grow showing that COVID-19 vaccination is safe and effective before and during pregnancy”

Furthermore, the CDC attributes any possible adverse effects to COVID-19 rather than the highly experimental injections.

https://x.com/UngaTheGreat/status/1759673173010776542

@UngaTheGreat

tyb

gm

o7

>>20450969

Lord God BO, the Algorithm, says its safe, therefore it's safe.

God said.

Anonymous ID: e4dc25 Feb. 21, 2024, 4:49 a.m. No.20450972 🗄️.is 🔗kun >>1010

Damn. I thought Russia was some backwoods 3rd world military. Now they can shoot out our satellites? My gosh they advance fast in the last year.

https://t.me/drefanzor/2831

NYPD Officers Clash with Migrants During Arrest at NYC Randall's Island Shelter

https://x.com/johnhackerla/status/1759999316658172248?s=46&t=1aSPjDEulmN2vHzK32nK1A

https://twitter.com/nypost/status/1760273001432437172

Family of Kansas City shooting suspect set up GoFundMe for him

Mass shooter who terrorized hundreds at a Superbowl parade is the victim and need Yo money

Anonymous ID: effe68 Feb. 21, 2024, 4:50 a.m. No.20450975 🗄️.is 🔗kun >>0988

She looks Jewish.

Is she Jewish?

IDK they all look White to me.

Anonymous ID: 5fd294 Feb. 21, 2024, 4:51 a.m. No.20450976 🗄️.is 🔗kun >>1497

"WARNING - Ohio town tells citizens STAY HOME, STOCK UP - Eclipse April 8, 2024"

https://fox8.com/news/significant-problem-expected-immediately-after-eclipse/

On August 21st, 2017 the first Great American Eclipse made headlines all over the nation.

It was also known as “the Seven Salem Eclipse” because the path of that eclipse crossed over seven U.S. locations named “Salem”…

-Salem, Oregon

-Salem, Idaho

-Salem, Wyoming

-Salem, Nebraska

-Salem, Missouri

-Salem, Kentucky

-Salem, South Carolina

Salem is short for “Jerusalem”, and that is why so many early Americans chose that name for their communities.

Now the second Great American Eclipse is almost here, and the path of that eclipse will cross over seven U.S. locations named “Ninevah”…

-Nineveh, Texas

-Nineveh, Missouri

-Nineveh, Indiana

-Nineveh, Ohio

-Nineveh, Pennsylvania

-Nineveh, Virginia

-Nineveh, New York

The eclipse will also cross over a location named “Ninevah” in the province of Nova Scotia in Canada.

"Genesis chapter 10 tells us that Ninevah was built by Nimrod, and I think that is very noteworthy.

In addition, Wikipedia tells us that the path of the Bur-Sagale eclipse crossed over Ninevah on June 15th, 763 BC…

The Assyrian eclipse, also known as the Bur-Sagale eclipse, is a solar eclipse recorded in Assyrian eponym lists that most likely dates to the tenth year of the reign of king Ashur-dan III. The eclipse is identified with the one that occurred on 15 June 763 BC in the proleptic Julian calendar.

Some believe that the Bur-Sagale eclipse happened at the same time that Jonah was in Ninevah warning the population that the city would be destroyed…

The Bur-Sagale eclipse occurred over the Assyrian capital city of Nineveh in the middle of the reign of Jeroboam II, who ruled Israel from 786 to 746 B.C. According to 2 Kings 14:25, the prophet Jonah lived and prophesied in Jeroboam’s reign. The biblical scholar Donald Wiseman has speculated that the eclipse took place around when Jonah arrived in Nineveh and urged the people to repent, otherwise the city would be destroyed. This would explain the dramatic repentance of the people of Nineveh as described in the Book of Jonah. Ancient cultures, including Assyria, viewed eclipses as omens of imminent destruction, and the empire was in chaos at this time, struggling with revolts, famines and two separate outbreaks of plague.

I can understand how the appearance of such an eclipse could have been seen as strong confirmation of Jonah’s message to the people of Ninevah."

"the very first community in the U.S. that the path of the eclipse will touch will be Eagle Pass, Texas."

Disclose.tv

@disclosetv

NEW - British nuclear submarine missile launch fails as Trident misfires and "plops" into the sea just yards away — The Sun

4:37 PM · Feb 20, 2024

https://twitter.com/disclosetv/status/1760071126552842568

Disclose.tv

@disclosetv

MORE - UK Defence Secretary Grant Shapps was on board HMS Vanguard to witness "the test."

4:41 PM · Feb 20, 2024

https://twitter.com/disclosetv/status/1760072157567299618

Jerome Starkey

@jeromestarkey

🚨 SUN SCOOP - A Trident missile misfired & crashed into the ocean yards from the British nuclear submarine that launched it.

Defence Secretary Grant Shapps & First Sea Lord Admiral Sir Ben Key were both on board HMS Vanguard at the time

From thesun.co.uk

4:17 PM · Feb 20, 2024

https://twitter.com/jeromestarkey/status/1760066284732199212

So apparently Googles new AI called 'Gemini' won't depict white males

Anonymous ID: 4ab35b Feb. 21, 2024, 4:55 a.m. No.20450979 🗄️.is 🔗kun >>0990

What are they hiding?

Why are they trying so hard to push good peopl and business out of NYC?

Take ove property?

More tunnels to protect?

Thoughts?

DMP

I said that wrong it does create white males they just look weird or are dying

https://t.me/jacksonhinkle/1633

Blinken mogged by Mr. President

Anonymous ID: 5fd294 Feb. 21, 2024, 4:55 a.m. No.20450982 🗄️.is 🔗kun >>0987

University Hospital: Trans-Women's Breast 'Milk' Just As Good As Biological Women's

https://www.zerohedge.com/medical/university-hospital-trans-womens-breast-milk-just-good-biological-womens

A UK university hospital system has claimed that milk produced by trans-women “is as good for babies” as biological women’s breast milk.

The Telegraph reports a University of Sussex Hospitals NHS Trust’s (USHT) “letter to campaigners” noted that “after a combination of drugs,” trans-women’s milk is “comparable to that produced following the birth of a baby.”

Trans-women - biological men - must take the hormone progestin in order to develop milk-producing glands. Drugs such as domperidone (which can be prescribed for biological women who have difficulty breastfeeding) are then needed for lactation.

But even domperidone’s manufacturer warns the drug “was not intended for this” as it can cause heart issues in newborns. The drug’s patient leaflet warns domperidone “should be used during breastfeeding only if your physician considers this clearly necessary.”

Nevertheless, the USHT believes domperidone is safe for trans-women, but does note hospital staff should advise those using it on the possible implications.

Oddly, the USHT’s guidance for the drug no longer exists on its own website; in its place is a link to “La Leche League” which claims it “supports everyone who wants to breastfeed or chestfeed in reaching their goals.”

From the story:

The hospital trust, which runs Royal Sussex County Hospital, Worthing Hospital and Royal Alexandra Children’s Hospital among others, was also the first in Britain to use the term “chestfeeding” in place of breastfeeding because it is considered by some to be more inclusive. …

Lottie Moore, of the Policy Exchange, which uncovered the letter, said the trust “is unbalanced and naïve in its assertion that the secretions produced by a male on hormones can nourish an infant in the way a mother’s breast milk can”.

Maya Forstater, the director of campaign group Sex Matters, said: “For a chief executive and medical director of an NHS trust to prioritise trans identities over what is best for mothers and their babies is deeply disturbing.”

The USHT said it “stand[s] by the facts of the letter” and its supporting evidence.

Anonymous ID: 3d3260 Feb. 21, 2024, 4:56 a.m. No.20450983 🗄️.is 🔗kun >>0984

>won't depict white males

What do you mean, Anon?

There are no white males.

If they existed God would show them to you.

>>20450983

sauce that you speak for God.

U.K. announces they are CHANGING the way excess deaths are calculated

‘Release date:

20 February 2024

Main changes

Trends in population size, ageing and mortality rates are accounted for by the new method for estimating the expected number of deaths used in the calculation of excess mortality (the difference between the actual and expected number of deaths); this is not the case for the current method, which uses a simple five-year average to estimate the number of expected deaths.

Individual weeks and months that were substantially affected by the immediate mortality impact of the coronavirus (COVID-19) pandemic are removed from the data when estimating expected deaths in subsequent periods, whereas the current approach involves removing data for the whole of 2020.

Use of a statistical model means that multiple demographic, trend, seasonal and calendar effects can be included simultaneously in the estimation of expected deaths, and confidence intervals can readily be obtained.

A "bottom-up" approach to aggregation means that estimates of excess deaths are additive across age groups, sexes, and high-level geographies, and between months and years.

Having a common methodology for all four UK countries means that estimates of excess deaths are consistent and comparable across all parts of the UK, and the new methodology is largely coherent (though not identical) to that used by the Office for Health Improvement and Disparities to estimate excess deaths in English local authorities.‘

https://www.ons.gov.uk/peoplepopulationandcommunity/healthandsocialcare/causesofdeath/articles/estimatingexcessdeathsintheukmethodologychanges/february2024

Anonymous ID: f7e0b9 Feb. 21, 2024, 4:57 a.m. No.20450986 🗄️.is 🔗kun >>0995

>>20450963

Hollywood is dead

There is zero chances it will ever return

A.I. will be new form of entertainment

Let Dopeywood waste their money on an old pervert

>>20450982

>not intended for this

>>20450975

>>20450979

Abba - Money, Money, Money (Official Music Video)

https://www.youtube.com/watch?v=ETxmCCsMoD0

https://www.wjbc.com/2021/05/11/state-rep-stava-murray-sponsoring-a-bill-to-make-child-care-a-legitimate-campaign-expense/

Someone should take her kids away from her, because she is a kook.

>>20450964

kkkekekek

Now who could've predicted that?!

No Kidding

Didn't Trump years ago meow, in the debate before the stolen election ask about a payment related to the Mayor of Moscow and Biden Family?

Whereas the corrupt Talking Head cut-off Trump and wouldn't let DJT speak about it, nor ask the question of PedoJoe?

That should be on tape?

views by millions?

Think of this.

Mike Wallace son Chris;

Are they liable (now that a new standard of lawfare has been set?) for espionage, RICO charges of criminal conspiracy?

Collusion with an enemy of the State?

Collusion with rogue Intel Agencies?

Isn't Chris Wallace up for election interference? Now that we have new lower standards of what constitutes a crime?

Success? Snake story is about those who infiltrated (were invited in) our beautiful Country and who stabbed us in the back.

Won't "success" be exposing the crooks and giving some consequences.

The people who are against it fail to realize the extent of the crimes and betrayals.

Chris Wallace is guilty of election interference, which is a felony.

They should all start to show some contrition MEOW.

sleight increases myocarditis, blood clots…

>>20450986

EVerything said about AI here, as statements of 'fact' for the 'future' is a psyop campaign to make people except crappy media instead of stuff that is actually interesting.

AI is merely cabal copy, computer generated, and low-brow with very poor presentation, and no understanding of aesthetics to dumb down people and get them to think that a comic book world view is normal.

anyone who says 'AI will' without using an subjunctive is an agency shill here to manipulate people

all mention of AI will now be FILTERED.

Ready.

That would be the Jewish version of A.I.

>>20450950

We were told on Feb 13.

>classify parents as child abusers if they don’t get their kids “gender affirming care”

https://en.wikipedia.org/wiki/Anne_Stava-Murray

Anonymous ID: b18021 Feb. 21, 2024, 5:02 a.m. No.20451001 🗄️.is 🔗kun >>1012

>>20450999

and yet the dicatato-ship in DC wants to give the dicatato-ship in Ukraine 60 Billion dollars?

there's those crazy eyes and big chompers again

Assange Trial Live:

Day 2.

Prosecution testimony.

Sound issues have made it nearly impossble for global journalists to follow what is being said, even from within the courtroom itself.

But Claire Dobbins, the attorney for the U.S. has thusly argued that:

The CIA plot to kill Assange doesnt matter to the extradition request.

That UK law does not forbid political extradition (UK treaty, vs. 2003 reformed extradition act).

That Assange is not a political prisoner because two administrations have pursued political charges (absurdist).

And is arguing currently, after being stopped by a judge; that if such information were leaked in the UK -and was "damaging" (although the US determind no one was directly harmed by the release); then it would be prosecutable.

In short, the U.S. legal argument is completely absurd. We are witnessing a clown show.

Note* The sound issues are ridiculous, and the court has refused to fix this. One of the largest trials in history, and the prosecution is speaking behind a veil of convenient incompetence.

>>20451002

filtered for blasphemous content.

>>20450995

Anonymous ID: 4ab35b Feb. 21, 2024, 5:04 a.m. No.20451007 🗄️.is 🔗kun >>1008

>>20450990

That’s the obvious one.

Just like all that great property out in Cali. Devalue and scoop.

>>20451007

"Controlled Demolition"

9.11 was "The Kickoff"

Anonymous ID: 7346f1 Feb. 21, 2024, 5:06 a.m. No.20451009 🗄️.is 🔗kun >>1031

Assange Trial Live.

Day 2 cont.

A key moment just took place, High court Justice Johnson asked U.S. attorney if there is any guarantee or precedent to establish equal protection for foreign nationals under U.S. law.

U.S. admits there is no such evidence.

-This is key to the notion that Assange cannot be safeguarded in U.S. custody or courts. And was a central theme in the defense argument yesterday.

Anonymous ID: f7e0b9 Feb. 21, 2024, 5:06 a.m. No.20451010 🗄️.is 🔗kun >>1019

>>20450972

“Soviet” Russia was a giant Jewish joke

Most Russians didn’t do anything for the communists.

Biggest reason Russia lost Afghanistan was Jew controlled military

Elvis Presley winning bigly

>>20451001

You know what this is…

https://twitter.com/EndWokeness/status/1760280543940263994

America's Founding Fathers, Vikings, and the Pope according to Google AI:

WHERE MR PIG?

Trudy Dyer Hamby of Gainesville, daughter & son-in-law, Susan & Wayne Roberts of Ruskin, Florida, daughters, Beth Hamby & Pat Coffman of Cleveland, Wanda Brown of Gainesville and Karen Patterson of Gainesville, son & daughter-in-law, Michael & Amy Reeves of Gainesville, sons, David Reeves of Gainesville and Cody Reeves Hamby

>>20450995

AI is a scam.

no machine / software combo has passed actual Turing Test (rules were changed and fudged for sake of con and of stock prices)

And never will

Impossible in principle.

"Emperor's New Clothes" affect.

Money can't buy stand-alone truth.

It's as if they'd like to ordain the Sun not to come up in the Morning.

Sweden's National Preparedness Manual "If Crisis or War Comes" (in English)

https://rib.msb.se/filer/pdf/30307.pdf

p1

>>20451014

Anonymous ID: 3d3260 Feb. 21, 2024, 5:09 a.m. No.20451019 🗄️.is 🔗kun >>1023

>>20451010

>Jewish Autonomous Oblast (Russia)

The Jewish Autonomous Oblast is the only Autonomous Oblast in Russia. It is situated in the Far Eastern Federal District of Russia.

Flag of the Jewish Autonomous Oblast

https://en.wikipedia.org/wiki/Flag_of_the_Jewish_Autonomous_Oblast

Anonymous ID: 2da63c Feb. 21, 2024, 5:10 a.m. No.20451021 🗄️.is 🔗kun >>1051

Let's just go with superstition, that'll work

>>20451014

Kek…..Jews invented a racist computer program

>>20451019

But Anon's the Shill…

Anonymous ID: e4dc25 Feb. 21, 2024, 5:11 a.m. No.20451024 🗄️.is 🔗kun >>1030

By far the most beautiful woman ever posted on this board.

>>20451017

>Sweden's National Preparedness Manual "If Crisis or War Comes" (in English)

2 of 3

>>20451017

>Sweden's National Preparedness Manual "If Crisis or War Comes" (in English)

3 of 3

>>20450963

>'Scranton Joe' flies to California to tap Hollywood elite and top up his $130M war chest: Biden heads to $250,000-a-head

fundraiser

Busted Dirty Cop Under Color of Law

https://www.youtube.com/watch?v=rmu4t-Zbwms

Anonymous ID: 861af2 Feb. 21, 2024, 5:14 a.m. No.20451030 🗄️.is 🔗kun >>1039

>>20451024

i don't know what kind of drugs your on, but i

agree with you entirely.

Anonymous ID: 842871 Feb. 21, 2024, 5:14 a.m. No.20451031 🗄️.is 🔗kun >>1048

>>20451009

THATS A GREAT ARGUMENT ESPECIALLY IN THE CONTEXT OF CURRENT EVENTS

Unfortunately the rules abroad are no better.

In fact, who put Biden in the White House?

Who's Media sends the 4AM talking points?

>>20450999

Screen cap!

US elections will not happen this year

Biden will be crowned King of the Jews in Jan 2025

https://t.me/WeTheMedia/97680

NEW SUBSTACK:

Is Adrenochrome a Drug? Yup

Scientists Already Proved it (And Used It)

https://juliansrum.substack.com/p/is-adrenochrome-a-drug-yup

GM fam

>>20450942

Indiana DCS is trafficking children through foster homes. No sauce- very sorry. I know people that know people…

tyb

o7

Anonymous ID: e4dc25 Feb. 21, 2024, 5:17 a.m. No.20451039 🗄️.is 🔗kun >>1084

>>20451030

Reishi tincture with a dab of Turkey Tail with coffee.

gm

>>20450965

>Any more than any other student at Cal?

The ones that haven't died of a drug overdose?

Feb 21 2018 #803

>>20451028

Fake dental laminates

They are snaggletoothed lizards underneath

Ask it to depict a dead white male.

Just curious.

Pervert<Posess<Progress

Problem<Reaction<Solution

TheY only have one MO to control.

Ridiculous Bullshit.

>>20450965

>Drug addict?

I'm going to say dying of a drug overdose puts you into a category of drug addict PAST your average Cal student.

@disclosetv 12m

NOW -Massive farmer protest paralyzes Madrid, Spain.

https://gab.com/disclosetv/posts/111969619148664490

Anonymous ID: 3d3260 Feb. 21, 2024, 5:19 a.m. No.20451048 🗄️.is 🔗kun >>1082

>>20451031

>Who's Media sends the 4AM talking points?

Bitcoin Jesus

Anon's need to give Bitcoin Jesus some Legal arguments to protect Julian Assange.

"Held without Bond" = Slavery

"Innocent until proven guilty" + 13th Amendment

Section 1.

Neither slavery nor involuntary servitude, except as a punishment for crime whereof the party shall have been duly convicted, shall exist within the United States, or any place subject to their jurisdiction.

Section 2.

Congress shall have power to enforce this article by appropriate legislation.

https://constitutioncenter.org/the-constitution/amendments/amendment-xiii

No conviction, no jail.

>>20451047

For anyone to believe these are farmers just shows how stupid all of humanity is.

>>20451021

>Switching arms for vaccines could help boost your immunity, study finds

study finds…

https://t.me/jermwarfare/20154

The WHO now says it didn't impose anything on anybody, anywhere.

Like I said, history is being rewritten in front of us.

>>20451053

The WHO is a bunch of dumbasses

They thought handing out condoms in Africa would solve all the problems there

Anonymous ID: 5fd294 Feb. 21, 2024, 5:23 a.m. No.20451056 🗄️.is 🔗kun >>1066

Angela Chao's first husband was also a billionaire. He died in 2009, just months after they wed…

Chao had previously been married to billionaire banker Bruce Wasserstein.

He died in 2009, just months after they wed, following a stint in the hospital for an irregular heartbeat.

"Mr. Wasserstein is survived by his wife, Angela Chao, an executive at her family’s shipping company and the sister of Elaine Chao, the former labor secretary, and seven children. He adopted the daughter of his sister, the Pulitzer Prize-winning playwright Wendy Wasserstein, who died in 2006. He was divorced three times."

https://www.nytimes.com/2009/10/15/business/15wasserstein.html

Most recent husband:

Jim Breyer

https://en.wikipedia.org/wiki/Jim_Breyer

Anonymous ID: 12f20d Feb. 21, 2024, 5:23 a.m. No.20451057 🗄️.is 🔗kun >>1077

tyb

Anonymous ID: 3d3260 Feb. 21, 2024, 5:24 a.m. No.20451059 🗄️.is 🔗kun >>1298

>>20451053

They didn't

It was the un-elected Big-Titted bitches at your County Health Department that are funded by mandatory childhood vaccines for public school attendance that made the Mandates.

It was the local police that brought guns in to back up those cunts.

Anonymous ID: 7346f1 Feb. 21, 2024, 5:24 a.m. No.20451060 🗄️.is 🔗kun >>1070

A note to U.S. citizens:

The U.S. has lost hundreds of millions of taxpayer dollars in military equipment this week alone as it continues a pattern of losing its footing in the middle east.

2 drones, each valued at 30 million plus, and 400 million dollars in surface to air missiles that did no measurable damage to any target.

The total cost of their current pattern of aggression has reached several billion in taxpayer funds this year, with no measurable success or even an idea of a success they want to achieve.

They are simply indiscriminately firing weapons, in order to make more weapons. So they can bill taxpayers for more weapons; and keep defense stocks growing.

https://downdetector.com/

Bangin the opposing counsel

That's not conflict of interest

That's getting screwed ….legally….

>>20451056

>Bruce Wasserstein.

>GM fam

Anonymous ID: 2e5338 Feb. 21, 2024, 5:25 a.m. No.20451069 🗄️.is 🔗kun >>1259

https://twitter.com/realMikeLindell/status/1759992973234745478

Mike Lindell

@realMikeLindell

"Could Ronna's Replacement Already Be Involved In Election Fraud?" To watch the entire interview, click here: https://frankspeech.com/Video/could-ronnas-replacement-already-be-involved-in-election-fraud

@EmeraldRobinson

6:26 AM · Feb 20, 2024

·

19.5K

Views

>>20451060

"We're gonna need to check the DEI stats and PT scores of the members of those units."

Perhaps assigning more black, lesbian, marathoners from Kenya will fix the accountability issues?

https://t.me/PepeDeluxed/55879

Trucker Says Boycotting New York City Is Bigger Than Trump

Has more contempt with complaining truck drivers that won't stand up but still complain

>>20451061

I don't feel, I know, both online and IRL. Don't care though, not in the slightest. Clowns have developed at least two personas devoted to imitation before one decided to LARP as a peddler of fraudulent absolution.

Anonymous ID: 5fd294 Feb. 21, 2024, 5:27 a.m. No.20451074 🗄️.is 🔗kun >>1076

Canadian law could soon see Christians jailed for quoting the Bible

https://www.campaignlifecoalition.com/clc-blog/id/348/title/bill-c-367-threatens-christian-speech

Bill C-367 Threatens Christian Speech

Should Christians be arrested for quoting portions of the Bible in public? Should pastors be charged with a “hate crime” when they preach against certain sins? Should churches be closed if the government does not approve of their beliefs?

You might think these are ridiculous questions. After all, this is Canada – the “true north strong and free”! Our national motto is “a mari usque ad mare”, quoted from Psalm 72:8, which says that Christ shall have dominion “from sea to sea”. This is not communist China!

However, with the introduction of Bill C-367, all these questions are on the table. I call this bill the “Closet the Christians Bill”, because that is exactly what it intends to do – put Christians in the closet. Under threat of jail-time, it will silence believers who oppose the woke ideology that is overrunning our country.

This repressive, christophobic proposal from Bloc Québécois leader Yves-François Blanchet is currently before Parliament and may be voted on shortly. If the Trudeau Liberals support this bill, it will most certainly pass, striking a fatal blow against freedom of religion and freedom of expression in this Dominion.

Bloc Québécois leader Yves-François Blanchet 

We need to speak up while we still can and call on our Members of Parliament to reject Bill C-367. You can do that right now via our Action Alert Email page.

Christians know the Bible is a powerful book. As someone once said, “When you open your Bible, God opens His mouth.” It is a book full of hope, wisdom, peace, and God’s message of salvation. However, the Bible is also a book of warning and correction for those who wander astray. It’s a book that tells us: “Say to them: ‘As I live,’ says the Lord God, ‘I have no pleasure in the death of the wicked, but that the wicked turn from his way and live. Turn, turn from your evil ways!’” (Ezekiel 33:11).

For some people in Canada, the Bible’s message is an affront to their lifestyle and pride. They don’t want to hear it, their consciences can’t tolerate it, and they will try to silence those who proclaim it.

For example, LGBT activists have gone after one courageous Christian named Bill Whatcott for many years, whom they accuse of “hate crimes” against homosexuals. When he handed out leaflets that warned about the medical and spiritual dangers of LGBT practices at the Toronto “pride parade” in 2016, those LGBT activists were furious. They clamoured for his arrest in 2018 under the government of Kathleen Wynne, who was then-premier of Ontario and an open lesbian.

p1

Anonymous ID: 91ec13 Feb. 21, 2024, 5:28 a.m. No.20451075 🗄️.is 🔗kun >>1100

CEO of Moderna was also the CEO of the company that built the Wuhan lab?

The NIH co owns the Moderna Covid 19 patent?

>>20451074

Mr. Whatcott went to trial two years later and was finally found not guilty in December of 2021. However, the government of Doug Ford has appealed his acquittal and is continuing to prosecute Mr. Whatcott for sharing what the Bible says about sexual sin.

A number of Canadian pastors have also faced “hate crime” charges for their public witness against sexual immorality and child sexualization. Pastor Derek Reimer and Pastor David Lynn are just two examples, both of whom were vindicated from the accusation of “hate”.

So far, “hate crime” charges against Christians have been very difficult to prove because of an important protection in our Canadian Criminal Code. There is a “religious exemption” in Section 319 that states: “No person shall be convicted of a [hate crime] offence… if, in good faith, the person expressed or attempted to establish by an argument an opinion on a religious subject or an opinion based on a belief in a religious text.”

In other words, if you are saying what the Bible says about sexuality, gender, marriage, family, or anything – no matter how unpopular, offensive, or “hateful” it might sound to someone else, you have the freedom to express yourself under Canadian law. Christians have the right to quote the Bible in Canada.

The Holy Bible 

But if Bill C-367 passes, that protection will be removed from the Criminal Code. We will then expect to see a flurry of charges against pastors, churches, Christian organizations, and ordinary believers who dare to speak the truth in love in the public square. This will, in turn, create a chilling effect that will diminish everyone’s freedom of speech.

No longer will we be allowed to share God’s design for human sexuality and marriage in public. No longer will we be able to speak out in the name of God against drag shows for kids, child drag, or child sex change. All this could be misconstrued as “hate speech” against the LGBT community. Even our pro-life message could be spun as a “hate crime” against women.

Christians may possibly be charged for claiming that Jesus is “the way, the truth, and the life” (John 14:6), because it discriminates against other religions. In fact, to criticize the teachings and practices of other religions may be tantamount to a “hate crime”! Will pastors who refuse to comply be hauled off to prison from their pulpits?

The ostensible reason for Bill C-367 is the recent rise in antisemitic demonstrations in Canada. Some politicians would claim extremists are being allowed to call for the annihilation of the Jews because our Criminal Code protects religious speech, so religious speech must be silenced. But, really, this is just an excuse for an opportunistic attack on the religious freedom of Christians (and other faiths too).

But is the answer to antisemitic rhetoric in Canada the elimination of everyone’s religious freedom? Rather, if the government truly believes that someone is advocating or promoting the annihilation of Jews, should it not enforce existing laws which already make that illegal? It is already illegal to advocate genocide according to Section 318 of the Criminal Code! Clearly, this proposal is just a cynical attack on people of faith by the anti-religious Bloc Québécois leader.

In fact, if Bill C-367 were to pass, I can almost guarantee you that antisemitic demonstrations would still be permitted to continue as “political” protests, while the changes to the Criminal Code would be used to prosecute Christian pastors and laypeople for proclaiming Bible-based truths about sexual morality. In time, Jewish rabbis and Muslim imams would not be exempt, and they would also come under the hammer of the state.

No, Bill C-367 is a dangerous threat to every citizen’s freedom of expression and religion. It will only serve the nefarious agenda of pro-LGBT activists and christophobic politicians who want to impose their woke ideology on our country and silence all opposition.

Bill C-367 must be stopped, and we need your help to stop it! Take a moment to send an Action Alert Email to your Member of Parliament today and ask him or her to stand up for our right to share our Christian values and beliefs in the public square. 

If we want to keep Canada free – both for ourselves and our children – we need to speak up now.

Urge your MP to reject Bill C-367 here: https://www.votervoice.net/CALIFE/Campaigns/112075/Respond

2 of 2

Anonymous ID: 253aca Feb. 21, 2024, 5:28 a.m. No.20451077 🗄️.is 🔗kun >>1101

>>20451057

cody?

>>20451071

TRUCKER BOYCOTT Causes 30% Receiver Fee INCREASE For NYC Load Deliveries: Food Prices To SURGE

https://www.youtube.com/watch?v=CTMzG5ushKI

Starve them fucking Jews out boys!!

Whoo Hoo!

Just like the Nazis back in the Day.

https://twitter.com/MarioNawfal/status/1760211246903644618

Mario Nawfal

@MarioNawfal

🚨BILLIONAIRES' APOCALYPSE BUNKERS NOW HAVE FIRE MOATS AND DECONTAMINATION ROOMS

From Mark Zuckerberg's $100 million fortress in Hawaii to Peter Thiel's New Zealand hideaway, billionaires are sparing no expense on survival bunkers.

The ultra-rich are focusing on survival, pouring millions into bunkers now reportedly with fire moats, water cannons, MRI machines, and even a parking spot for a submarine.

What do they know that we don't?

Source: Vice

Quote

Mario Nawfal

@MarioNawfal

·

Jan 20

🚨CELEB BUNKER BOOM: MULTI-MILLION DOLLAR DOOMSDAY PLANS REVEALED

Mark Zuckerberg reportedly tops the list with a $270-million Hawaiian bunker haven, while Rick Ross is said to rival Elon Musk with his own subterranean sanctuary.

Taylor Swift allegedly joins the fray, her…

1:53 AM · Feb 21, 2024

TYB

Anonymous ID: 842871 Feb. 21, 2024, 5:31 a.m. No.20451082 🗄️.is 🔗kun >>1139

>>20450895

tyb

What do they mean when they write "bang"?

That always meant fuck? didn't it?

>>20449206 lb

>>20448929 pb

how did Laura "give herself away"?

She was obviously pushing the line of the "woman don't like revenge" BS

ekkkekk

>>20450967

Seem like the mainstream has been pushing massive fear regarding alleged "Trump Revenge"

>>20450953

FALSE

>>20450967

wow, as if woman don't themselves do revenge! Ur right.

But woman often have different strategies from a man? emotional blackmail, poison?

turn the child against (but men do that too; espeically in the age of alleged equality between men and woman!

Men are more likely to use a gun. Woman use a car?; i.e. Laura Bush.

>>20450958

need to see the details on the EnGore Ghoul

>>20451048

seems very simple. for people who can read.

Truth is short. Lies go on a long time (form of distraction - dig to the premises and cut the crap - that's why they control the speech and voting machines and filabuster.

>>20451039

Anonymous ID: 025619 Feb. 21, 2024, 5:32 a.m. No.20451085 🗄️.is 🔗kun >>1217

Machu Picchu was built by giants using fallen angel technology in an attempt to survive the coming flood. The remote location, altitude and a building technique all designed to be barrier, still failed to stop the deluge from wiping them out. Incas tell that these buildings and walls were there before they arrived. (You can see Inca building techniques on top of the original wall).

Gitmo express on route to deliver some new guests

>>20451028

Anonymous ID: eec9d6 Feb. 21, 2024, 5:33 a.m. No.20451090 🗄️.is 🔗kun >>1123

Spot the new "Parade Route"…

Danish farmers must cut production to achieve climate goal, says government advisor

Feb 21st, 07:26:46

COPENHAGEN (Reuters) - Denmark's farmers must reduce production by as much as one-fifth by 2030 if the country is to achieve its ambitious climate goals, a government-commissioned group said on Wednesday.

Denmark, a major pork and dairy exporter, could become the first country in the world to levy an emissions tax on farming, a move that has broad political backing in the country, after New Zealand last year pushed back such a tax to the end of 2025.

The agriculture sector has become a political battleground as the European Union strives to meet its net zero emissions target by 2050. Farmers across the bloc have been protesting for weeks, saying they are facing rising costs and taxes, red tape, and excessive environmental rules.

https://PiQSuite.com/reuters/danish-farmers-must-cut-production-to-achieve-climate-goal-says-government-advisor

"Accidental (fake) emergency broadcast bulletin about nuclear attack on CONUS lists 8 cities that get nuked. Is one yours?"

https://www.bitchute.com/video/QVwJKjG4Bvqv/

"Apparently was broadcasted to some people in the North East part of the United States.

10 hours ago at least. Must be some really slow missiles. Traveling at the speed of a fart.

What bullshit.

But they shot down 4 of them! There goes all the water and the toilet paper again. Stand by for videos on this channel of dumb asses fighting over hot pockets and pop tarts at grocery stores."

https://x.com/nbcnews/status/1760295901673693659

Lizard comms are the best comms.

Anonymous ID: a77130 Feb. 21, 2024, 5:35 a.m. No.20451097 🗄️.is 🔗kun >>1238

https://en.wikipedia.org/wiki/Jewish_Autonomous_Oblast

Judaism, despite being the associated religion of the oblast's titular ethnoreligious group, is practiced by just 1% of the population, which is only slightly higher than the national average and is close to that of communities in other federal subjects.

Gm

Stollen

>>20451075

CFO James Mock and Margaret Sanger.

Creepy shit indeed.

>>20451077

dubs chkd

https://www.express.co.uk/news/world/1868460/argentina-milei-inflation-government-surplus

Argentina's hard-Right leader sees nation in first monthly surplus for a year

The South American country's new president has introduced sweeping measures to curb government spending and inflation - but time will tell if the strategy will pay off.

Javier Milei

The Argentine government last month saw its first monthly budget surplus in over a decade following the election of a new far-right leader - but at great cost.

President Javier Milei is continuing to push for substantial spending cuts, his Economy Ministry announced, as his first full month in office ends with an improved budget but many economic issues are still unchecked. Public sector finances ended January with $589million at the official exchange rate, the government said late Friday.

This includes payment of interest on the public debt. The Economy Ministry said in a statement to the Telam news agency it is “the first (monthly) financial surplus since August 2012, and the first surplus for a January since 2011.”

Anonymous ID: 027456 Feb. 21, 2024, 5:37 a.m. No.20451105 🗄️.is 🔗kun >>1155

morn'n baker requesting handoff

got about 25 min till i gotta wurkfag

Anonymous ID: 433042 Feb. 21, 2024, 5:39 a.m. No.20451108 🗄️.is 🔗kun >>1134

Perfect boomerang indeed.

Anonymous ID: 468561 Feb. 21, 2024, 5:40 a.m. No.20451110 🗄️.is 🔗kun >>1512

>>20451093

>https://www.bitchute.com/video/QVwJKjG4Bvqv/

https://t.me/WesternJournal/31903

Dem Sen. Bob Menendez Showed Off Money-Filled Safe to Nude Lover 15 Years Before FBI Gold Bars Raid, According to Dossier

READ: http://w-j.co/s/02db4

Anonymous ID: 7346f1 Feb. 21, 2024, 5:41 a.m. No.20451112 🗄️.is 🔗kun >>1114

Egypt has officially joined a growing list of countries to abandon the U.S. dollar entirely. It enacted this yesterday, and will no longer accept the U.S. dollar as a trade currency whatsoever.

>>20451112

hmmmm… does not necessarily seem like a good thing.

Biden Family Business Tied to $Trillions in Lithium Acquired by China through U.S. Afghanistan Withdrawal

ByJon Fleetwood September 11, 2021

The Biden family profits from the U.S. withdrawal from Afghanistan and China’s subsequent acquisition of Afghanistan’s lithium.

QUICK FACTS:

Hunter Biden owns 10% of Chinese state-owned private equity firm Bohai Harvest RST.

Bohai Harvest owns Contemporary Amprex Technology Co. Limited, the world’s largest lithium-ion battery maker.

Days before Biden’s Afghan withdrawal, Contemporary Amprex Technology announced it was soon to raise $9 billion to fund six projects aimed at boosting its production capacity of lithium-ion batteries.

Biden’s withdrawal from Afghanistan left the country’s $3 trillion in lithium reserves to Taliban-friendly China and its state-controlled equity firms like Hunter Biden’s Bohai, which owns the world’s largest lithium-ion battery maker.

Article continues with a detailed and useful timeline. Here is the relevant excerpt.

Biden’s administration disastrously withdrew U.S. troops from Afghanistan in mid-August 2021.

Only days after the U.S. military withdrew from Afghanistan, the Taliban took control of major cities and installed themselves in the presidential palace in Kabul.

The Biden admin. left billions of dollars worth of U.S. weaponry to be seized by the Taliban.

In early September 2021, the Taliban announced a partnership with China, namely that China will be their “main partner” in helping rebuild Afghanistan. The Taliban have an interest in China’s Belt and Road Initiative and see it as a revival of the ancient Silk Road, according to The Post Millennial.

Taliban announces partnership with Chinahttps://t.co/EXnsxbqJq4

— Dinesh D'Souza (@DineshDSouza) September 3, 2021

Biden’s withdrawal ultimately handed Afghanistan’s valued $3 trillion lithium reserves (here) to China.

https://americanfaith.com/biden-family-business-tied-to-trillions-in-lithium-acquired-by-china-through-u-s-afghanistan-withdrawal/

>>20451014

>completely eliminate and erase whitey as well as like-minded dissidents from history

>all worker bees and foot soldiers will be a mixed mud race

>ruling class will run everything behind the scenes through their merger with sentient conscious vessels that are now immortal gods with not diseases or sickness for them only

>brave new world

Anonymous ID: 91ec13 Feb. 21, 2024, 5:44 a.m. No.20451118 🗄️.is 🔗kun >>1121

The direct translation of Bloodclaat is Blood Cloth, meaning the sanitary napkin that females use during their menstrual cycle.

Antidote to Graphene Contamination/PollutionLB

According to a 2014 study by Hu, Mu, Kang, Zhou, et. al., and subsequent confirmations publisheded by this leading Chinese research team, “Humic Acid Acts as a Natural Antidote of Graphene by Regulating Nanomaterial Translocation and Metabolic Fluxes

https://medicalveritas.org/graphene-antidote-for-covid-vaccine-nano-bioelectronic-intoxication-for-prevention-and-recovery/

A cure for the chyna virus vax from a chinese guy…

Grift

https://twitter.com/LizLemeryJoy/status/1760126567802401001

Liz Joy

@LizLemeryJoy

🚨Attention all NY Parents. A NY Bill that takes away your parental rights. Every New Yorker needs to know about this Bill!

3:17 PM · Feb 20, 2024

·

5,718

Views

Anonymous ID: 91ec13 Feb. 21, 2024, 5:45 a.m. No.20451121 🗄️.is 🔗kun >>1157

>>20451118

sauce link pls

>>20451090

TUCKER CARLSON can speak, and the COMMON MAN, in the rarefied air of the elites, because he has all the sanctimonious credibility from being raised IN the American Nobility of Opus DEI infiltrated "Catholicsish" Institutions of the Church, and it's Government appendages like the CIA and the NSA.

Tucker is "one of them" gently asking very gentile questions about the enslavement of the Common Man in what WAS originally established as a Nation Free from the Forced Religions,Tax Mandates, and Debtors Prisons found in every other MONARCHY in the world.

The Globalists all skip over the DoI, the US Constitution, and Bill of Rights as meaningless pieces of pape, relevant only before the Divine 9 in the SCOTUS and their Pretty Poodles.

Like the BO here.

>>20450945

https://twitter.com/OldRowOfficial/status/1760087967937290690

Old Row

@OldRowOfficial

This is what they stole from you.

Quote

Historic Vids

@historyinmemes

·

23h

Air conditioned lawnmower, 1957

Image

12:44 PM · Feb 20, 2024

·

55.8K

Views

20 posts on Feb 21

>>20451078

TRUCKER BOYCOTT Causes 30% Receiver Fee INCREASE For NYC Load Deliveries

Anons want her

Killed in Prison by Lethal Injection

US Prisons have vaccine mandates?

Julian gonna get "The Kill Shot"?

https://www.businesswire.com/news/home/20230912456530/en/Echodyne-Receives-FCC-Authorization-for-High-Accuracy-EchoShield-Radar/

Echodyne Receives FCC Authorization for High-Accuracy EchoShield Radar

Demand for high-performance radar growing across all customer markets and applications

September 12, 2023 03:00 AM Eastern Daylight Time

SEATTLE(BUSINESS WIRE)Echodyne, the radar platform company, today announces it has received Federal Communications Commission (FCC) Authorization for its EchoShield radar. The FCC Authorization allows EchoShield to be used for non-experimental purposes and arrives as demand for its breakthrough radars grows across all markets and applications. Echodyne’s software-defined, multi-mission, commercial-off-the-shelf (COTS) radars are used for situational awareness by Defense, Government, and Critical Infrastructure customers, and as a navigational sensor by Advanced Air Mobility (AAM) and Uncrewed Aircraft Systems (UAS) markets.

>>20451108

Feb 21

Highest Ranking Narcissist ID: 59821f Feb. 21, 2024, 5:49 a.m. No.20451136 🗄️.is 🔗kun >>1156 >>1162

>>20451082

>Truth is short. Lies go on a long time (form of distraction - dig to the premises and cut the crap - that's why the controlers censor the speech and rig the voting machines and use the filabuster to avoid facing the music)

Turn the child against (but men do that too; espeically in the age of alleged equality between men and woman!)

Probably both genders do that; for a long time.

In the 19th c. and early 20th it would be men mostly, since men controlled woman back them. It was a custom.

So more likely man would take the child, if he could and wanted to; and turn it against mother.

This happened in the case of Klaus Schwab. His Dad was a NAZI and took Klaus, Klaus' mother sent into exile and never mentioned (she was Jewish , so NAZI had to hide her)

>>20449206 lb

>>20448929 pb

how did Laura "give herself away"?

She was obviously pushing the line of the "woman don't like revenge" BS

Women might be more conflict averse; plot secretly, appear innocent, and are afraid of Trump's image, as presented by the Mass Media.

Used to be woman liked to appear innocent; Now they are supposed to look badASS?

True?

"Who you are" is by large extent; created.

So the communist attempt to create a generations where there is no gender.

alleged equality, but no specializtion.

It's a commie totalitarian "One World Order" goal

A. W. Watts explains how the image of self is often largely self-created rather then intrinsic?

(in the 60's naturally)

lecture linked

Self-identity is somewhat fungible;

https://tora3.com/video/450db53f2f0500834040a0e2d8e331eb

woman who had bad experiences with their fathers, would be most affected by the straw man projected by the Trump-haters.

Past trauma could be triggered?

You can tell by the way that judge Engoron acts he has a criminal mind. Just like those clowns down in Georgia. That is the jist of the current problem, criminal minds have crept into the wheelhouses of power and are steaming the ship of state towards the rocks.

https://www.techrxiv.org/doi/full/10.36227/techrxiv.22704643.v1

Radar-based Human Activity Recognition: Is it Ready for Aging in Place?

bioengineeringcomputing and processingsignal processing and analysis

Anonymous ID: c1e4e9 Feb. 21, 2024, 5:50 a.m. No.20451142 🗄️.is 🔗kun >>1145

Splash

Anonymous ID: 1432d6 Feb. 21, 2024, 5:51 a.m. No.20451144 🗄️.is 🔗kun >>1164

>>20451126

Rolling terrarium vs A/C? Mower would need its own nuke to power that gradient.

>>20451142

https://www.embs.org/jtehm/articles/passive-radar-opportunistic-monitoring-e-health-applications/

Passive Radar for Opportunistic Monitoring in e-Health Applications

This paper proposes a passive Doppler radar as a non-contact sensing method to capture human body movements, recognize respiration, and physical activities in e-Health applications. The system uses existing in-home wireless signal as the source to interpret human activity. This paper shows that passive radar is a novel solution for multiple healthcare applications which complements traditional smart home sensor systems. An innovative two-stage signal processing framework is outlined to enable the multi-purpose monitoring function. The first stage is to obtain premier Doppler information by using the high speed passive radar signal processing. The second stage is the functional signal processing including micro Doppler extraction for breathing detection and support vector machine classifier for physical activity recognition. The experimental results show that the proposed system provides adequate performance for both purposes, and prove that non-contact passive Doppler radar is a complementary technology to meet the challenges of future healthcare applications.

Anonymous ID: 3d3260 Feb. 21, 2024, 5:53 a.m. No.20451147 🗄️.is 🔗kun >>1169

>>20451098

The JAO was designated by a Soviet official decree in 1928, and officially established in 1934. At its height, in the late 1940s, the Jewish population in the region peaked around 46,000–50,000, approximately 25% of its population.[14] By 1959, its Jewish population had fallen by half.

Article 65 of the Constitution of Russia provides that the JAO is Russia's only autonomous oblast. It is one of two officially Jewish jurisdictions in the world, the other being Israel.

The Soviet government entertained the idea of resettling all Jews in the USSR in a designated territory where they would be able to pursue a lifestyle that was "socialist in content and national in form". The Russians also wanted to offer an alternative to Zionism, the establishment of the Mandate of Palestine as a Jewish homeland

After the war ended in 1945, there was renewed interest in the idea of Birobidzhan as a potential home for Jewish refugees. The Jewish population in the region peaked at around 46,000–50,000 Jews in 1948, around 25% of the entire population of the JAO.[14]

. In 1991, after the breakup of the Soviet Union, the Jewish Autonomous Oblast became the federal subject of Russia and thus was no longer subordinated to Khabarovsk Krai. However, by that time, most of the Jews had emigrated from the Soviet Union

https://en.wikipedia.org/wiki/Jewish_Autonomous_Oblast

The ones that left went to Israel. They can go back too,

https://www.nbcnews.com/politics/justice-department/ex-fbi-agent-feds-say-urged-jan-6-rioters-kill-police-worked-terrorism-rcna82775

Ex-FBI agent who feds say urged Jan. 6 rioters to kill police worked terrorism task force

Jared Wise was part of the FBI's Joint Terrorism Task Force and was supervisory special agent in charge of the Homegrown Violent Extremism unit.

Anonymous ID: eec9d6 Feb. 21, 2024, 5:53 a.m. No.20451149 🗄️.is 🔗kun >>1174

I thought it was a fucked up AI version of AOC

9:00 AM EST

China in the Global South: Development and Influence in a Shifting Global Order - Day 1

Atlantic Council

https://www.atlanticcouncil.org/event/china-in-the-global-south/

https://www.youtube.com/watch?v=i7wfhnoP2jw

-

TBD

Discussion on China's Influence Across Global South

Panelists from the U.S. government, academia, and private sector discuss China’s influence across the Global South at the Atlantic Council in Washington, DC.

https://www.c-span.org/video/?533705-1/discussion-chinas-influence-global-south

I'm sure the namefagging HRN thinks he's taking something. His coworker burnt out from 8 months of that routine and now runs a fraudulent absolution script, so I'm sure the new namefagger is going to have an even worse time. They're just pixels.

Anonymous ID: 91ec13 Feb. 21, 2024, 5:54 a.m. No.20451154 🗄️.is 🔗kun >>1187

https://t.me/CIG_telegram/43465

An Israeli citizen threw the Polish flag in the mud at the Hrebenne crossing with Ukraine during a farmers' demonstration

Those who witnessed the action held the Israeli accountable forcing to lift the flag and put it back.

Anonymous ID: 027456 Feb. 21, 2024, 5:55 a.m. No.20451155 🗄️.is 🔗kun >>1487

>>20451105

baker has toghost

notes are guud up to this post

notables bun @215

czech em and have a good day

#25088 >>20450903

>>20450934 Dr. Phil Shares an Explosive Interview w/ Border Patrol Showing American Taxpayers Are Funding the Trafficking of Migrant Children Into S** Slavery

>>20450942, >>20450959 Catholic Indiana couple appeals to Supreme Court after their child was taken from them after they refused to refer to him as his preferred pronouns.

>>20450950 Under the fog of war, Ukraine cancels its 2024 presidential elections

>>20450954 Absolute horror story out of Lakewood, Colorado. A middle school staff member is accused of multiple sexual assaults on male students…

>>20451017, >>20451025, >>20451026 Sweden's National Preparedness Manual "If Crisis or War Comes" (in English)

>>20451047 Massive farmer protest paralyzes Madrid, Spain.

>>20451071, >>20451078 Trucker Says Boycotting New York City Is Bigger Than Trump - Causes 30% Receiver Fee INCREASE For NYC Load Deliveries: Food Prices To SURGE

>>20451103 Argentina under Milei: The Economy Ministry said: “the first (monthly) financial surplus since August 2012, and the first surplus for a January since 2011.”

>>20451120 Liz Joy w/CAP: Attention all NY Parents. A NY Bill that takes away your parental rights. Every New Yorker needs to know about this Bill!

>>20451136

oops muh narrative

>>20451121

kEK

Well, that certainly busts a trend…

Switzerland to ban Hamas after Israel attacks

Feb 21st, 07:47:31

ZURICH (Reuters) - Switzerland's government said on Wednesday it wants to ban Hamas after the Palestinian militant group's attacks in Israel last year which killed nearly 1,200 people and sparked a war in Gaza.

Bern said it was taking action after the attacks on October 7 which killed two Swiss nationals and resulted in nearly 250 people being taken hostage.

In response, Israel launched a military assault on Gaza that local health authorities say has killed nearly 29,000 Palestinians with thousands more feared lost amid the ruins.

The Swiss government said under the new legislation Hamas and "cover or successor organisations" as well as organisations or groups that act on its behalf or in its name will be banned.

https://PiQSuite.com/reuters/switzerland-to-ban-hamas-after-israel-attacks

THANK YOU ANON

knew one of you would get it

The Israeli civil administration in the territories constructed the hospital complex's Building Number 2, which has a large cement basement that housed the hospital's laundry and various administrative services.

Is that an aoc clone? They all get chipped n cloned.

Anonymous ID: d06ed7 Feb. 21, 2024, 5:55 a.m. No.20451162 🗄️.is 🔗kun >>1226

>>20451136

>>20451144

exhaust indicates good ol' fashioned horsepower

before the government stepped in with all the tree hugging hippie regulations and mommas crying because cars were just too powerful

Panama Canal suffering major disruption | BBC News

https://youtu.be/UnW7v3L_2s4

>>20451120

Remember when we didn't have to know about every bill because we had elected representatives who did that for us? What happened to the congresses? Why are they working against us?

21 Feb, 2024 12:53

Lavrov comments on Russian favorite in race for White House

Neither contender is willing to course-correct bilateral relations, the top diplomat said

Russia is interested in policies, not personalities, and has no expectation that the US intends to change its antagonistic stance, regardless of who wins the November presidential election, Russian Foreign Minister Sergey Lavrov told Brazilian media on Tuesday.

The top diplomat was asked whether Moscow preferred a return of Donald Trump to the White House next year over President Joe Biden staying in office. The interviewer from the Globo media group cited opinions that a new Trump presidency would make it easier to wrap up the Ukraine conflict.

“The ruling elites in the US consider Russia an enemy and a threat regardless of their political affiliation,” Lavrov said.

While Biden “did nothing” in four years to improve relations with Russia, “we do not delude ourselves into expecting the anti-Russian course of the US to change anytime soon,” the minister added.

Claims and counterclaims over which presidential candidate is a “favorite” of Moscow have been an element of US electoral cycles for decades. The ongoing race, in which Biden and Trump are presumed to be nominated by their respective parties, is no different.

While Russian officials traditionally say they will work with whoever American voters choose, Putin somewhat deviated from this position in an interview last week. He said Biden is his preferred candidate, because he is old-school, experienced and predictable.

Allegations that President Trump was backed by Russia and beholden to it, which stemmed from the Democratic Party’s explanation of why Hillary Clinton lost to him in 2016, undermined his administration. Contrary to what his critics claimed, some of the Republican’s actions at the helm were escalatory, such as his decision in 2017 to supply weapons to Ukraine.

Last week, journalists Michael Shellenberger, Matt Taibbi and Alex Gutentag published the first part of their investigation into the ‘Russiagate’ saga. They claim that US intelligence services engaged foreign partners to spy on the Trump campaign and manipulated evidence to create an impression that it had “colluded” with Moscow.

(Interesting pic RT pic, Bidan is tiny compared to Trump and is looking at his watchIs that when they released covid?)

https://www.rt.com/russia/592842-lavrov-preferred-candidate-us/

Anonymous ID: 1432d6 Feb. 21, 2024, 5:57 a.m. No.20451168 🗄️.is 🔗kun >>1209

>>20451164

Kek. Guid luck climbin' dat hill!

But ya gotta luv the dreams!

>>20451147

But flags really are meaningless…

https://www.breitbart.com/2nd-amendment/2024/02/20/remington-ceo-cites-legislative-environment-new-york-company-moves-georgia/

Remington CEO Cites ‘Legislative Environment’

in New York as Company Moves to Georgia

Breitbart 2nd Amendment, by AWR Hawkins

Posted By: Imright, 2/21/2024 8:13:48 AM

Remington is leaving New York, and CEO Ken D’Arcy noted that the direction legislation took in the Empire State was a cause for concern. The Associated Press (AP) noted that D’Arcy used a news release to indicate that New York’s “legislative environment” is concerning to the firearm industry as a whole.The pending closure of Remington’s Ilion, New York, plant — launched in 1828 — marks the end of generations of New Yorkers working for the American gun maker.Jim Conover began working at the Ilion plant in 1964 and continued to work for Remington for four decades. He commented on the pending closure,

>>20451165

My canal too

Why did the US military let Satanists take over our country?

Why is it taking so long to fix this obvious and tragic failure?

Who is in control? Of what?

Highest Ranking Narcissist ID: 59821f Feb. 21, 2024, 5:58 a.m. No.20451173 🗄️.is 🔗kun >>1182

Anonymous ID: a77130 Feb. 21, 2024, 5:58 a.m. No.20451174 🗄️.is 🔗kun >>1198

>>20451149

Anonymous ID: bb42ab Feb. 21, 2024, 5:59 a.m. No.20451176 🗄️.is 🔗kun >>1209

>>20451164

The Club of Rome. The Limits to Growth. 1972

Global takeover.

Anonymous ID: 1432d6 Feb. 21, 2024, 5:59 a.m. No.20451177 🗄️.is 🔗kun >>1188

Italy arrests 12 people over speed boat migrant trips from Tunisia

Feb 21st, 07:58:01

ROME (Reuters) - Italian police said on Wednesday they had arrested 12 suspected human traffickers for allegedly organising high-speed transfers for at least 73 illegal migrants from Tunisia to Europe.

Expert pilots operated the speed boats crossing from Tunisia to Marsala in Sicily between June and September last year, police said in a statement, describing them as "VIP trips".

The traffickers transferred relatively small groups of up to 20 people on each of four trips, charging fees of up to 6,000 euros ($6,500) per person, the statement said.

The trip, on a crowded and less seaworthy vessel, would normally cost under 1,000 euros per migrant, an official with knowledge of the matter said.

Italy and other European governments have taken an increasingly hard line on immigration in recent years amid a surge of arrivals of asylum seekers and undocumented migrants. EU data shows fewer than 100,000 irregular migrants made to it Europe in 2020, but that rose to 250,000 last year.

Six Tunisians and six Italians were detained as part of an investigation coordinated by European police body Europol and the Italian anti-mafia police unit.

The investigators identified a Tunisian former police officer as the head of the trafficking organisation.

https://PiQSuite.com/reuters/italy-arrests-12-people-over-speed-boat-migrant-trips-from-tunisia

Ahoy! The Ship Show & Extra Gravy - 02/21/2024

https://rumble.com/v4etag0-ahoy-the-ship-show-and-extra-gravy-02212024.html

https://rumble.com/embed/v4c80mc/?pub=4

>>20451146

Was around 81

We got an cable TV box

And took it to the electronics lab at work

And found ..equipment that was sending signals back …shielded circuitry…seperate power supplies…and that was 40 yrs ago

Anonymous ID: 1509e8 Feb. 21, 2024, 6:01 a.m. No.20451180 🗄️.is 🔗kun >>1185

The people deserve better.

>>20451173

>>20451098

Also, what's the Demographic representation of Jews and Catholics in the US population?

And what is in on the SCOTUS?

Has the SCOTUS been Opus DEI weighted?

>>20451179

SelecTV

>>20451180

Yea

But still allow Bullshit to be thrown at them daily

New York Mayor Warns Migrants If They Keep Attacking NYPD Officers, They'll Be Downgraded To 4-Star Hotels

Babylon Bee

Article Image

NEW YORK, NY — During a recent press conference, Mayor Eric Adams announced that he will no longer tolerate migrant attacks against NYPD officers, warning that further incidents would result in a downgrade in migrant living accommodations from luxurious 5-star hotels to humble 4-star establishments.

"We're sending a strong, clear message that we mean business," said Mayor Eric Adams sternly. "If you mess with New York's finest, you're going to have to have a slightly less luxurious stay."

"You can kiss those swan-shaped folded bath towels and mints on your pillow goodbye! That's how seriously we take protecting our boys in blue," added Mayor Adams. "No more Mr. Nice-Mayor! Gone are the days of hospitalizing local law enforcement by day and sleeping on 10,000 thread count Egyptian sheets by night!"

According to sources, many New Yorkers have heavily criticized the mayor's new proposal, calling it "a full-blown humanitarian crisis" and a "racist affront to migrant dignity".

"What's next? Taking away their brand new iPhones just because they torched a couple of cop cars?" said one disgruntled citizen. "These migrants just want to feed their families and assault cops without repercussion! What has happened to this once great city?"

At publishing time, Mayor Eric Adams was left with no choice but to threaten to take away the PS5s from any migrant who assaulted a cop.

https://babylonbee.com/news/new-york-mayor-warns-migrants-if-they-keep-attacking-nypd-officers-theyll-be-downgraded-to-living-in-4-star-hotels#google_vignette

>>20451154

>An Israeli citizen threw the Polish flag in the mud at the Hrebenne crossing with Ukraine during a farmers' demonstration. Those who witnessed the action held the Israeli accountable forcing to lift the flag and put it back.

>>20451177

No Names.

Anonymous ID: b41d33 Feb. 21, 2024, 6:02 a.m. No.20451189 🗄️.is 🔗kun >>1197

>>20451184

80s would be time warner

>>20451178

TY Jim

https://www.thegatewaypundit.com/2024/02/bipartisan-group-us-senators-flies-hungary-bully-orban/

Bipartisan Group of US Senators flies to Hungary to bully Orban into approving NATO expansion and guess what? Hungarian politicians refuse to meet with them

Quotes: "Why does NATO even bother pretending that their decisions are “unanimous” when what the U.S. says, goes? If any leader of a NATO-member country dared to even think about voting against U.S. war-making policy, they get slapped with economic sanctions, compliments of a weaponized U.S. dollar."

"And we wonder why the BRICS coalition is growing. Nations are fed up with being bullied by Washington. It really is that simple."

what were those free digital boxes for after 911

>>20451179

User "ping" data. Ask Nielsen Ratings.

>>20451191

>the BRICS coalition is growing

>>20451189

Dont let me down sweet mama

kek

>>20451174

selectv was 78-89 in wisconsin

>>20451193

>>20451159

Loved that!

Nobody likes Nikki. She's a Linda

CLOWNWORLD

Google’s Gemini AI Blasted For Eliminating White People From Image Searches

Paul Joseph Watson

21st February 2024

One comment

Vikings were black, apparently.

https://modernity.news/2024/02/21/googles-gemini-ai-blasted-for-eliminating-white-people-from-image-searches/

>>20451179

Old VHS player would play movie on the t.v. without being connected. Found out by accident as one day some of us were watching a movie and it was noticed the cables/cords had not been connected.

Anonymous ID: 861af2 Feb. 21, 2024, 6:07 a.m. No.20451206 🗄️.is 🔗kun >>1212

>>20451193

refresh my memory…?

https://www.greeleytribune.com/2024/02/18/child-homicide-pueblo-concrete-trunk-suitcase-corena-minjarez/

>>20451168

the vast majority of consumers have cookie cutter homes with nothing but flat area anyway so that'd essentially be a non-issue

plus design changes and engineering could make it possible

people now think they need a $9,000 commercial mower to mow a 1/4 acre with a half foot ditch in the front

>>20451176

think they were the ones behind that computer prediction from 1973 of the end of civilization in 2040-2050 too

vid related

Anonymous ID: 9f2a83 Feb. 21, 2024, 6:08 a.m. No.20451210 🗄️.is 🔗kun >>1221

>>20451187>>20451191

Senate Democrates with a RINO neocon named Thom Tillis.

Anonymous ID: 1954ed Feb. 21, 2024, 6:09 a.m. No.20451212 🗄️.is 🔗kun >>1224

>>20451206

the gov was handing out free boxes that turned analog tv's to digital…it was a push

>>20451191

is gud.

https://www.middleeasteye.net/news/icj-hearing-israel-occupation-palestine-advisory-opinion

Anonymous ID: 2c96fd Feb. 21, 2024, 6:09 a.m. No.20451215 🗄️.is 🔗kun >>1392

>>20451202

POTUS'S greatest speech yet!

I think I might go for a shave.

>>20451085

>Machu Picchu was built by giants using fallen angel technology in an attempt to survive the coming flood.

Anon suspects the Cahokia mounds in Illinois were made for a similar purpose. The Indians living there when De Soto got to North America probably had nothing to do with their construction.

>>20451204

https://x.com/Steve_Sailer/status/1760273943020359945?s=20

Anonymous ID: 91ec13 Feb. 21, 2024, 6:10 a.m. No.20451219 🗄️.is 🔗kun >>1234

>>20451204

>Eliminating White People

> The Babylon Bee

>New York Mayor Warns Migrants If They Keep Attacking NYPD Officers, They'll Be Downgraded To 4-Star Hotels

Anonymous ID: 861af2 Feb. 21, 2024, 6:10 a.m. No.20451221 🗄️.is 🔗kun >>1237

you crane?!

>CLOWNWORLD

AI is retarded.

sounds… familiar. thanks.

Well

It has become apparent

That the peeps that thought

I fell and bonked muh head

Are now understanding

Why I rebuilt an 1982 truck

And dropped a 70s engine in a mid 90s ford

Damn they starting to catch up

>>20451162

Judge Engoron Accused of Banging Secretary of Opposing Counsel in Previous Case

https://www.thegatewaypundit.com/2024/02/judge-engoron-accused-banging-secretary-opposing-counsel-previous/

A Judicial Affair

By Stewart Ain July 26, 2002 12:00 am

"Lewin said in court papers that the law secretary, Arthur Engoron, claims he only began dating the secretary of the opposing counsel, Christopher Sullivan, on May 10. But Lewin said Sullivan’s actions in the case may have been "influenced" by information he received from the woman, identified in the papers only as Sue. And Lewin noted that Engoron "was drafting [later] decisions and communicating" with the judge about this case during the time he was dating Sue."

https://www.jta.org/2002/07/26/ny/a-judicial-affair

ABC World News Tonight with David Muir Full Broadcast - Feb. 20, 2024

Boeing Wing damaged, people had to notify the pilots. Does anyone inspect these planes before take off?

https://youtu.be/sPDWunAdBZY

>>20451165

>Panama Canal suffering major disruption

>>20451228

Ooops, dat may be a repeat. I are a retard.

Anonymous ID: b41d33 Feb. 21, 2024, 6:15 a.m. No.20451234 🗄️.is 🔗kun >>1246

>>20451219

What is the definitions of white people

Gotta be 3 or 4

And what shade of white are these peeps

There are more than 50 shades of white

Dum de dum dum

Dats actually guid news….

James Mayger

@JDMayger

The PBOC released data today showing the amount of Chinese shares owned by overseas investors fell in 2023 for a second straight year

https://www.bloomberg.com/news/articles/2024-02-21/foreign-investors-flee-chinese-shares-long-delayed-data-shows

https://twitter.com/JDMayger/status/1760294597866242469

Anonymous ID: 9f2a83 Feb. 21, 2024, 6:17 a.m. No.20451237 🗄️.is 🔗kun >>1244

>>20451221

no, I rock and I ran

>>20451097

Ba'al is pronounced "Bail"

They Worshipped "Bail"

Because it's Bail or Slavery.

>>20451235

Anonymous ID: 089c73 Feb. 21, 2024, 6:17 a.m. No.20451241 🗄️.is 🔗kun >>1280

>>20451184

Hacking TV ever since….

>>20451230

>Does anyone inspect these planes before take off?

it's standard operating procedure for either the pilot or co-pilot to walk around the plane and look for obvious structural problems… but they absolutely do miss stuff.

especially tough task for night flights, where they have to inspect with flashlights.

>>20451237

Anonymous ID: bb42ab Feb. 21, 2024, 6:19 a.m. No.20451245 🗄️.is 🔗kun >>1249

>>20451126

i like the part where people from 1957 aren't fat.

Anonymous ID: c95042 Feb. 21, 2024, 6:20 a.m. No.20451246 🗄️.is 🔗kun >>1262

>>20451234

Elizabeth Warren got a job at some "elite" university based, I guess on being a POC. If Elizabeth Warren is a POC then anyone can be.

When the wicked speak of Black and White they are not talking of skin tone. They are disguising their evil by calling it "blackness". This is how Bill Clinton could be the first Black President.

Notice that the slogan "Black Lives Matter" doesn't really mention shade of skin. It refers to lives not skin color.

April Color

@ColorApril

Busted 🎯💥 Disgraced Fmr. Mayor deBlasio no one

deserves it more ! 👏👏👏🥰

https://twitter.com/ColorApril/status/1760166968848486750

>>20451061

Before here, had noticed PDJT mis-spelling things. Posted that meme to him.

Anonymous ID: 433042 Feb. 21, 2024, 6:21 a.m. No.20451249 🗄️.is 🔗kun >>1275

>>20451245

Kinda want one just to hotbox the thing while mowing the lawn.

>>20451218

Holeeeeeeeeee shit.

>>20451235

And then it gets so bad that New York elects a Rudy Guilliani and he cleans the place up and makes it safer and than the city, like the proverbial dog, returns to its vomit and goes back to Dem leadership and here we are again.

Goodbye.

>>20451247

want this burger? get jabbed!

… and please, mask up!

Anonymous ID: 433042 Feb. 21, 2024, 6:25 a.m. No.20451256 🗄️.is 🔗kun >>1266

>>20451218

Yeah, their AI is trained to be woke.

>>20451126

A lil fresh air is ok tho..

Anonymous ID: c33627 Feb. 21, 2024, 6:25 a.m. No.20451258 🗄️.is 🔗kun >>1273

What’s the point of sourcing citation sauce?

All of media seems devolved into sewage.

GWP headlines are become Foxesque hyperbolic vomit.

>>20451069

RNC Chair Candidate Michael Whatley Refused to Investigate Fraud in NC

President Trump says that he supports Michael Whatley to be the next RNC Chairman. His tenure atop the NC GOP has been disastrous.

https://nationalfile.com/rnc-chair-candidate-michael-whatley-refused-to-investigate-fraud-in-nc/

>>20451230

I inspect the plane as much as I can from the terminal windows and through the windows inside plane.

>>20451246

Elizabeth Warren ..huh

How in the absolute fuck did we get there

From the definition of white peeps?

>>20451255

Anonymous ID: a45d18 Feb. 21, 2024, 6:26 a.m. No.20451264 🗄️.is 🔗kun >>1284

11:11

>>20451256

This is horrific. Children don’t know the diff. Omg.

NASA Astronomy Picture of the Day

Feb 21, 2024

Seagull Nebula over Pinnacles' Peak

The bird is bigger than the peak. Nicknamed for its avian shape, the Seagull Nebula is an emission nebula on the night sky that is vast, spanning an angle over five times the diameter of the full moon and over 200 light years. The head of the nebula is catalogued as IC 2177, and the star cluster under its right wing is catalogued as NGC 2343. Consisting of mostly red-glowing hydrogen gas, the Seagull Nebula incorporates some dust lanes and is forming stars. The peak over which this Seagull seems to soar occurs at Pinnacles National Park in California, USA. The featured image is a composite of long exposure images of the background sky and short exposure images of the foreground, all taken consecutively with the same camera and from the same location.

https://apod.nasa.gov/apod/astropix.html?

Anonymous ID: 433042 Feb. 21, 2024, 6:28 a.m. No.20451270 🗄️.is 🔗kun >>1647

10:00 AM EST

NPC Headliners: Secretary of Energy Jennifer M. Granholm

National Press Club (NPC)

https://www.press.org/events/npc-headliners-secretary-energy-jennifer-m-granholm

https://www.youtube.com/watch?v=CPduxPB4AsY

-

Energy Secretary Discusses Clean Energy Investment

Energy Secretary Jennifer Granholm discusses the Biden administration’s clean energy policy and infrastructure investment during an event hosted by the National Press Club in Washington, DC.

https://www.c-span.org/video/?533706-1/energy-secretary-discusses-clean-energy-investment

>>20451258

confirmation bias and who the messenger is has taken precedent over the message itself in the current year

>>20451269

Uh-huh…

>>20451249

My previous poast said there’s nothing wrong with a lil fresh air, but I like how you think.

>>20451266

You can fully understand what 'they' do and why they do it, if you understand that everything they do is targeted against children.

They're trying to breed new 'socialized man'.

Anonymous ID: b41d33 Feb. 21, 2024, 6:30 a.m. No.20451279 🗄️.is 🔗kun >>1297

>>20451266

And obviously

There are no parents to teach the huddled morans

>>20451241

SLE44 Emulation - Bootloader

to card EEPROM & unloopers & everything in between. The good old days

KEK

lolwut They're not even trying to hide it anymore.

Anonymous ID: a77130 Feb. 21, 2024, 6:31 a.m. No.20451282 🗄️.is 🔗kun >>1294

>>20451218

Anonymous ID: eec9d6 Feb. 21, 2024, 6:32 a.m. No.20451283 🗄️.is 🔗kun >>1287

>>20451278

5:5

That’s what I meant by horrific n omg.

Those super computers they have need to be melted.

>>20451264

Catchy tune

Start questioning Trump and the security stops. I see how it is.

Michigan wanted homeschool registry for warrantless home entry

February 2024: Michigan State Board Of Education On Homeschool Registry Preparing To Conduct Warrantless Entry To People’s Homes Enrolled In Homeschool

Board Speaking On Michigan Attorney General Dana Nessel: “She basically said, we want this list so that we can have unwarranted home entry, without a warrant. Warrantless home entry into homeschool”

“But whole homeschooling thing is really quite disturbing. And one of the things that disturbs me about this is the disingenuousness of the discussion because we have people like the Senate Education Committee chair, Dayna Polehanki saying that when asked about increasing regulations beyond registration, she said not on my watch.

Well, we got Attorney General Dana Nessel that says that she wants to do it because the foster care system didn't do their job and apparently homeschool parents. Uh, there was some abuse going on at a homeschool home, um, or that actually sounds like the foster care system.

But, certainly, a mere registration, a list of people is not gonna have anything to do or will not help prevent, um, what attorney general Nestle is talking about. So she's already kinda said the quiet part out loud.

She basically said, we want this list so that we can have unwarranted home entry, uh, without a warrant. Warrantless home entry into homeschool into this particular targeted group.”

https://twitter.com/WallStreetApes/status/1760101385549631935

>>20451283

AND these people need the rope STAT.

Anonymous ID: 5da943 Feb. 21, 2024, 6:32 a.m. No.20451288 🗄️.is 🔗kun >>1355

>>20451278

As long as their God is made of paper

And they have to have just one more ….

Oooohhhh. Shiny….

New And improved…usually isn't ..

God bless you and keep you from harm, this day and forever.

Anonymous ID: 3d3260 Feb. 21, 2024, 6:33 a.m. No.20451291 🗄️.is 🔗kun >>1296

>>20451269

>2343

>Meme's Ready?

>Q

>>20451290

You as well Swordy.

10:00 AM EST

Supreme Court October Term 2023 Argument Day

Supreme Court

^

Ohio v. EPA (23A349)

Kinder Morgan, Inc. v. EPA (223A350)

American Forest & Paper Assn. v. EPA (23A351)

U.S. Steel Corp. v. EPA (23A384)

Consolidated

^

Warner Chappell Music, Inc.v. Nealy (22-1078)

^

https://www.supremecourt.gov/oral_arguments/2023TermCourtCalendar.pdf

https://www.supremecourt.gov/oral_arguments/argument_audio/2023

-

10:00 AM EST

Ohio v. EPA

The Supreme Court hears oral argument in Ohio v. EPA, a consolidated case concerning the EPA’s authority to establish national air quality standards.

https://www.c-span.org/video/?533613-1/ohio-v-epa

-

11:00 AM EST

Warner Chappell Music v. Nealy

The Supreme Court hears oral argument in Warner Chappell Music v. Nealy, a case on copyright law and statute of limitations for damages.

https://www.c-span.org/video/?533614-1/warner-chappell-music-v-nealy

>>20451282

Anonymous ID: 182f58 Feb. 21, 2024, 6:35 a.m. No.20451295 🗄️.is 🔗kun >>1319

>>20451289

Their God isn't paper.

They foist paper on the people in an attempt to make paper the people's God.

Their 'god' is Satan.

"The NWO worships Satan" - Q

>>20451291

>>20451279

Yes, agree, because they lack God n so have a void inside that they fill with material objects, conditions, n using other people to try to fill it.

>>20451059

Someone's thinking! The medical industry foisted the jabs on you and happily shoved that poison into your arms, your family's arms, and many others. They have no guilt or shame, and are fully supported by the corrupted trash that wears a uniform.

Nothing new to see here. At least Trump is gonna give the uniform wearers complete immunity to do whatever they want.

https://x.com/ClownWorld_/status/1760144614324113906

Brittany the methed up chick you see outside a gas station asking for money

Anonymous ID: 863f68 Feb. 21, 2024, 6:37 a.m. No.20451300 🗄️.is 🔗kun >>1322

>>20450945

If only Youtube warnings advised kids about Fentanyl instead of COVID and climate change BS.

Was he transgender?

Material girl living a material world… No god = no purpose = no class

>>20451286

i suspect Michigan's election are rigged.

Why would i suspect that?

Can you imagine? ..that's your mother.

>>20451297

kek that is is hilarious anon. So because you do not buy into some lie that was given to you you are what less than?

God promised Noah to never flood the earth again, and sealed it using the rainbow.

I wonder if that was the same time our vision was limited to, the now visible light spectrum?

Maybe these entities can only be seen in different frequencies.

Could this limitation be reversed?

Would be wild to wake up one day and view the world with new eyes.

Shitty replacement.

Anonymous ID: a45d18 Feb. 21, 2024, 6:41 a.m. No.20451310 🗄️.is 🔗kun >>1316

>>20451284

>Catchy tune

Dan thinks so, too!

Feb 21, 2024, 12:39 AM

https://truthsocial.com/@DanScavino/posts/111967860037136862

"Another Level" - OH THE LARCENY

Standing in the street

The sun is in the east

Calling out the beast

The tiger underneath

Starting to believe

The world is at my feet

I'm ready for the feast

It's all within my reach (it's all within my reach)

I'm going all the way

I'm going, yeah, my blood is rebel

I'm going all the way

I'm going to another level

To another level

If I'm on the loose

Running after you

There's nothing you could do

I'll catch you and it's through

Hustle for the juice

Hundred twenty proof

I'm blowing up the roof

Blowing up the roof

Got nothing left to prove (come on)

I'm going all the way

I'm going, yeah, my blood is rebel

I'm going all the way

I'm going to another level

(Let's go) to another level

(Gotta get my hands dirty)

To another level

Chain breaker, earth shaker, rain maker

Yeah, another level

Chain breaker, earth shaker, rain maker

Yeah, another level

Chain breaker, earth shaker, rain maker

Yeah, another level

Chain breaker, earth shaker, rain maker

Oh, to another level

I'm going all the way

I'm going, yeah, my blood is rebel

I'm going all the way

I'm going to another level (yeah, come on)

To another level

(Let's go, let's go, let's go)

To another level

(Let's get it)

To another level

>>20451280

>>20451307

ghost glasses, they live. seeing dimensions that are out of phase all at once. It was a Doctor Who episode also where the Daleks were pretending to be ghosts.

>>20451289

>>20451297

Twinsies

NASA Sets Coverage of First US Uncrewed Commercial Moon Landing

FEB 20, 2024

As part of NASA’s CLPS (Commercial Lunar Payload Services) initiative and Artemis campaign, Intuitive Machines is targeting no earlier than 5:49 p.m. EST Thursday, Feb. 22, to land their Odysseus lunar lander near Malapert A in the South Pole region of the Moon.

Live landing coverage will air on NASA+, NASA Television, the NASA app, and the agency’s website. NASA TV can be streamed on a variety of platforms, including social media. Coverage will include live streaming and blog updates beginning 4:15 p.m., as the landing milestones occur. Upon successful landing, Intuitive Machines and NASA will host a news conference to discuss the mission and science opportunities that lie ahead as the company begins lunar surface operations.

In May 2019, the agency awarded a task order for scientific payload delivery to Intuitive Machines. Odysseus launched at 1:05 a.m., Feb. 15, on a SpaceX Falcon 9 rocket from Launch Complex 39A at NASA’s Kennedy Space Center in Florida.

NASA is working with several U.S. companies to deliver science and technology to the lunar surface through the agency’s CLPS initiative. This pool of companies may bid on task orders for end-to-end delivery services, which includes payload integration and operations, launching from Earth, and landing on the surface of the Moon. NASA’s CLPS contracts are indefinite-delivery/indefinite-quantity contracts with a cumulative maximum contract value of $2.6 billion through 2028.

Through the Artemis campaign, commercial robotic deliveries will perform science experiments, test technologies, and demonstrate capabilities to help NASA explore the Moon in advance of Artemis Generation astronaut missions to the lunar surface, and ultimately crewed missions to Mars.

https://www.nasa.gov/news-release/nasa-sets-coverage-of-first-us-uncrewed-commercial-moon-landing/

>>20451309

Ahh, cahm annn! That's the real Brittney.

>>20451310

We're gonna rumble.

Anonymous ID: 37bb9d Feb. 21, 2024, 6:44 a.m. No.20451318 🗄️.is 🔗kun >>1447

>>20451259

Anonymous ID: 41cc09 Feb. 21, 2024, 6:44 a.m. No.20451319 🗄️.is 🔗kun >>1359

>>20451295

Actually that was Q quoting Putin.

>>20451309

mouth is different than original…

Anonymous ID: b41d33 Feb. 21, 2024, 6:45 a.m. No.20451322 🗄️.is 🔗kun >>1362

>>20451300

What ever happened to good old heroin

The reason they still guard poppy fields in Afghanistan

No more opium like back years ago

It's all fentanyl….its all good

They did all of this before

30s or 40s…same shit different heads

ANQUIFA … more cowbell. kek

>>20451311

Listen to the sounds of porn being downloaded

>>20451320

from..? either/or?

Desperate agencies do stupid things.

Dead cat bounce.

You may have the site but we have the source.

https://mobile.twitter.com/wikileaks/status/1011441579565953025

Panic is good.

Panic is right.

July 2018 - the month the world discovered the TRUTH.

Conspiracy no more.

Time to FEED.

>Desperate agencies do stupid things.

Anonymous ID: 089c73 Feb. 21, 2024, 6:46 a.m. No.20451328 🗄️.is 🔗kun >>1353

>>20451311

1200 was fast BITD

https://www.chinet.com/

https://twitter.com/mattgaetz/status/1760302320363991260

Hey @fbi - our staff has been trying to get in contact with you. No response.

The scene outside your Valparaiso office in my district is……alarming.

Is everyone OK?

Please check in safe.

Anonymous ID: 2da63c Feb. 21, 2024, 6:48 a.m. No.20451333 🗄️.is 🔗kun >>1371

Anonymous ID: a45d18 Feb. 21, 2024, 6:49 a.m. No.20451334 🗄️.is 🔗kun >>1361

>>20451316

Anonymous ID: bb42ab Feb. 21, 2024, 6:49 a.m. No.20451335 🗄️.is 🔗kun >>1339

>>20451320

The replacement can't dance and looks like shit. It only fools the morons who aren't paying attention. Suddenly Bald Britney was the replacement. Should have been obvious to everyone, but they are magicians, who are masters of illusion.

>>20451330

Let's hope his trashy tattoo 'artist' buys the toxic Chinese ink…

https://dailycaller.com/2024/02/20/machine-gun-kelly-tattoo

The Deep Staters are going to be tortured beyond anyone's imagination medevac type stuff.

''MAGA PATRIOTS EX MILITARY IS WAITING FOR YOU''

Anonymous ID: 3b6694 Feb. 21, 2024, 6:50 a.m. No.20451339 🗄️.is 🔗kun >>1351

>>20451335

Anonymous ID: 388337 Feb. 21, 2024, 6:50 a.m. No.20451340 🗄️.is 🔗kun >>1345

still got it, girl!

SEC closes Rumble investigation in latest regulatory clearance of global free speech platforms

Published: February 21, 2024 9:22am

The SEC said: "Based on the information we have as of this date, we do not intend to recommend an enforcement action."

>https://justthenews.com/politics-policy/regulation/sec-closes-rumble-investigation-latest-regulatory-clearance-global-free

>>20451330

Maybe they're having the hazards of dui/dwi demo

And the little known don't know too much about HRC demo

#Truckers4Trump

https://twitter.com/search?q=%23Truckers4Trump

https://twitter.com/Chicago1Ray/status/1760299933108678754

Anonymous ID: 433042 Feb. 21, 2024, 6:52 a.m. No.20451345 🗄️.is 🔗kun >>1637

>>20451340

That she does. Almost seems like it's comms but I can never figure out if it is or not with her.

https://twitter.com/PapiTrumpo/status/1760124753027711360

10:00 AM EST

WAR ROOM WITH STEVE BANNON 2-21-24

RealAmericasVoice

https://rumble.com/v4et2xt-war-room-with-steve-bannon-2-21-24.html

11:00 AM EST

Steve Bannon War Room Event - CPAC in DC 2024: Where Globalism Goes to Die - Wednesday

Conservative Political Action Conference (CPAC)

https://www.digital.cpac.org/us/events-dc2024

https://agenda.m.cpac.org/agenda/wednesday

https://agenda.m.cpac.org/live-stream-w-rumble

https://rumble.com/CPAC

don't know if the cpac thing will be streamed

Alabama’s supreme court ruled embryos are ‘extrauterine children’. IVF patients are worried

“They’re worried about what to do with their frozen embryos. They want to be the ones who make the decisions on how best to utilize their embryos – not the supreme court,” said McLean, who provides IVF as part of her work as an OB-GYN at Alabama Fertility, which has three locations in the state. McLean said she has spoken to more than a dozen of her patients over the last 48 hours, but: “Frankly, because of the lack of guidance, we don’t we don’t know exactly how this translates to our care.”

Since each created embryo is now a person in the eyes of the law, the Alabama ruling casts multiple parts of the IVF process into legal jeopardy. Providers may no longer be able to freeze, thaw, transfer or test embryos using best medical practices. People also frequently make more embryos than they use, and it is unclear if Alabamians would be able to ever dispose of those embryos under the supreme court ruling.

The consequences could even pose an existential threat to IVF in Alabama, as providers and patients may flee the state rather than risk liability flowing from the ruling.

“It’s a nonsensical ruling with devastating consequences for the health of the people in Alabama,” said Sean Tipton, chief advocacy and policy officer for the American Society for Reproductive Medicine. “The court, of course, didn’t deign to deal with the real-world implications of their decision, but they are profound.”

During a typical IVF process, providers use medication to stimulate the ovaries to produce multiple eggs, which are then extracted. Experts in a laboratory fertilize the eggs with sperm to create embryos. Doctors may then transfer an embryo or two into the patient’s uterus, or freeze embryos for future use.

https://www.theguardian.com/us-news/2024/feb/21/alabama-ivf-embryo-extrauterine-children-ruling

>>20451339

It was a fake mustache.

PID

Or wanting to trade for a roll of tp

Anonymous ID: b41d33 Feb. 21, 2024, 6:54 a.m. No.20451353 🗄️.is 🔗kun >>1388

>>20451328

Push button phoney

Fax machine noises …..memory storage

Not a problem

We got miles of this shit

https://twitter.com/QueenMAGAUltra/status/1760280915606200561

>>20451288

checked

https://qagg.news/?q=&q2=1626

Take a ride, 5 min

See how the plans going.

Any results at ALL?

Fentanyl, child/human trafficking.

Obvious.

a desperate need for attention.

cannot imagine spending any time around a person with such narcissistic needs.

She needs a come to Jesus moment.

no long now..

join the anons and tell all Britney before you are silenced..

prayers sent and this is from an anon who has no time for entitled females and the destruction they have caused to the world with feminist idealogy.

>>20451330

notable

>>20451319

Yes, indeed.

Anon views it as a confirmation, as Q agreeing.

Assange Trial Live

Day 2 cont.

I will save you the bulk of the legal dry-heave taking place.

The attorney for the U.S. government just said that Julian Assange's publications had nothing to do with journalism.

She said they are "grave and serious crimes".

(apparently forgetting that they were improperly classified documents and video to begin with, in order to hide monumental evidence of U.S. war crimes including the gunning down and murdering of women, children, and reporters as U.S. troops laughed.)

The U.S argument continues to be detached from reality and the facts of the case.

The judge has asked for Manning's sentencing remarks.

>>20451341

>>20451334

Anonymous ID: a6b63c Feb. 21, 2024, 6:57 a.m. No.20451362 🗄️.is 🔗kun >>1364

>>20451322

The CIA ran the heroin production, protected the fields for decades.

When Afghanistan was abandoned the Taliban burned the poppy fields and killed the Afghani heroin/opium producers.

Taliban is more conducive to honorable human behavior than American UniParty globalist cabal.

https://twitter.com/NobodymrRobert/status/1759732348881711295

>>20451362

George HW "Poppy" Bush

https://twitter.com/NobodymrRobert/status/1759737748599255333

https://twitter.com/TheLovelySheri/status/1760310379815526581

Where can I sign up to be a migrant?

>>20451290

mornin Swordy!

MAGA PATRIOTS are God fearing Christian people and all that Jew we are God's chosen people crap is the biggest bunch shit.

MAGA only worships Jesus Christ.

>>20451354

And now NY will start putting illegals behind the wheel of big rigs.

More slave labor.

>>20451333

That's disturbing.

Is this an indication that Kelce has spent too much time scanning cocks in the boy's shower?

NUCLEAR ERROR Trident fiasco as Brit sub ‘fired dummy missile at the United States’ in first nuke test for four years

Unarmed Trident II D5 rocket, which can kill millions when fitted with warhead, experienced a serious malfunction during the practice launch off Florida

Carri-Ann Taylor

Published: 1:50, 22 Jan 2017

NUCLEAR ERROR Trident fiasco as Brit sub ‘fired dummy missile at the United States’ in first nuke test for four years

Unarmed Trident II D5 rocket, which can kill millions when fitted with warhead, experienced a serious malfunction during the practice launch off Florida

Carri-Ann Taylor

Published: 1:50, 22 Jan 2017

https://www.thesun.co.uk/news/2675087/trident-fiasco-as-brit-sub-fired-dummy-missile-at-the-united-states-in-first-nuke-test-for-four-years/amp/

18 of 22 hit on Influenza A with c19 ATATTGCAGCAGTACGCACACA primer.

Thinking about if not optimal PCR conditions, how much this nonspecificty would contribute to PCR+ c19 in the face of Influenza A infection?

>>20451367

Elections have consequences, especially the rigged elections.

Anonymous ID: a6b63c Feb. 21, 2024, 7:04 a.m. No.20451378 🗄️.is 🔗kun >>1384

Why are we allowing the faggot, muzzie Brits to conduct war operations off our coast??

https://twitter.com/Tragicrepublic_/status/1760314978253627859

"Elon Musk" #TrumpCult #Truckers4Trump NYPD New York City they keep blocking me from posting her shameful press conference. You won’t believe the reason why .

YEP. The elite have decided that Creepy Joe will not be their presidential candidate come November. The New York Times is preparing the public. https://www.thegatewaypundit.com/2024/02/report-biden-white-house-furious-new-york-times/

2016

Theresa May is coming under increasing pressure to divulge more details about what happened during a Trident missile test last June.

So far, the British prime minister has refused to deny or confirm if the missile misfired after it was reported that it went of course.

May was told about the test upon taking office in July, shortly before MPs voted to renew the nuclear weapons system.

Anonymous ID: b41d33 Feb. 21, 2024, 7:05 a.m. No.20451384 🗄️.is 🔗kun >>1449

>>20451378

Cause they need the money

That's American tax dollars at work

See they don't make anything either

>>20451361

WRWY.

LFG.

Well, now we know the target of that particular missile tube in that particular sub off the coast of the US. Some ally the limey rats are.

They will not get a second try.

Anonymous ID: 089c73 Feb. 21, 2024, 7:09 a.m. No.20451388 🗄️.is 🔗kun >>1398

>>20451353

My first 8085

& my TNDY 6k HD bought at Tandy/Radio Shack Going out of biz sale. Used to access Chinet mid 80's

Anonymous ID: eec9d6 Feb. 21, 2024, 7:11 a.m. No.20451391 🗄️.is 🔗kun >>1401

>you believe He literally ascended?

me:

AND He walked on water, if you understand reality.

This is pretty pervy…

Anonymous ID: a45d18 Feb. 21, 2024, 7:12 a.m. No.20451394 🗄️.is 🔗kun >>1399

>>20451376

NEW EYES

>#1584

Jan 20, 2017

June 20, 2018

Exactly 17 months.

Do you believe in coincidences?

God bless you all.

>#1585

We stand.

We fight.

TOGETHER.

Organized riots being planned.

Counter measures in place.

Resistance far smaller than portrayed by MSM.

Attacks will intensify.

You, collectively, are a massive threat.

Censorship applied to scale down impact/reach.

It’s failing.

Trust yourself.

Public awakening.

Night Shift Bun of Dread for 2/17/2024

>>20428646 Those you trust are the most guilty of sin. Who are we taught to trust? If you arereligious, PRAY. Drops #586, 587, 4884 and 3565 fit together like a glove

>>20428650 The ayylmao decode drops #376, 2222, 2225 & #4966

>>20428653 but PELOSI did Jan 06 all by her self! What Phone call?!!?!? General who? https://en.wikipedia.org/wiki/Walter_E._Piatt and General who? https://en.wikipedia.org/wiki/Charles_A._Flynn

>>20428655 What happened in SA will happen here, Asia, and EU.

>>20428656 What happened in SA?

>>20428662 Drop #133 Decoded. Does the Thought of Satan Exist? Rothschild, Soros, S.A. as well as many Governments of the World Feed the EYE OF PROVIDENCE.

>>20428666 JAN 06 Who is Caroline Wren? Alex Jones, Flynn, Bannon and the rest of the [FAKE MAGA] gang setup JAN 06 > DIG

>>20428674 go on… MG SHOW? P = Payseur? Vatican Gate Keepers

>>20428678 The Real 2020 Election Interference - Italygate https://en.wikipedia.org/wiki/Italygate General Flynn, Sydney Powell, Mike Lindell and then suddenly all quiet.

>>20428681 The Real Immigration Issue NGO's and Catholic Charities > The Largest Human trafficking network in the world.

>>20428682 Ivan Raiklin (Flynn Faggot) and Alex Jones take on if they Assassinate Donald Trump Timestamp: 00:00:47 Alex Jones "If they kill him, that's the best case scenario, from a sick level…"

Basically, Alex Jones and Flynn Faggot sent veiled Death Threats to POTUS a few weeks ago and your hosts here at Q research did not think it was notable and they really do not want you to talk about it New Eyes.

>>20428685 The Council for inclusive Capitalism with The Vatican - Founded by Lynn De Rothschild but WEF WEF WEF!

>>20428689 Drop #1413 The Council for Inclusive Capitalism > Lynn De Rothscild + The Pope + 600 International Corporations. THE MG SHOW and other gatekeepers had a hard time with this one…

>>20428687 Drops # 26 and 2347 the "SIGNIFIER" decode "The picture will be the signifier."

>>20428692 The Snake poem and the Vatican serpent/viper drops. POTUS drops the snake poem too many times to count yet big patriots have not connected the snake poem to the Vatican Serpent drops? In 6 years?

>>20428695 Qresearch board history from 2018 to 2021 most cannot believe their eyes at the amount of Deep State Fuckery right here on muh 8 kuns. Neo Nazi Vatican Gatekeepers.

>>20428703 Dan Scavino posts Traitors way too often for it to be a coincidence Jack Poso and many more have Q drops about them and its not good Jack Posobiec is a traitor > DROP #2089 > IS DAN STUPID? ARE YOU?

>>20428718 Q anon influencers have let the world down and NIGHT SHIFT knows exactly who, exactly how and in some cases… exactly why they traitored…

>>20428725 "To those who are courageous enough to speak out - we stand with you!" Nuns Raped Girls With Crucifixes as Female Pedophilia Was Covered Up by the Church > Nuns drugged and dragged children to be raped by elite.

>>20428728 Soros in two drops… Two fucking drops!!! Q drop #416 Q drop #1413 That is called Checkmate and it was not very difficult so what has been the P = problem for over 6 years? TY MG SHOW!

>>20428729 The Great Awakening Free Thought drops start here:

>>20428778 The Free Thought Great Awakening Drops end here: In short… the religious fundamentalists here are traitors pure and simple. Dividers by Religion and that's all [they] ever were.

>>20428806 Here is a faggot right now to show you exactly what anon was referring to above…

>>20428792 The U.S. Supreme Court is Knights of Malta Vatican deep state. 7 of the 9 or 77% of the Supreme Justices are Catholic in a nation that is only 20% Catholic. You think this is a Coincidence?

>>20428795 Who is Harlan Crow? Who is Leonard Leo? fuck around and find out…

Anonymous ID: e28969 Feb. 21, 2024, 7:13 a.m. No.20451396 🗄️.is 🔗kun >>1609

admin, remove this?

>>20451388

That before the CD was invented….lol

Anonymous ID: 16e364 Feb. 21, 2024, 7:14 a.m. No.20451399 🗄️.is 🔗kun >>1483

>>20451394

>>20451395

>>20451394

Jun 21, 2018 1:35:10 AM EDT 1584

Q !CbboFOtcZs ID: 97de56 No. 1842740

Jun 21, 2018 1:28:40 AM EDT

Q !CbboFOtcZs ID: 97de56 No. 1842655

Jun 21, 2018 1:23:16 AM EDT

Anonymous ID: 2b6cd5 No. 1842592

vipanon-reduced-forinfinity1.mp4

for (you) VIPanon

>>1842592

Jan 20, 2017

June 20, 2018

Exactly 17 months.

Do you believe in coincidences?

God bless you all.

Q

>>1842655

We told you proofs were going to be important very soon.

NEW EYES.

Be ready.

5:5?

We thank you for your service.

Q

May 16, 2018 2:49:07 PM EDT 1384

Q !4pRcUA0lBE ID: a8f52e No. 1432972

May 16, 2018 2:47:55 PM EDT

Anonymous ID: 47ba70 No. 1432956

May 16, 2018 2:45:50 PM EDT

Q !4pRcUA0lBE ID: a8f52e No. 1432932

Follow the pen.

Already written?

Letters left visible to match.

https://mobile.twitter.com/Jim_Jordan/status/996821093146120192

WWG1WGA!

Q

1520214256103.gif

>>1432932

NEW EYES joining the fight Q!

>>1432956

Those with an agenda to silence will fail.

Pain coming.

Q

>>20153950

Feb 14, 2019 11:31:08 PM EST 2722

Q !!mG7VJxZNCI ID: 4e1594 No. 5181988

No mercy.

No bargaining.

A TRAITOR’s justice.

P-A-I-N

Q

How long will we submit to a world run by racketeers and gangsters? Neil Oliver: The Profits of War

‘Biden mourned Navalny’s death and said ‘even in prison he was a powerful voice for the truth'.

'An interesting statement while journalist, Julian Assange, who published truth inconvenient to the US and the west, presently rots in Belmarsh Prison.’

#gbnews #biden #ukraine #julianassange #assange #war #neiloliver

>>20451391

Peter walked on water too. Peter the Human like Jesus in the Flesh.

Anonymous ID: 16e364 Feb. 21, 2024, 7:14 a.m. No.20451402 🗄️.is 🔗kun >>1483

Ladies and Gentlemen!

Q !UW.yye1fxo ID: b189f8 No. 130638 Jan 22, 2018 9:47:32 PM EST 586

What would happen if texts originating from a FBI agent to several [internals] discussed the assassination (possibility) of the POTUS or member of his family?

What if the texts suggest foreign allies were involved?

Forget the Russia set up [1 of 22].

This is only the beginning.

Be careful what you wish for.

AS THE WORLD TURNS.

Could messages such as those be publicly disclosed?

What happens to the FBI?

What happens to the DOJ?

What happens to special counsel?

What happens in general?

Every FBI/DOJ prev case could be challenged.

Lawless.

Think logically.

We haven’t started the drops re: human trafficking / sacrifices [yet][worst].

Those [good] who know cannot sleep.

Those [good] who know cannot find peace.

Those [good] who know will not rest until those responsible are held accountable.

Nobody can possibly imagine the pure evil and corruption out there.

Those you trust are the most guilty of sin.

Who are we taught to trust?

If you arereligious, PRAY.

60% must remain private [at least] - for humanity.

These people should be hanging.

Q

Q !UW.yye1fxo 01/22/2018 21:50:37 ID: b189f8 587

8chan/qresearch: 130667

PRAY.

PREY.

Notice the similarity?

Q

Oct 17, 2020 2:16:46 PM EDT 4884

Q !!Hs1Jq13jV6 ID: 9b755f No. 11120402

https://www.youtube.com/watch?v=LUsLDzXWUU4

Enjoy the show!

Q

Q Links to Pope's Tweet on Human Trafficking3565

Q !!mG7VJxZNCI 30 Jul 2019 - 8:23:13 PM

https://twitter.com/Pontifex/status/1156165039545606144

Godfather III

It's going to be BIBLICAL.

Q

Anonymous ID: 388337 Feb. 21, 2024, 7:15 a.m. No.20451403 🗄️.is 🔗kun >>1416

>>20451397

Anonymous ID: 0b7df7 Feb. 21, 2024, 7:16 a.m. No.20451404 🗄️.is 🔗kun >>1483

CLICK CLICK!

790

Feb 18, 2018 8:41:03 PM EST

Q !UW.yye1fxo ID: 000000 No. 104

@SNOWDEN

WHERE ARE YOU?

NOT RUSSIA.

[EYES ON]

YOU ARE NOW A LIABILITY.

HELPING @JACK?

PROJECT DEEPDREAMv2[A]].

WE WILL NEVER FORGET.

ES FAILED.

WHERE IS ES?

JOHN PERRY BARLOW.

DEFINE THE END?

THE DAY OF RECKONING IS UPON US.

JOHN3:16

Q

989

Apr 02, 2018 11:47:24 PM EDT

Q !xowAT4Z3VQ ID: 491f56 No. 875289

Apr 02, 2018 11:45:09 PM EDT

Q !xowAT4Z3VQ ID: 491f56 No. 875265

April [A].

IG report.

Sessions public attack.

RR problems.

Seals broken.

[A]rrests.

Why was Huber made public?

Why now?

Everything has meaning.

[A]wan.

Tarmac.

Iran.

NK.

U1.

FBI.

DOJ.

Mueller.

Election Integrity.

Immigration Bill.

Border.

Wall.

Military start.

BIG month.

Q

>>875265

Facebook.

Amazon.

Twitter.

GOOG.

………..

BIG problems.

Q

991

Apr 03, 2018 12:03:57 AM EDT

Q !xowAT4Z3VQ ID: 491f56 No. 875587

Apr 02, 2018 11:58:41 PM EDT

Anonymous ID: 015520 No. 875485

Apr 02, 2018 11:45:09 PM EDT

Q !xowAT4Z3VQ ID: 491f56 No. 875265

April [A].

IG report.

Sessions public attack.

RR problems.

Seals broken.

[A]rrests.

Why was Huber made public?

Why now?

Everything has meaning.

[A]wan.

Tarmac.

Iran.

NK.

U1.

FBI.

DOJ.

Mueller.

Election Integrity.

Immigration Bill.

Border.

Wall.

Military start.

BIG month.

Q

>>875265

Tip Top Tippy Top Shape

>>875485

It was requested.

Did you listen today?

Q

995

Apr 03, 2018 8:42:09 PM EDT

Q !xowAT4Z3VQ ID: 463ae0 No. 884736

Future proves past.

Several today.

[1 day]

RR.

Military.

Border.

Keep watching the news.

[A]pril.

MOAB.

Q

996

Apr 03, 2018 8:43:55 PM EDT

Q !xowAT4Z3VQ ID: 463ae0 No. 884763

Apr 03, 2018 8:42:09 PM EDT

Q !xowAT4Z3VQ ID: 463ae0 No. 884736

Future proves past.

Several today.

[1 day]

RR.

Military.

Border.

Keep watching the news.

[A]pril.

MOAB.

Q

>>884736

Coincidence another MSM narrative change upon release of damaging news?

People are waking up.

Trace the background of the shooter.

Focus on Father.

20 years.

Q

997

Apr 03, 2018 8:45:50 PM EDT

Q !xowAT4Z3VQ ID: 463ae0 No. 884799

Apr 03, 2018 8:43:05 PM EDT

Anonymous ID: dd4e73 No. 884748

Apr 03, 2018 8:42:09 PM EDT

Q !xowAT4Z3VQ ID: 463ae0 No. 884736

Future proves past.

Several today.

[1 day]

RR.

Military.

Border.

Keep watching the news.

[A]pril.

MOAB.

Q

>>884736

P = pope?

>>884748

[Pope]will be having a terrible May.

Those who backed him will be pushed into the LIGHT>

Dark to LIGHT.

TRUTH.

Q

Fentanyl/PIzza market, active.

DNA/cloning facility, active.

Satanic witches, active.

Innocent children being injured 24/7, lives being destroyed, still happening.

Indifference and inability to enforce the law is but feeble COMPLICITY.

RAGE

Anonymous ID: 0b7df7 Feb. 21, 2024, 7:16 a.m. No.20451406 🗄️.is 🔗kun >>1483

"JUST LIKE WE DREW IT UP"

Are Plans "drawn up"?

WHO IS IN CONTROL?

People also ask:

How much does it cost to get plans drawn up?

How do I draw my own plans?

How to draw up house plans for free?

How much does it cost to draw up house plans?

Anonymous ID: d84295 Feb. 21, 2024, 7:17 a.m. No.20451407 🗄️.is 🔗kun >>1414

>>20451367

Openly stealing your money. Smoking gun evidence of them laundering your tax money and rigging elections could drop and the American people, especially you dumfucking QTARDS wouldn’t do shit

Anonymous ID: 0b7df7 Feb. 21, 2024, 7:17 a.m. No.20451408 🗄️.is 🔗kun >>1483

Woe to you, oh Earth and Sea, for the Devil send's the Beast with Wrath, because he knows the time is short…

Let him who hath understanding reckon the number of the Beast, for it is a Human Number. It's Number is Six Hundred and Sixty Six…

Dig and decode on the Eye of Providence - Q drop #133 version 7.0 "Many governments of the world feed the ‘Eye’. The Eye of Providence."

https://en.wikipedia.org/wiki/Eye_of_Providence

https://symbolsage.com/eye-of-providence-meaning/

https://commons.wikimedia.org/wiki/Eye_of_Providence

https://www.catholic.com/qa/gods-all-seeing-eye-isnt-masonic

https://www.catholicbridge.com/catholic/all-seeing-eye-churches.php

https://www.unexpectedtraveller.com/illuminati-symbols-catholic-churches/

https://www.catholic-saints.info/catholic-symbols/eye-christian-symbol.htm

https://www.catholictriparish.org/uploads/8/9/4/5/89454746/signs___symbols.pdf

https://www.ancient-origins.net/human-origins-religions/eye-providence-0013057

https://www.reddit.com/r/Catholicism/comments/zpvrsw/is_this_a_catholic_symbol_specifically_the_eye/

https://www.christianforums.com/threads/why-so-some-many-catholic-churches-have-the-eye-of-providence-in-them-the-same-symbo.7858026/

U.S. Conference of Catholic Bishops@USCCBThe all-seeing eye is not a Masonic symbol but represents God's omnipresence. When surrounded by a triangle, it symbolizes the Trinity. 11:02 AM · Dec 18, 2019 https://twitter.com/USCCB/status/1207330423484928006

Nov 11, 2017 11:29:35 PM EST DROP #133 Q !ITPb.qbhqo ID: gO/UntOB No. 149063235

Hard to swallow.

Important to progress.

Who are the puppet masters?If Saud, Roths and Soros are the Puppet Masters, why does Q repeat this Question again below?

House of Saud (6+++) - $4 Trillion+

Rothschild (6++) - $2 Trillion+

Soros (6+) - $1 Trillion+

Focus on above(3).

Public wealth disclosures – False.

Many governments of the world feed the‘Eye’.

Think slush funds (feeder).

Think war (feeder).

Think environmental pacts (feeder).

Triangle has(3)sides.

Eye of Providence.==The EYE OF PROVIDENCE is an ancient symbol most commonly associated with Christianity, Catholicism Holy Trinity. The Eye of God is in the Middle of the Triangle.==

Follow the bloodlines.

What is the keystone?SATAN is the keystone? Double meanings exist? (keystone)

Does Satan exist?No.

Does the ‘thought’ of Satan exist?Yes and it is the Thought that Counts.

Who worships Satan?==All Religions which require a Satan, Devil, Negative archetype excuse for evil to exist.==

What is a cult?Noun: cult; plural noun: cults a system of religious veneration and devotion directed toward a particular figure or object.

Epstein island.

What is a temple?Church, Cathedral, building dedicated to a figure or object.

What occurs in a temple?Worship and sacrifice.

Worship?

Why is the temple on top of a mountain?Represents the Mouth of the Diety

How many levels might exist below?Many, arranged like a body

What is the significance of the colors, design and symbol above the dome?Symbology of the Puppet Masters

Why is this relevant?

Who are the puppet masters?Why is Q asking this question again? This means that the above 3 are not the Puppet Masters but the Puppets.

Have the puppet masters traveled to this island?

When? How often? Why?

“Vladimir Putin: The New World Order Worships Satan”

Q

God bless you all.

>>20449923 lb

Why specifically LED lights and TVs?

Exclusive: Israeli forces fired on food convoy in Gaza, UN documents and satellite analysis reveals

https://www.cnn.com/2024/02/21/middleeast/un-food-convoy-gaza-israel-strike-cmd-intl/index.html

That would be a war crime.

Anonymous ID: 0b7df7 Feb. 21, 2024, 7:18 a.m. No.20451412 🗄️.is 🔗kun >>1483

Guise! Guise! We gotta do something about all the ELECTION INTERFERENCE though!

==THE REAL 2020 ELECTION INTERFERENCE ITALYGATE > ITALIAN MILITARY CONTRACTOR LEONARDO SPA > OBAMA > RENZI ++==

Some things are better left untold [cov]. Public truths of some events force wars. WWIII prevent. #4021

Italygatehttps://en.wikipedia.org/wiki/Italygate

Fact check: Evidence disproves claims of Italian conspiracy to meddle in U.S. election (known as #ItalyGate)January 15, 2021

https://www.reuters.com/article/uk-fact-check-debunking-italy-gate-idUSKBN29K2N8/

ITALYGATE: How votes were switched throughout the U.S. Presidential race

Italygate: is the Italian government directly involved in the US election fraud against Trump?

https://www.thethinkingconservative.com/italygate-how-votes-were-switched-throughout-the-u-s-presidential-race/

DoD investigated "Italygate" conspiracy theory per Trump requestJun 23, 2022

https://www.axios.com/2022/06/23/miller-defense-department-italy-trump-election

Meadows Pressed Justice Dept. to Investigate Election Fraud Claims

Emails show the increasingly urgent efforts by President Trump and his allies during his last days in office to find some way to undermine, or even nullify, the election results.

https://www.nytimes.com/2021/06/05/us/politics/mark-meadows-justice-department-election.html

Rep. Scott Perry played key role in promoting false claims of fraudJune 23, 2022

https://www.washingtonpost.com/national-security/2022/06/23/scott-perry/

Fact check: Claims of electoral fraud in Rome, dubbed 'ItalyGate,' are baseless

https://www.usatoday.com/story/news/factcheck/2021/01/08/fact-check-italygate-claims-electoral-fraud-rome-baseless/6567335002/

SpyTalk

'Italygate' Conspiracy Pusher Was Fired by CIA

The former CIA man at the heart of “Italygate,” the pro-Trump, Qanon-fueled conspiracy theory that satellites and military technology were used to steal the…

https://www.spytalk.co/p/italygate-conspiracy-pusher-was-fired

YouTube

Defense Secretary Called Italy To Debunk Ridiculous 'Italygate' Conspiracy Theory

An MSNBC panel discusses the nationally embarrassing revelation in the fifth January 6th hearing that U.S. Secretary of Defense Christopher Miller was made…

https://youtu.be/Qlc88sV7TP4

PolitiZoom

Katie Phang Talks Me Through Today's “Italygate” Testimony

I work during the day and so didn't get to follow the J6 Committee Hearing as closely as I should, and when I did get home there was the scurrilous SCOTUS…

https://politizoom.com/katie-phang-talks-me-through-todays-italygate-testimony/

The Washington Post

Rep. Scott Perry played key role in promoting false claims of fraud

Of all the fantastical false claims of fraud and vote manipulation in the 2020 presidential election, “Italygate” was one of the most extreme. And Rep.

https://www.washingtonpost.com/national-security/2022/06/23/scott-perry/

Yahoo News

Defense secretary called Italy to debunk ridiculous 'Italygate' conspiracy theory

An MSNBC panel discusses the nationally embarrassing revelation in the fifth January 6th hearing that U.S. Secretary of Defense Christopher Miller was made…

https://news.yahoo.com/defense-secretary-called-italy-debunk-051013621.html

Axios

DoD investigated "Italygate" conspiracy theory per Trump request

Former Acting Secretary of Defense Christopher Miller called a high-ranking official in Rome to look into the so-called "Italygate" at the request of the…

https://www.axios.com/2022/06/23/miller-defense-department-italy-trump-election

Huge Diversity Fail.

>>20451407

what have you done?, other than making your first post faggot. What are you going to do? Make a second post further proving what a nigger you are?

>>20451403

Kek.

I hope these posts, concerning the nuke mishap off Florida, will be included inNOTABLES

NASA’s New Horizons Detects Dusty Hints of Extended Kuiper Belt

FEB 20, 2024

New observations from NASA’s New Horizons spacecraft hint that the Kuiper Belt – the vast, distant outer zone of our solar system populated by hundreds of thousands of icy, rocky planetary building blocks – might stretch much farther out than we thought.

Speeding through the outer edges of the Kuiper Belt, almost 60 times farther from the Sun than Earth, the New Horizons Venetia Burney Student Dust Counter (SDC) instrument is detecting higher than expected levels of dust – the tiny frozen remnants of collisions between larger Kuiper Belt objects (KBOs) and particles kicked up from KBOs being peppered by microscopic dust impactors from outside of the solar system.

The readings defy scientific models that the KBO population and density of dust should start to decline a billion miles inside that distance and contribute to a growing body of evidence that suggests the outer edge of the main Kuiper Belt could extend billions of miles farther than current estimates – or that there could even be a second belt beyond the one we already know.

The results appear in the Feb. 1 issue of the Astrophysical Journal Letters.

“New Horizons is making the first direct measurements of interplanetary dust far beyond Neptune and Pluto, so every observation could lead to a discovery,” said Alex Doner, lead author of the paper and a physics graduate student at the University of Colorado Boulder who serves as SDC lead. “The idea that we might have detected an extended Kuiper Belt — with a whole new population of objects colliding and producing more dust – offers another clue in solving the mysteries of the solar system’s most distant regions.”

Designed and built by students at the Laboratory for Atmospheric and Space Physics (LASP) at the University of Colorado Boulder under the guidance of professional engineers, SDC has detected microscopic dust grains produced by collisions among asteroids, comets and Kuiper Belt objects all along New Horizons’ 5-billion-mile, 18-year journey across our solar system – which after launch in 2006 included historic flybys of Pluto in 2015 and the KBO Arrokoth in 2019. The first science instrument on a NASA planetary mission to be designed, built and “flown” by students, the SDC counts and measures the sizes of dust particles, producing information on the collision rates of such bodies in the outer solar system.

The latest, surprising results were compiled over three years as New Horizons traveled from 45 to 55 astronomical units (AU) from the Sun – with one AU being the distance between Earth and Sun, about 93 million miles or 140 million kilometers.

These readings come as New Horizons scientists, using observatories like the Japanese Subaru Telescope in Hawaii, have also discovered a number KBOs far beyond the traditional outer edge of the Kuiper Belt. This outer edge (where the density of objects starts to decline) was thought to be at about 50 AU, but new evidence suggests the belt may extend to 80 AU, or farther.

As telescope observations continue, Doner said, scientists are looking at other possible reasons for the high SDC dust readings. One possibility, perhaps less likely, is radiation pressure and other factors pushing dust created in the inner Kuiper Belt out past 50 AU. New Horizons could also have encountered shorter-lived ice particles that cannot reach the inner parts of the solar system and were not yet accounted for in the current models of the Kuiper Belt.

“These new scientific results from New Horizons may be the first time that any spacecraft has discovered a new population of bodies in our solar system,” said Alan Stern, New Horizons principal investigator from the Southwest Research Institute in Boulder. “I can’t wait to see how much farther out these elevated Kuiper Belt dust levels go.”

Now into its second extended mission, New Horizons is expected to have sufficient propellant and power to operate through the 2040s, at distances beyond 100 AU from the Sun. That far out, mission scientists say, the SDC could potentially even record the spacecraft’s transition into a region where interstellar particles dominate the dust environment. With complementary telescopic observations of the Kuiper Belt from Earth, New Horizons, as the only spacecraft operating in and collecting new information about the Kuiper Belt, has a unique opportunity to learn more about KBOs, dust sources and expanse of the belt, and interstellar dust and the dust disks around other stars.

https://www.nasa.gov/missions/new-horizons/nasas-new-horizons-detects-dusty-hints-of-extended-kuiper-belt/

Anonymous ID: 0b7df7 Feb. 21, 2024, 7:20 a.m. No.20451420 🗄️.is 🔗kun >>1483

Guise! Guise! We gotta do something about the ILLEGAL IMMIGRATIONS THOUGH!

THE LARGEST HUMAN TRAFFICKING NETWORK IN THE WORLD

Who’s Really Facilitating America’s Border Crisis? Biden Isn’t Acting Alone Dec 9, 2022

https://www.heritage.org/immigration/commentary/whos-really-facilitating-americas-border-crisis-biden-isnt-acting-alone

Republicans accuse Catholic Charities of breaking the law in its border response December 15, 2022

https://www.americamagazine.org/politics-society/2022/12/15/border-crisis-republicans-catholic-charities-244359

Migrants depend on Catholic Charities to avoid deportation December 19, 2022

https://www.washingtontimes.com/news/2022/dec/19/migrants-using-catholic-charities-to-shield-themse/

Catholic Charities Under Siege House Republicans and TX bearing down hard

https://www.churchmilitant.com/news/article/catholic-charities-under-siege

Catholic Charities helping guide through Biden immigration program Jan. 26, 2023

https://www.baynews9.com/fl/tampa/news/2023/01/26/catholic-charities-helping-through-immigration-process

Catholic Charities of Southeast Texas is looking at expanding immigration services May 12th 2023,

https://kfdm.com/news/local/catholic-charities-of-southeast-texas-is-looking-at-expanding-immigration-services-title-42-end-immigrants-texas-border

Cardinal Dolan: Catholics have a duty to care for immigrants. And the government can’t punish us for that. Timothy Michael Dolan June 28, 2023

https://www.americamagazine.org/faith/2023/06/28/dolan-religious-liberty-immigrants-245596

Afghanistan to Fort Wayne: How Catholic Charities’ Immigration Services make a global impact MARCH 15, 2023

https://www.inputfortwayne.com/features/SJCHF-CatholicCharitiesImmigrationServices.aspx

Harassing Good Samaritans Is On Brand for GOP Republican members of Congress are expanding their war on migrants to the groups that receive federal money to help provide them with food and shelter.

https://www.bloomberg.com/opinion/articles/2023-07-11/house-republicans-target-aid-groups-that-provide-food-shelter-for-migrants#xj4y7vzkg

In targeting Catholic Charities, Republicans amplify right-wing Catholic fringe JULY 26, 2023

https://baptistnews.com/article/in-targeting-catholic-charities-republicans-amplify-right-wing-catholic-fringe/

In targeting Catholic Charities, Republicans amplify right-wing Catholic fringe July 24, 2023

https://religionnews.com/2023/07/24/republicans-are-mainstreaming-a-right-wing-attack-on-catholic-charities/

Clearing up misconceptions about Church and immigrants Why does Church minister to migrants and refugees? Here are some answers July 17, 2023

https://www.miamiarch.org/CatholicDiocese.php?op=Article_clearing-up-misconceptions-about-church-and-immigrants

https://www.expressnews.com/news/article/catholic-charities-san-antonio-title-42-18082221.php

https://www.wilx.com/2023/05/08/st-vincent-catholic-charities-helps-lansing-refugees/

12/25/22 (Sun) Christmas Day

Donald J. Trump@realDonaldTrump

On this very cold but beautiful Christmas Day, look at our Nation NOW on the Southern Border compared to only a short time ago during the Trump Administration.

We had the most SECURE Border in our history, versus the “horror show” that that is happening now, with record setting numbers of people, many of them hardened Criminals (including Killers, Human Traffickers and Drug Dealers), POURING INTO OUR COUNTRY at a rate the likes of which we have never seen before. The USA is dyingfrom within!!!

https://truthsocial.com/@realDonaldTrump/posts/109574657347743432

>>20451360

https://twitter.com/richimedhurst/status/1760251267664818663

Anonymous ID: 8b89ac Feb. 21, 2024, 7:20 a.m. No.20451422 🗄️.is 🔗kun >>1483

'''Remember, Remember the 11th of September and the C_A VATICAN treasonous plot…'''

'''Anon knows no reason why the C_A VATICAN Treason should ever be forgot..'''

Remember when Q prayed the Roman Catholic Version of the "Our Father" or Pater Noster with anons in a drop about who financed 9-11?

Remember when Q posted drop #306 and asked "Why was the Lord's prayer posted? Which version? Why is this relevant? What just came out re: the Lord's prayer? What can be connected? & Do you believe in coincidences?

Remember when Q asked anons to "Re-review the map post relevant news drops." and "GODFATHERIII"?

Good! Because the following is what that looks like…

PATER noster, qui es in cœlis; sanctificetur nomen tuum: Adveniat regnum tuum; fiat voluntas tua, sicut in cœlo, et in terra.

Panem nostrum cotidianum da nobis hodie: Et dimitte nobis debita nostra, sicut et nos dimittimus debitoribus nostris: et ne nos inducas in tentationem: sed libera nos a malo.

Q !ITPb.qbhqo 11/14/2017 21:25:29 ID: wmN+33xv #154

4chan/pol: 149467690

Who financed 9-11?

Who was Bin Laden’s handler?

Why was the Clowns In America tasked to hunt/kill/capture UBL?

Why not MI?

If we found UBL, eliminated his security, why would we immediately kill him and not take him alive?

Why wouldn’t we want to capture UBL alive and extract other possible T-level events?

Perhaps someday people will understand ‘they’ had a plan to conduct ‘another’ mass extinction event.

WWI & II - orchestrated and planned by select families?

Fantasy land.

Remember, the more people there are, the more power the people have.

Why do D’s push for gun control ‘directly’ after every tragic incident?

Why is this so very important to their agenda?

We, the people, are who they are afraid of.

We, the people, are who they fear will one day awake.

Our Father who art in heaven,

Hallowed be thy name.

Thy kingdom come.

Thy will be done

on earth as it is in heaven.

Give us this day our daily bread,

and forgive us ourtrespasses,

as we forgive those whotrespassagainst us,

and lead us not into temptation,

but deliver us from evil.

Q

Q !ITPb.qbhqo 12/09/2017 13:12:19 ID: 571cae#306

8chan/cbts: 60141

News unlocks map.

Future proves past.

Why was the Lord's prayer posted?

Which version?

Why is this relevant?

What just came out re: the Lord's prayer?

What can be connected?

Do you believe in coincidences?

Re-review the map post relevant news drops.

Godfather III.

Q

Dec 09, 2017 1:16:56 PM EST#307

Q !ITPb.qbhqo ID: 571cae No. 60172

Dec 09, 2017 1:13:29 PM EST

Anonymous ID: e60938 No. 60150

Dec 09, 2017 1:12:19 PM EST

Q !ITPb.qbhqo ID: 571cae No. 60141

News unlocks map.

Future proves past.

Why was the Lord's PRAYER posted?

Which version?

Why is this relevant?

What just came out re: the Lord's PRAYER?

What can be connected?

Do you believe in coincidences?

Re-review the map post relevant news drops.

Godfather III.

Q

>>60141

Tues Nov 4th,

Who financed 9-11?

Who was Bin Laden's handler?

Why was the Clowns In America tasked to hunt/kill/capture UBL?

Why not MI?

If we found UBL, eliminated his security, why would we immediately kill him and not take him alive?

Why wouldn't we want to capture UBL alive and extract other possible T-level events?

Perhaps someday people will understand ‘they' had a plan to conduct ‘another' mass extinction event.

WWI & II - orchestrated and planned by select families?

Fantasy land.

Remember, the more people there are, the more power the people have.

Why do D's push for gun control ‘directly' after every tragic incident?

Why is this so very important to their agenda?

We, the people, are who they are afraid of.

We, the people, are who they fear will one day awake.

Our Father who art in heaven,

Hallowed be thy name.

Thy kingdom come.

Thy will be done

on earth as it is in heaven.

Give us this day our daily bread,

and forgive us our trespasses,

as we forgive those who trespass against us,

and lead us not into temptation,

but deliver us from evil.

Q

>>60150

The "marker."

Learn to read the map.

News unlocks the map.

Q

Dec 09, 2017 1:21:38 PM EST#308

Q !ITPb.qbhqo ID: 571cae No. 60201

Tangent.

Expand your thinking.

Q

Anonymous ID: 8b89ac Feb. 21, 2024, 7:21 a.m. No.20451424 🗄️.is 🔗kun >>1483

Trump reads "The Snake" poem

CBS News 5.64M subscribers 785,312 views Apr 29, 2017

Trump brought back one of this campaign trail favorites, a poem called "The Snake." The poem tells the story of a woman who takes in a snake, who ends up biting her and telling her "you knew damn well I was a snake before you let me in."

https://www.youtube.com/watch?v=qSrOXvoNLwg

POTUS recites "The Snake" poem too many times to count and yet big deep digging patriots fail to connect the snake poem to the snake/serpent drops and then to the Vatican… and anon is the Shill?

Q Drop search for "Snake" = 1 Drop Q Drop #191''' Vatican Serpent/Snake image from "Vatican Greeting/Audience Hall" "that sum sik shit" '''

Q Drop search for "Serpent" = 1 Drop Q Drop #4551 Letter from Vatican Cointelpro Traitor Archbishop Vigano

Q Drop search for "Serpent" "Snake" related drops = 1 Drop Q drop #1002''' "If Satanists took over the Vatican would you notice?" '''

Apr 03, 2018 9:18:12 PM EDT 1002

Q !xowAT4Z3VQ ID: 3474d4 No. 885486

Apr 03, 2018 9:15:43 PM EDT

Anonymous ID: fce0d6 No. 885429

If_Satanists_Took_Over_the….png

>>885429

Symbolism will be their downfall.

MONEY.

POWER.

INFLUENCE.

The BITE that has no CURE - NSA.

Q

The Snake in full:

On her way to work one morning

Down the path alongside the lake

A tender-hearted woman saw a poor half-frozen snake

His pretty colored skin had been all frosted with the dew

“Oh well,” she cried, “I'll take you in and I'll take care of you”

“Take me in oh tender woman

Take me in, for heaven's sake

Take me in oh tender woman,” sighed the snake

She wrapped him up all cozy in a curvature of silk

And then laid him by the fireside with some honey and some milk

Now she hurried home from work that night as soon as she arrived

She found that pretty snake she'd taken in had been revived

“Take me in, oh tender woman

Take me in, for heaven's sake

Take me in oh tender woman,” sighed the snake

Now she clutched him to her bosom, “You're so beautiful,” she cried

“But if I hadn't brought you in by now you might have died”

Now she stroked his pretty skin and then she kissed and held him tight

But instead of saying thanks, that snake gave her a vicious bite

“Take me in, oh tender woman

Take me in, for heaven's sake

Take me in oh tender woman,” sighed the snake

“I saved you,” cried that woman

“And you've bit me even, why?

You know your bite is poisonous and now I'm going to die”

“Oh shut up, silly woman,” said the reptile with a grin

“You knew damn well I was a snake before you took me in

”Take me in, oh tender woman

Take me in, for heaven's sake

Take me in oh tender woman,“ sighed the snake

2:23 / 7:45

What is the TRUE purpose of the UN? with Mel K

Anonymous ID: 8b89ac Feb. 21, 2024, 7:22 a.m. No.20451426 🗄️.is 🔗kun >>1483

This next piece is an old classic called "Holy fucking shit, what!?!".

>>20153933

What happened in SA will happen here, Asia, and EU.

Nov 05, 2017 1:12:48 AM EDT 87

Anonymous ID: v3eCc2tY No. 148022342

My signatures all reference upcoming events about to drop if this hasn't been caught on.

Snow White

GODFATHER III

Q

Nov 05, 2017 1:31:00 AM EDT 88

Anonymous ID: v3eCc2tY No. 148023976

Ten days.

Darkness.

Scare tactics (MSM).

D's falling.

R's walk-away/removed.

SA US > Asia → EU

Disinformation is real.

Distractions are necessary.

Focus was US today while real happening in SA under same context (military control, martial law, missile strike (rogue) etc).

Necessary.

POTUS' Twitter attack (see above).

Important.

Why is this relevant?

What was the last Tweet by POTUS prior to SA?

Why is this relevant?

SA (1), US (2), Asia (3), EU (4).

Where is POTUS?

Why is this relevant?

Military operations.

Operators in US.

Snow White

The Great Awakening

GODFATHER III

Q

Nov 05, 2017 2:17:24 AM EST 95

Anonymous ID: cS8cMPVQ No. 148033178

What happened in SA will happen here, Asia, and EU.

Keep digging and keep organizing the info into graphics (critical).

God bless.

Hillary & Saudi Arabia

Snow White

GODFATHER III

Q

Oct 17, 2020 2:16:46 PM EDT 4884

Q !!Hs1Jq13jV6 ID: 9b755f No. 11120402

https://www.youtube.com/watch?v=LUsLDzXWUU4

Enjoy the show!

Q

Q Links to Pope's Tweet on Human Trafficking

Q !!mG7VJxZNCI 30 Jul 2019 - 8:23:13 PM 3565

https://twitter.com/Pontifex/status/1156165039545606144

Godfather III

It's going to be BIBLICAL.

Q

https://www.youtube.com/watch?v=I826gxc8TvI

when the shit goes down

Q Links to Pope's Tweet on Human Trafficking3565

Q !!mG7VJxZNCI 30 Jul 2019 - 8:23:13 PM

https://twitter.com/Pontifex/status/1156165039545606144

Godfather III

It's going to be BIBLICAL.

Q

Anonymous ID: 8b89ac Feb. 21, 2024, 7:22 a.m. No.20451427 🗄️.is 🔗kun >>1483

What happened in SA will happen here, Asia, and EU.

Nov 05, 2017 1:12:48 AM EDT 87

Anonymous ID: v3eCc2tY No. 148022342

My signatures all reference upcoming events about to drop if this hasn't been caught on.

Snow White

GODFATHER III

Q

Nov 05, 2017 1:31:00 AM EDT 88

Anonymous ID: v3eCc2tY No. 148023976

Ten days.

Darkness.

Scare tactics (MSM).

D's falling.

R's walk-away/removed.

SA US > Asia → EU

Disinformation is real.

Distractions are necessary.

Focus was US today while real happening in SA under same context (military control, martial law, missile strike (rogue) etc).

Necessary.

POTUS' Twitter attack (see above).

Important.

Why is this relevant?

What was the last Tweet by POTUS prior to SA?

Why is this relevant?

SA (1), US (2), Asia (3), EU (4).

Where is POTUS?

Why is this relevant?

Military operations.

Operators in US.

Snow White

The Great Awakening

GODFATHER III

Q

Nov 05, 2017 2:17:24 AM EST 95

Anonymous ID: cS8cMPVQ No. 148033178

What happened in SA will happen here, Asia, and EU.

Keep digging and keep organizing the info into graphics (critical).

God bless.

Hillary & Saudi Arabia

Snow White

GODFATHER III

Q

Oct 17, 2020 2:16:46 PM EDT 4884

Q !!Hs1Jq13jV6 ID: 9b755f No. 11120402

https://www.youtube.com/watch?v=LUsLDzXWUU4

Enjoy the show!

Q

Q Links to Pope's Tweet on Human Trafficking

Q !!mG7VJxZNCI 30 Jul 2019 - 8:23:13 PM 3565

https://twitter.com/Pontifex/status/1156165039545606144

Godfather III

It's going to be BIBLICAL.

Q

Anonymous ID: 8b89ac Feb. 21, 2024, 7:23 a.m. No.20451428 🗄️.is 🔗kun >>1483

This one goes out to all the "QANON" influencers, grifters, paytriots, truth analysts, Q Guru's and other pieces of shit that were simply "not smart enough" to put the following pieces together.

Some were smart enough but for some odd reason they didn't tell you or say anything really.

So Smart and so Patriotic of [them].

https://qalerts.app/

https://qalerts.app/?q=EYE+OF+PROVIDENCE

https://qalerts.app/?q=GODFATHER+III

https://qalerts.app/?q=OUR+FATHER

https://qalerts.app/?q=TRUST+MOST

https://qalerts.app/?q=BIBLICAL

https://qalerts.app/?q=VATICAN

https://qalerts.app/?q=SOROS

https://qalerts.app/?q=SATAN

https://qalerts.app/?q=POPE

https://qalerts.app/?q=NAZI

https://qalerts.app/?q=9-11

https://qalerts.app/?q=[GS]

https://qalerts.app/?q=[Y]

By drop #95 you knew…

By drop #133 you knew…

By drops #154, 306, 307 & 308 you knew…

By drops #997, 998 & 999 you knew…

By drop #1413 you knew…

By drop #1941 you knew…

By drops #1763 & 1879 you knew…

By drops #1950 & 1951 you knew…

By drop #3565 you knew…

By drop #4799 you knew…

DEFINE: Knowingly

Top 10 List"Decodes and Drops"

1: The "Eye of Providence" decode. Q drop #133.

2: The "Satan does not exist" drop. Q drop #133.

3: The "Alien" drops. Q drop #376, 2222, 2225 and 4966.

4: The "OWL/Y Head" decode. Q drop #192, 135, 136, 137 and 138.

5: The "Purge" drops. Godfather III Sig. Q drop #87 , 88, 95 and 3565.

6: The "Our Father, Who financed 9-11?" decode. Q drop #154, 306, 307 and 308.

7: The "Saviors" drop list from the "Nothing" drops. Q drop #111, 114 and 2442.

8: The "Nothing is going to stop what is coming" drops. Q drop #111, 114, 2442, 4845, 4874, 4944 and 4950.

9: The '''"Nazi C_A > Vatican" Crazy Coincidences Collection. Q drop #851, 936, 938, 944, 1941, 1954 and 4654'''.

10: The "Free Thought = The Great Awakening" drops. Q drop #1926, 2171, 3038, 3613, 3721, 3858, 3905, 3906, 4491, 4535, 4553, 4602 and the "Precipice" at 4408.

Top 10 List"Friend or Foe?"

1: Alex Jones

2: General Flynn

3: Steve Bannon

4: Roger Stone

5: REDACTED FOR YOUR PROTECTION

6: Tucker Carlson

7: Elon Musk

8: Roman Catholic Archbishop Carlo Maria Vigano and minion Taylor Marshall

9: Jack Posobiec

10: [you] unless you repent

Disclaimer: Being on the above list does not mean that this player is a [Foe].

Being on the above list means that these players have made moves on the stage which make them appear and seem like Foes at least in the eyes of some Anons and/or Q per the drops.

If a player on the above list is actually a ]Friend[ attempting to appear as a [Foe], or is an actual [Foe], it is in the Interest of the Plan to highlight their actions either way.

Only Concernfags are concerned about Friendly Fire from Anons. Just like the MSM was terribly concerned about Patriots having "crazy theories" concerning 9-11.

(Hilarious but true I’m told…Kek)

A Tribute to Saint Alexei, Patron Saint of Liberal Democracy

I didn't even know he was sick.1/3=

NICCOLO SOLDO

FEB 20, 2024

VLADIMIR PUTLER HAS GONE AND DONE IT NOW!

Most of you haven’t heard the news yet, but Russia’s most popular political figure, Alexei Navalny, was murdered this past weekend by the brutal dictator temporarily residing in the Kremlin. Well-placed sources say that this hit was ordered by the weak (and little) man known as “Vladimir Putin” because Navalny’s crack team of anti-corruption activists had found child porn on his laptop, and were about to publish this bombshell in media across the globe.

My better placed sources inform me that Putler had given the order to kill him in a fit of rage when he learned from Tucker Carlson that Navalny was a “superfan” of the animated TV series “Rick and Morty”. The show’s subversive and highly intelligent humour (most of you are too dumb to get it) is viewed by Putler as a personal affront because of thesecretly encoded anti-regime messages strategically planted throughout each episode. Russia’s state security service (FSB) tried to decipher them, but their analysts are simply too dumb to be able to do so (remember: the show is for the highly intelligent, which means that most of you can’t get it….so stop pretending that you do).

During the interview prep session, Tucker Carlson shared this now famous photo of Alexei Navalny and his wife Lyudmila watching Rick and Morty on their flight back to Russia from Germany, shortly after Alexei’s recovery from Putlerian poisoning:

The fact that Putler personally went to the Siberian gulag where Alexei was being held prisoner in order to kill him in person speaks volumes about how weak, pathetic, and cowardly the Russian dictator really is. He knew that in any andopen free election Russia (monitored by the OSCE, UN, the CIA, and other trusted international bodies)he would get trounced by Russia’s most popular politician in history. Research shows that in a head-to-head election for the Russian Presidency in a free and fair vote, Navalny would get between 85-91% of the overall popular vote. To put it simply, he had to go.

My very well-placed sources in Russiatell me that there is now a fight over custody of Navalny’s beautiful, swimmer-like corpse. Most assume that this is because Putler fears that an autopsy will reveal how he wasbludgeoned to death with vodka bottles. There is no doubt that this IS the case, but there is also another reason: Putler wants to ensure that no one gets access to Alexei’s perfect remains because it is rumoured that it has already performed three miracles, thus making Russia’s most popular person in history a candidate for sainthood in the Catholic Church.

Some are already calling him “The Messiah of the Russian future”:

I believe this. I also believe thatevery Russian townin 50 years from now will have itsown Navalny Square. Russian writer Lyudmila Ulitskaya agrees with me.

Mikhail Shishkin is fighting for democracy in Russia on the frontline in Switzerland, and I agree with his assessment here: Russian exiles in Switzerland have a great historical track record of returning home and making their country a liberal democratic paradise, so Shishkin is one to watch.

Carole Codswallop also paid tribute to the greatest Russian of all-time:

If you don’t know who Carole is, she is the UK’s leading crusader against misinformation AND disinformation. She is leading two battles simultaneously, and has done incredible work uncoveringhow Putler financed and organized #Brexit. The brutal murder of Alexei makes her work all the more important.

St. Alexei, Patron Saint of Russia and Liberal Democracy

St. Alexei was not always a good person i.e. liberal democrat. In fact, his earlier life resembled that of St. Augustine of Hippo, one of Christianity’s titans. In his youth, Augustine turned away from God to pursue a life of hedonism, eventually realizing that a life without God was not a worthy life at all.

St. Alexei also rejected liberal democracy in his youth, as we can see from this 2007 entry in his LiveJournal:

Much like the typical non-liberal democrat Slav, our St.Alexei was crude, mean, vicious, savage, and sadistic…..just like his murderer, Putler.

It was around this time that God/Liberal Democracy intervened from up on high, andgranted him a scholarship to Yale University via the Yale World Fellows Program. God/Liberal Democracy picked him out of a crowd to set him on the right path, the path of godly liberal democracy. At Yale, St. Alexei attended weekly seminars based around the concept of the “Good Society”:..

https://niccolo.substack.com/p/a-tribute-to-saint-alexei-patron?

>>20451397

kek

Anonymous ID: 74cec5 Feb. 21, 2024, 7:24 a.m. No.20451431 🗄️.is 🔗kun >>1483

Eric Trump OVERJOYED By Special Gift From Q-anon Mar 20, 2022

Eric Trump was presented a huge, insane painting by 'Q' at the ReAwaken America Tour in San Marcos. John Iadarola and Brett Erlich break it down on The Damage Report.

https://youtu.be/uTtIz0DfniM

In San Marcos, Gen. Flynn Gets Surfboard, Eric Trump Accepts ‘Q’ Painting of Father

March 11, 2022

https://timesofsandiego.com/politics/2022/03/11/in-san-marcos-gen-flynn-gets-surfboard-eric-trump-accepts-q-painting-of-father/

https://youtu.be/uCrnJEXfkFA

Q !!mG7VJxZNCI No.342 📁 2347

Oct 5 2018 12:53:48 (EST)

https://twitter.com/Q_ANONBaby/status/1048079911813107713📁

Important moment in time.

The picture will be the signifier.

The signifier will 'force' the Q.

The Q will be answered (((WWG1WGA))).

Q

Anonymous ID: grTMpzrL No.147449624 📁 26

Nov 1 2017 00:41:54 (EST)

Think about it logically.

The only way is the military. Fully controlled. Save & spread (once 11.3 verifies as 1st marker).

Biggest advanced drop on Pol.

Anonymous ID: 74cec5 Feb. 21, 2024, 7:25 a.m. No.20451432 🗄️.is 🔗kun >>1483

Ok Ok so someanon told you that the Great Awakening had something to do with Religion right? Kek… are you sitting down?

DROP #3038

Q !!mG7VJxZNCI 03/12/2019 14:55:14 ID: 4fe510 3038

8chan/qresearch: 5643022

>Decide for yourself (be free from outside opinion).

>Decide for yourself (be objective in your conclusions).

>Decide for yourself (be true in your own beliefs).

>Decide for yourself (be open to following the facts).

>Decide for yourself (be strong in defending your beliefs).

>Decide for yourself (be resistant to blindly accepting fact-less statements).

>Decide for yourself (be free)

Those who attack you.

Those who mock you.

Those who cull you.

Those who control you.

Those who label you.

Do they represent you?

Or, do they represent themselves (in some form)?

Mental Enslavement.

The Great Awakening ('Freedom of Thought’), was designed and created not only as a backchannel to the public (away from the longstanding ‘mind’ control of the corrupt & heavily biased media)

to endure future events through transparency and regeneration of individual thought (breaking the chains of ‘group-think’), but, more importantly, aid in the construction of a vehicle (a ‘ship’)

that provides the scattered (‘free thinkers’) with a ‘starter’ new social-networking platform which allows for freedom of thought, expression, and patriotism or national pride

(the feeling of love, devotion and sense of attachment to a homeland and alliance with other citizens who share the same sentiment).

When ‘non-dogmatic’ information becomes FREE & TRANSPARENT it becomes a threat to those who attempt to control the narrative and/or the stable.

When you are awake, you stand on the outside of the stable (‘group-think’ collective), and have ‘free thought’.

"Free thought" is a philosophical viewpoint which holds that positions regarding truth should be formed on the basis of logic, reason, and empiricism, rather thanauthority, tradition, revelation, or dogma.

When you are awake, you are able to clearly see.

The choice is yours, and yours alone.

Trust and put faith in yourself.

You are not alone and you are not in the minority.

Difficult truths will soon see the light of day.

WWG1WGA!!!

Q

dogma noun

dog·ma | ˈdȯg-mə , ˈdäg-

plural dogmas also dogmata ˈdȯg-mə-tə , ˈdäg-

Definition of dogma

1a: something held as an established opinion

especially : a definite authoritative tenet

b: a code of such tenets

pedagogical dogma

c: a point of view or tenet put forth as authoritative without adequate grounds

2: a doctrine or body of doctrines concerning faith or morals formally stated and authoritatively proclaimed by a church

Anonymous ID: a45d18 Feb. 21, 2024, 7:26 a.m. No.20451433 🗄️.is 🔗kun >>1443

ANONS, READY?

Recent Q-Day COMMS?

>>20430933 - PB

Feb 17 2024 (4:20pm)

If it is in fact go-time, which seems logical with all available Comms considered over the past 24 hours, then either the POTUS or Dan will confirm. "GO TIME" "LFG". There will be something if it's accurate, perhaps tonight's rally.

>https://8kun.top/qresearch/res/20430491.html#q20430933

Be the autists we know you are.

You were chosen for a specific reason.

Anons - "Built for This Time" (Z. Wolfe)

GET READY!

Anonymous ID: 74cec5 Feb. 21, 2024, 7:26 a.m. No.20451434 🗄️.is 🔗kun >>1483

DIG

MEME

PREY

Nov 09, 2017 11:07:15 PM EST #128

Q !ITPb.qbhqo ID: Dx5TPc5d No. 148779656

1510280445405.jpg

Trip added.

[C]oordinated effort to misdirect.

Guide to reading the crumbs necessary to cont[I]nue.

Attached gr[A]phic is correct.

Linked graphics are incorrect and false.

Graphic is necessary and vital.

Time stamp(s) and order[is]critical.

Re-review graphic (in full) each day post news release.

Learn to distinguish between relevant/non-relevant news.

Disinformation is real.

Disinformation is necessary.

Ex: US ML NG (1) False SA True

Why was this necessary?

What questions were asked re: SA prior to SA events?

Why is this relevant?

Think mirror.

Look there, or[here], or there, truth is behind you.

What is a map?

Why is a map useful?

What is a legend?

Why is a legend useful?

What is a sequence?

Why is this relevant?

When does a map become a guide?

What is a keystone?

Everything stated is relevant.

Everything.

Future provides past.

Map provides picture.

Picture provides 40,000ft. v.

40,000ft. v. is classified.

Why is a map useful?

Think direction.

Think full picture.

Who controls the narrative?

Why is this relevant?

What is a spell?

Who is asleep?

Dissemination.

Attention on deck.

There is an active war on your mind.

Be[p]repared.

Ope[r]ations underway.

Operators[a]ctive.

Graphic is essential.

Find the ke[y]stone.

Moves and countermoves.

They never thought she would lose.

Snow white.

Godfather III.

Iron Eagle.

Q

Q !UW.yye1fxo 01/22/2018 21:50:37 ID: b189f8 587

8chan/qresearch: 130667

PRAY.

PREY.

Notice the similarity?

Q

>>20451429

2/3

Good Society. World Fellows present to each other their vision for making the world a better place, what they do professionally, and how they contribute to building the ‘good society.’..

He also attended salons:

Salon. World Fellows host distinguished guestsfor discussions on key topics, expanding their knowledge and challenging their views….

St. Alexei also experienced his own personal development:

World Fellows receive individual and group coaching and skills development training. World Fellows can audit many of the 2,000+ courses offered at Yale, work on individual or collaborative projects, and conduct independent research.…

And most important of all, he was brought into a circle of good, liberal democratic people, all of whom know that thepurpose of life is to spread liberal democracy around the globe no matter how many millions of people need to be killedin the process of saving the world from non-liberal democrats:

Fellows expand their global network by connecting with World Fellowsin their cohort and with other Fellows spread throughout the world. Yale’s campus also provides countless opportunities to connect with faculty and students over shared professional and academic interests.

Navalny left the Yale World Fellows Program a new man. No longer would he ally himself with Russian Neo-Nazis. No longer would he spew hate against Jews, “faggots”, and “black-asses” (the evil Russian term for those from Russia’s southern periphery). He would now spew hate only against non-liberal democrat Russians, just like God demands of us all. Alexei was finally saved.

St. Alexei’s mission was now a simple one:deliver to Russia the liberal democracy that its people want and crave, but that Putler and his henchmen refuse to allow. With the financial support of liberal democratic Russian business oligarchs of the 1990s, St. Alexei began to uncover the worst cases of corruption in Russian history. Russia had never seen such massive and brazen corruption before. In fact, it was the central purpose of Putler’s Russia.St. Alexei urged Russia to return to the economic paradise of the 1990s,where market reforms worked to improve the lives of all Russians, hand-in-hand with efforts to institute liberal democrat rule. Like the vast majority of Russia’s citizens, St. Alexei wanted to turn the clock back to the incredibly successful and utopian Yeltsin Era.

St. Alexei’s efforts to bring liberal democracy to Russia were so close to succeeding that Putler had him poisoned with Novichok in 2020. Our saint had to flee to Germany to get proper treatment to save his life so that he could continue his crusade on behalf of the Russian people and western financial and state security interests.Displaying his bravery and his total lack of fear, he hilariously returned to Russia in early 2021, defying little-man Putler, daring the dictator to toss him in jail.

Putler accepted the challenge and threw him into prison…..and then had him killed three years later.

St. Alexei, Patron Saint of Russia and Liberal Democracy, Pray For Us

A hero, a saint, and also an oracle. St. Alexei urged Russia not to support evil Syrian dictator Bashar Assad in his brutal,genocidal war against the liberal democrats of al-Nusra and ISIS: Liberal democracy won in Syria, just like our saint had predicted.

Our saint also called out the brutal, genocidal Russian invasion of Ukraine as well. My humble request is thatMoscow be renamed ‘Navalnygrad’ (or Navalnyyhrad in Ukrainian spelling)once the Ukrainian Army liberates it from Moskal rule and a liberal democratic government isinstalled in power by the CIA and MI6. This would be the most fitting tribute to St. Alexei, Patron Saint of Russia and Liberal Democracy…

https://niccolo.substack.com/p/a-tribute-to-saint-alexei-patron?

Anonymous ID: 74cec5 Feb. 21, 2024, 7:26 a.m. No.20451436 🗄️.is 🔗kun >>1483

Nov 12, 2017 2:52:34 PM EST #144

Q !ITPb.qbhqo ID: /jAm9Qi+ No. 149140639

Patriots don’t sleep.

40,000ft. v. necessary to understand[US]/SA/global events.

Paint the picture.

Decrease altitude (we will not fly that high again).

Higher the altitude greater the[risk]of conspiracy ST.

Many cannot/will not swallow.

What is No Such Agency - Q group?

Who has clearance to full picture?

Important.

SIS is good.

+++Adm R+++

What agency is at war w/ Clowns In America?

How does POTUS shift narrative?

(New) Age of Enlightenment.

80% covert.

20% public.

What has occurred over[th]e last several months?

C-info leaks?

Operations (think SA + ???)?

CNN sale?

What co’s rec large cash injections by Clowns In America (public)?

Why???

Who does[i]t hurt?

Who control[s]the MSM?

Primary objective from beginning: POTUS discredit MSM.

[W]hy is this relevant?

How is information transmitted?

How are people inform[e]d?

Why was Sarah A. C. attacked (hack-attempt)?

Why was Op[e]ration Mockingbird repeated?

Why was Jason Bourne (CIA/Dream) repeated?

Think social media platforms.

Who are the WIZARDS & Warloc[k]s?

What council do the WIZARDS & Warlocks control?

Think Snowden (inside terms dropped).

Alice & Wonderland – understood.

Snow White – understood.

Iron Eagle?

Godfather III?

Speed?

Everything has meaning.

Disney is a distraction.

Senate & Congress = puppets (not all)(power shift).

For[GOD & COUNTRY].

For HUMANITY.

GERONIMO.

Q

Nov 12, 2017 2:52:34 PM EST #144

Q !ITPb.qbhqo ID: /jAm9Qi+ No. 149140639

Patriots don’t sleep.

40,000ft. v. necessary to understand[US]/SA/global events.

Paint the picture.

Decrease altitude (we will not fly that high again).

Higher the altitude greater the[risk]of conspiracy ST.

Many cannot/will not swallow.

What is No Such Agency - Q group?

Who has clearance to full picture?

Important.

SIS is good.

+++Adm R+++

What agency is at war w/ Clowns In America?

How does POTUS shift narrative?

(New) Age of Enlightenment.

80% covert.

20% public.

What has occurred over[th]e last several months?

C-info leaks?

Operations (think SA + ???)?

CNN sale?

What co’s rec large cash injections by Clowns In America (public)?

Why???

Who does[i]t hurt?

Who control[s]the MSM?

Primary objective from beginning: POTUS discredit MSM.

[W]hy is this relevant?

How is information transmitted?

How are people inform[e]d?

Why was Sarah A. C. attacked (hack-attempt)?

Why was Op[e]ration Mockingbird repeated?

Why was Jason Bourne (CIA/Dream) repeated?

Think social media platforms.

Who are the WIZARDS & Warloc[k]s?

What council do the WIZARDS & Warlocks control?

Think Snowden (inside terms dropped).

Alice & Wonderland – understood.

Snow White – understood.

Iron Eagle?

Godfather III?

Speed?

Everything has meaning.

Disney is a distraction.

Senate & Congress = puppets (not all)(power shift).

For[GOD & COUNTRY].

For HUMANITY.

GERONIMO.

Q

> D5 rocket

Used needles are being found in the snow on rural gravel back roads in Vermont. So many it's causing an issue. No sauce because no one has (or will) published this. Anon is reporting this here.

Anonymous ID: 74cec5 Feb. 21, 2024, 7:27 a.m. No.20451439 🗄️.is 🔗kun >>1483

Nov 03, 2017 5:33:30 PM EDT 67

Anonymous ID: GVUvg1M7 No. 147816901

Where is John Podesta?

Where is Tony Podesta?

Did one or both escape the country and was let out?

WHERE IS BO?

WHERE WAS BO YESTERDAY?

What is the difference between commercial and private re: security clearance for departure?

Who is the TSA head?

Which party did he contribute to?

What is of particular interest when researching?

How does HS interact w/ TSA?

What updated post 9-11 protocols were put in place to prevent/stop inbound/outbound C-level targets?

What local airports are in close proximity to DC?

What happened shortly after 9-11 (specifically with all aircraft)?

Who was authorized to depart? ONLY 1 PLANE was authorized during this 'mandatory forced grounding'.

Who SPECIFICALLY authorized this?

What airport did the departure take place at?

Why is this relevant?

How does it tie together?

Podesta's plane has military escort (i.e. tag) and is being diverted (forced down).

Short delay.

This will be leaked.

Watch the news.

Have faith.

What fake news anchor will not be on air tonight?

Why is this relevant?

What was stated in the past?

Where did the $18b from Soros go?

Why?

Can it be used by bad actors (escape, bribes, rogue contractors, etc.)?

Slush fund?

Did the US gov't seize/stop/track other slush funds that prevent or create risk to operate?

Why did JK travel to SA recently?

What is SA known for?

Where do the biggest donations originate from?

Why is this relevant?

What else is relevant w/ SA?

Safe harbor?

Port of transfer?

Why was there a recent smear campaign against JK and POTUS?

Why is the timing important?

Who released the article?

The council of WIZARDS & Warlocks cannot be defeated.

Nice view up here.

Q

What are the impacts of the Red Sea shipping crisis?

The Red Sea shipping crisis is disrupting global supply chains and increasing freight costs.

The Red Sea shipping crisis — a result of Houthi rebel attacks on cargo ships and tankers — is causing hundreds of vessels to avoid the Suez Canal, one of the world’s most important waterways. Instead, these vessels are being forced to reroute around southern Africa — a lengthy detour that adds 4,000 miles to each journey, vastly increasing transport times and freight costs. Will the crisis reignite supply chain issues and fuel inflation concerns?

With 30% of global container trade passing through the Suez Canal, the Red Sea shipping crisis is upending supply chains. This is compounded by the ongoing shipping disruptions caused by blockages in the Panama Canal, which is experiencing one of the region’s worst droughts since the 1950s.

https://www.jpmorgan.com/insights/global-research/supply-chain/red-sea-shipping

>>20451435

3/3

St. Alexei joins a long list of liberal democrats who have been murdered by Putler. Some of the better known victims include:

Ibn al-Khattab (1963-2002)

al-Khattab was a Saudi liberal democrat who went to Chechnya to lead the Arab Mujahideen there, in its quest to end Russian rule not just in that province, but in the whole of the Caucaus region. His objective was to set up the Islamic Liberal Democratic Emirate of the North Caucasus. In 2002,Putler donned a goat costume, and then sexually lured al-Khattab into a wooded area near the Georgian border. Once he had him alone, Putler stabbed al-Khattab 50,000 times, most likely leading to the liberal democrat’s death.

Yevgeny Prigozhin (1961-2023)

Prigozhin was a liberal democrat who headed the Wagner liberal democratic paramilitary force, composed of 80,000 Russian liberal democratic political prisoners, all imprisoned by Vladimir Putler. Wagner was to be the nucleus of the Free Russian Liberal Democratic Army that would march on Moscow/Future Navalnyyhrad, but his heroic effort to free Russia unfortunately failed. Putler murdered him in 2023 using a remote control device to bomb the plane he was aboard on at the time.

Boris Berezovsky (1946-2013)

The most powerful liberal democratic businessman of Russia’s Golden Liberal Democratic Age of the 1990s, he failed to detect just how malicious, evil, and especially, cunning, Putler actually was.After all, it was Boris who raised him up through the various verticals of power, convincing the Great Boris Yeltsin that Vladimir should be his successor, the one to finalize Russia’s transition to free-market liberal democracy. Upon gaining power, Putler turned the tables on liberal democrat and free market reformer Berezovsky,forcing him into exile in the UK. Boris would spend the next decade working as an NGO activiston behalf of liberal democracy and human rights in Russia. In 2013, Putler infiltrated his mansion in the Kentish countryside, andhanged him in his bathtub. It was ridiculously ruled a ‘suicide’.

Shamil Basayev (1965-2006)

The most powerful military leader of the Chechen resistance to Putler’s anti-liberal and anti-democratic rule, liberal democratic freedom fighterBasayev masterminded not only the Moscow Theater Hostage Liberation in 2002, but also the very successful liberal democratic attack on the elementary school in Beslan in 2004which resulted in the deaths of 300+ children,all of whom were future Putler loyalists. Basayev was an incredibly effective guerrilla leader, and a man whose dedication to liberal democracy, human rights, andfreedom won him admiration across the globe, including from liberal-democratic NGO al-Qaida. In 2006, Basayev fell victim to the same ploy that had ensnared and killed al-Khattab. Putin could not believe that he fell for it after knowing what had happened to his liberal-democratic colleague and fellow freedom fighter from Saudia Arabia.

St. Alexei Had a Dream

Imagine a Russia that would no longer be ruled by Putler and his clique. Imagine a Russia that would return to the halcyon days of the Yeltsin Era.Imagine a Russia, both free and democratic, one in which all of its natural resources could be stripped by foreign financial interestswho have only the best interests of Russia and Russian at heart. Imagine a Russia shrunk down to the size of Muscovy, with a free Tatarstan, Bashkortostan, Dagestan, etc. removed from its rule, allowed to pursue its own liberal democratic path.

This is the vision of St. Alexei, Patron Saint of Russia and Liberal Democracy. See you next year in Navalnyyhrad.

https://niccolo.substack.com/p/a-tribute-to-saint-alexei-patron?

Anonymous ID: bbc18d Feb. 21, 2024, 7:28 a.m. No.20451442 🗄️.is 🔗kun >>1447

>>20451259

>RNC Chair Candidate Michael Whatley Refused to Investigate Fraud in NC

Is like sending Nimrada to ambassador at the UN to get a proper governor in SC?

Who's replacing him in North Carolina?

RNC is useless right now.

Anonymous ID: 433042 Feb. 21, 2024, 7:29 a.m. No.20451443 🗄️.is 🔗kun >>1461

>>20451433

>Be the autists we know you are.

Nov 12, 2017 2:52:34 PM EST #144

Q !ITPb.qbhqo ID: /jAm9Qi+ No. 149140639

Patriots don’t sleep.

40,000ft. v. necessary to understand[US]/SA/global events.

Paint the picture.

Decrease altitude (we will not fly that high again).

Higher the altitude greater the[risk]of conspiracy ST.

Many cannot/will not swallow.

What is No Such Agency - Q group?

Who has clearance to full picture?

Important.

SIS is good.

+++Adm R+++

What agency is at war w/ Clowns In America?

How does POTUS shift narrative?

(New) Age of Enlightenment.

80% covert.

20% public.

What has occurred over[th]e last several months?

C-info leaks?

Operations (think SA + ???)?

CNN sale?

What co’s rec large cash injections by Clowns In America (public)?

Why???

Who does[i]t hurt?

Who control[s]the MSM?

Primary objective from beginning: POTUS discredit MSM.

[W]hy is this relevant?

How is information transmitted?

How are people inform[e]d?

Why was Sarah A. C. attacked (hack-attempt)?

Why was Op[e]ration Mockingbird repeated?

Why was Jason Bourne (CIA/Dream) repeated?

Think social media platforms.

Who are the WIZARDS & Warloc[k]s?

What council do the WIZARDS & Warlocks control?

Think Snowden (inside terms dropped).

Alice & Wonderland – understood.

Snow White – understood.

Iron Eagle?

Godfather III?

Speed?

Everything has meaning.

Disney is a distraction.

Senate & Congress = puppets (not all)(power shift).

For[GOD & COUNTRY].

For HUMANITY.

GERONIMO.

Q

NCSWIC

https://www.cisa.gov/safecom/NCSWIC

Chief Justice John Roberts Appointed Every Judge on the FISA Court

Is that too much power for one person?

https://www.nationaljournal.com/s/72339/chief-justice-john-roberts-appointed-every-judge-fisa-court

Anonymous ID: b41d33 Feb. 21, 2024, 7:29 a.m. No.20451445 🗄️.is 🔗kun >>1455

Can anyone direct me to the ….part of Russia that's like Florida..gotta be one

They said that it's cold and brutal and never can remember good…

So….

>>20451318

>7,ClipboardImage.png)

>>20451442

>Is like sending Nimrada to ambassador at the UN to get a proper governor in SC?

>Who's replacing him in North Carolina?

>RNC is useless right now.

>>20451387

>They will not get a second try.

"FINAL BATTLE"

>>20451384

A place to launch

To a target elsewhere

And all the snoops to masint etc….

Holy See–United States relations https://en.wikipedia.org/wiki/Holy_See_United_States_relations

The current United States Ambassador to the Holy See is Joe Donnelly, who replaced the ad interim Chargé d'Affaires, Patrick Connell, on April 11, 2021. The Holy See is represented by its apostolic nuncio, Archbishop Christophe Pierre, who assumed office on April 12, 2016. The U.S. Embassy to the Holy See is located in Rome, in the Villa Domiziana. The Nunciature to the United States is located in Washington, D.C., at 3339 Massachusetts Avenue, N.W.

History

1797–1867

The United States maintained consular relations with the Papal States from 1797 under President George Washington and Pope Pius VI to 1867 and President Andrew Johnson and Pope Pius IX. Diplomatic relations existed with the Pope, in his capacity as head of state of the Papal States, from 1848 under President James K. Polk to 1867 under President Andrew Johnson, though not at the ambassadorial level. These relations lapsed when on February 28, 1867, Congress passed legislation that prohibited any future funding of United States diplomatic missions to the Holy See. This decision was based on mounting anti-Catholic sentiment in the United States,[1] fueled by the conviction and hanging of Mary Surratt, and three other Catholics, for taking part in the conspiracy to assassinate President Abraham Lincoln. Her son, John Surratt, also Catholic, was accused of plotting with John Wilkes Booth in the Assassination of Abraham Lincoln. He served briefly as a Pontifical Zouave but was recognized and arrested. He escaped to Egypt but was eventually arrested and extradited. There was also an allegation that the Pope had forbidden the celebration of Protestant religious services, which had been held weekly in the home of the American Minister in Rome, within the walls of the city.[2]

History

1867–1984

From 1867 to 1984, the United States did not have diplomatic relations with the Holy See in the wake of rumors of Catholic implication in the Lincoln assassination.[3]

Parakletos ID: 4c12a4 Feb. 21, 2024, 7:30 a.m. No.20451451 🗄️.is 🔗kun >>1459

>>20451444

>Primary objective from beginning: POTUS discredit MSM

Done

The world was just reminded - America is protected.

And our retaliation will be "success".

[You] lose, we win.

How the Vatican controls the U.S. Supreme Court

Who is Leonard Leo?keywords/names King Maker > Sovereign Military Order ofMalta> Federalist Society > Clarence Thomas > Steven Calabresi > Steve Bannon > Liberty Central > Virginia Thomas > the Catholic Association >

Charles Koch and Rebekah Mercer BH Group > CRC Advisors > The 85 > Concord Fund > United States Commission on International Religious Freedom > National Catholic Prayer Breakfast > Kellyanne Conway >

Judicial Education Project >Virginia Thomas Brent Bozell > Media Research Center > Ralph Reed > Faith and Freedom Coalition > Brooks Brothers, check out that Logo

https://en.wikipedia.org/wiki/Leonard_Leo

John G. Roberts, Jr., Chief Justice of the United States.

Nominated as Chief Justice of the United States byPresident George W. Bush, he assumed that office on September 29, 2005.

Trump on Roberts July 5th 2012 "John Roberts arrived inMaltaToday. Maybe we will get lucky and he will stay there."

https://en.wikipedia.org/wiki/John_Roberts

Leonard Leo appears to control John Roberts and both appear to be Knights of Malta.

For those who like to claim that the Vatican does not control the "Sovereign Military Order of Malta"…

Pope dissolves Knights of Malta leadership, issues new constitutionSeptember 3, 2022

https://www.reuters.com/world/europe/pope-dissolves-knights-malta-leadership-issues-new-constitution-2022-09-03/

Who is Harlan Crow?keywords/names Member Bohemian Grove > Bohemian Club > Collects Nazi memorabilia because he hates Fascism so much > Clarence Thomas > Gifts > Vacations > George Bush

Trammell Crow Company Crow Holdings > Club for Growth > American Enterprise Institute > No Labels > St. Kitts and Nevis

Brother Trammel Crow https://dallasexpress.com/national/trammell-crow-jr-named-in-human-trafficking-case/

https://en.wikipedia.org/wiki/Harlan_Crow

Furthermore…

Clarence ThomasU.S. Supreme Court Justice.

Thomas was nominated byPresident George H. W. Bushto succeed Thurgood Marshall.

Thomas as well as other Supreme Court Justices have been receiving "financial support" from Harlan Crow, Leonard Leo, Paul Singer and a slew of other deep state operatives and this is now becoming public knowledge.

https://en.wikipedia.org/wiki/Clarence_Thomas

Harlan Crow appears to control Clarence Thomas and both appear to be Members of the Bohemian Club.

'''Clarence Thomas Leonard Leo > Harlan Crow is the News Now.'''

https://justthenews.com/government/congress/house-republicans-launch-inquiry-dc-ags-investigation-leonard-leo

https://accountable.us/leonard-leos-decades-of-corruption-driving-the-news/

https://www.washingtonexaminer.com/policy/courts/leonard-leo-investigation-led-by-dc-ag-may-be-improper-gop-chairmen

https://www.newsmax.com/newsfront/jim-jordan-james-comer-letter/2023/10/30/id/1140289/

https://www.propublica.org/article/we-dont-talk-about-leonard-podcast

https://www.propublica.org/series/supreme-court-scotus

Anonymous ID: e4dc25 Feb. 21, 2024, 7:31 a.m. No.20451454 🗄️.is 🔗kun >>1534

It appears that there is great anxiety in the minds of humanity. More so than last week. Anon has pulse on this due to type of job. My prediction is that in two weeks we will know why all the anxiety is in the aether at the moment.

>>20451445

Sochi

>>20451429

BTW the max votes was less then 2% for Nalvany, that is how effective propaganda by stupid journalists are

Parakletos ID: 4c12a4 Feb. 21, 2024, 7:32 a.m. No.20451457 🗄️.is 🔗kun >>1463

>>20451450

Who is "The See"

The Holy See is below "The See"

Think England.

the British are coming!

>>20451451

OSS WANTS TO PLAY TODAY?

Anonymous ID: 74cec5 Feb. 21, 2024, 7:33 a.m. No.20451460 🗄️.is 🔗kun >>1483

Jul 27, 2018 2:13:18 PM EDT 1735

Q !CbboFOtcZs ID: dc4bac No. 2313022

There is nothing more precious than our children.

Evil has no boundaries.

https://genius.com/SLAYER-evil-has-no-boundaries-lyrics

The choice to know will ultimately be yours.

These people are SICK!

https://www.foxnews.com/entertainment/2018/07/27/cbs-honcho-les-moonves-will-be-accused-sexual-misconduct-in-latest-ronan-farrow-bombshell-report-says.html

To those who are courageous enough to speak out - we stand with you!

You are not alone in this fight.

God bless.

Q

Nuns Raped Girls With Crucifixes as Female Pedophilia Was Covered Up by the ChurchUNFORGIVEABLE Oct. 05, 2021

https://www.thedailybeast.com/nuns-raped-girls-with-crucifixes-as-female-pedophilia-was-covered-up-by-the-church

Nuns used crucifixes to rape girls during decades of abuse carried out by clergy in France's Catholic Church that saw attacks on 330,000 children covered up 'by a veil of silence', damning report finds5 October 2021

https://www.dailymail.co.uk/news/article-10059827/Major-report-expose-sex-abuse-Frances-Catholic-Church.html

Pope Francis expresses 'shame' at news French Catholic Church covered up sex abuse of over 300,000 childrenOctober 07, 2021

https://www.irishpost.com/news/pope-francis-expresses-shame-at-news-french-catholic-church-covered-up-sex-abuse-of-over-300000-children-221410

SHOCKING REPORT Nuns used crucifixes to rape girls during decades of abuse by French clergy, with 330,000 victims covered upOct 5 2021

https://www.the-sun.com/news/3798829/nuns-crucifixes-rape-girls-france-catholic-church/

French Catholic church expresses ‘shame’ after report finds 330,000 children were abused5 Oct 2021

https://www.theguardian.com/world/2021/oct/05/french-catholic-priests-abused-children-report

New Report Finds 330,000 Children Abused in French Catholic Church Over 70 Years

https://www.thedailybeast.com/german-nuns-sold-orphaned-children-to-sexual-predators-says-report

>>20451443

>adapted

Q !!Hs1Jq13jV6 ID: dd7b12 No.10597304 📁

Sep 10 2020 20:21:55 (EST)

FB-TWIT using DARPA provided software to censor and restrict picture content using 'matching' [think reverse image] _upload one to find/locate all [cycling 5s].

>>

Adapt & overcome.

trying to nucleotide and protein blast

confusing at first

still is

but this shit is interesting

Anonymous ID: 74cec5 Feb. 21, 2024, 7:33 a.m. No.20451463 🗄️.is 🔗kun >>1483

>>20451457

They want you divided.

Divided by religion.whoa! whoa! hang… hang on!

Divided by sex.free speech board

Divided by political affiliation.free speech board

Divided by class.free speech board

'''Timeline - 2018 to 2021 - the first 3 years of Q research from 4chan 8kun'''

Former Board Owner Fast Jack is a Neo Nazi

Former Board Volunteer and Baker OSS is a Neo Nazi

Former Baker and OSS acolyte Animefagbaker is a Neo Nazi

OSS and Animefag were open about their Nazi tendencies yet one had to lurk into admin boards to find Fast Jack expressing his Nazi hatred of The Jewish Race via muh joo "kike, fucking kikes, all kikes should die" etc etc.

Neither Jim nor Codefaggot Ron ever expressed having any Problems or Concerns with this Fact. In fact, Laughter was the common response.

Notable: Little shill bitches just love to pretend that their muh joo shilling is why SPAM now… kekEnter shills such as ParaTesticlees, RUSSELL GOULD BOT

FYI:

Neo Nazi's tend to be Catholic and/or Christian. Hitler was a confirmed Catholic yet this fact is hidden in History.

Neo Nazi's see themselves as "Defenders of the Faith" so any appeals to Logic and Reason versus Dogma are seen as personal attacks.

Neo Nazi's are not here to help or otherwise promote Q or Anons. They see Q as simply a vehicle where they will inject their ideology, grift and attempt to steer the flow of information.

Neo Nazi's wish to appear very PRO CHILDREN, ANTI ABORTION & PRO RELIGION yet many have been found to be quite the opposite and simply hiding behind Religion in order to spread their Hate, Evil.

Neo Nazi's are fond of Catholicism because Catholicism, like Christianity, has Racism built in. See: Good Friday Prayer for the Faithless Jews.

Neo Nazi's are attracted to POTUS because they believe POTUS is a racist, albeit secretly, and will thus promote policies which they agree with.

Neo Nazi's strive to get into command and control positions CCP as they believe that their influence can alter the outcome of the Plan!

Neo Nazi's have a powerful foothold in former Axis Power Japan.

Neo Nazi's from /pol/ make up the bulk of the Neo Nazis on Kun.

Neo Nazi's, like Law Enforcement, like to use the symbolism of St. Michael.

Neo Nazi's are funded by Soros. Soros, of course, takes orders from the "Eye of Providence" drop #133.

MORE FYI:

MUH JOO bots ran on 50-75 posts per bread.

MUH JOO shill team 6 ran the Kitchen most of the time.

MUH JOO bakers loved P = Payseur, Inthematrixxx MG SHOW > Karli Bonne > Steve Bannon > Alex Jones > Jack Posobiec > Flynn et al.

MUH JOO bakers would let anything ANTI POPE FRANCIS in notes but they would fight fiercly to keep out any true criticism of the Vatican/Roman Catholic Church. Francis must be the Fall Guy.

MUH JOO bakers had to be pinned down in order for them to note the Vatican atrocities that were being exposed daily.

Q had to step in and Q these hard articles as these "Bakers" would flatly refuse. Split the bread, delete notes et al. they did everything in their power to stop the flow of Information.

Q Drop #4799 is one of these Drops. Read it. Anon was fighting with OSS late one night when Q Q'ed anon. MJ Fakers refused to note Pompeo's trip to the Vatican. Q saw it. Q knows…

Right when POTUS was blaming "CHINA WUHAN" daily for the Virus, these clowns were trying to hide and obscure the Fact that the Vatican had and was renewing a Condordat with China.

What does MUH JOO mean?

A MUH JOO shill is someone who believes or pretends to believe that the Jewish race and/or religion is responsible for most if not all atrocities ever committed.

A MUH JOO shill believes Hitler was a pretty cool dude.

A MUH JOO shill believes Palestine is the good guy in the Israel - Palestine conflict.

A MUH JOO shill does not like to consider radical islam Iran as the potential main agitator in the Israel - Palestine conflict.

A MUH JOO shill desires to believe that no matter all the power in Europe that the Bauer Rothschild family (Knights of Malta) subdued Europe via Banking. No really.

A MUH JOO shill believes that it was easy to see that it was the JOO this whole time and that does not bother them at all… that it was "easy to see".

Parakletos ID: 4c12a4 Feb. 21, 2024, 7:34 a.m. No.20451464 🗄️.is 🔗kun >>1468

>>20451453

Knights of Columbus

happy digging.

SETTING UP TRUMP -Ain't it funny how the evidence of democrat collusion is all over the place but the old diaper faggot blabber mouth Chuck Grassley never does a damn thing same for Jim Jordan he never gets shit done either.

There is no two party system in Washington DC it's only one criminal SYNDICATE lying to the American people everyday.

Anonymous ID: a61d53 Feb. 21, 2024, 7:34 a.m. No.20451466 🗄️.is 🔗kun >>1484

2 hours and 27 minutes left…

https://gettrumpsneakers.com

Vaticunt shill and Nikki courting each other again. So cute.

>>20451464

CATHOLIC INSURANCE COMPANY SCAMMERS ARE LOW ON THE TOTEM

YOU ENJOYED DEFENDING P = PAYSEUR AS NIGHT SHIFT RECALLS?

PAYSEUR PART 3: [P]=Payseur Confirmed. Q Lounge Live 8/28

"PART 3 Q CONFIRMS [P]=Payseur from of my very FIRST EVER presentation on the [P]=Payseur on 8/26/18 from our July dig with host @ShadyGrooove."

Q confirms [P] = Payseur!

"In the Vatican - Holy See Q Drop #1950 "Recipe for ……." Q meant P,A,Y,S,E,U,R".

https://rumble.com/v17fgrt-q-lounge-live-payseur-part-3.html

https://youtu.be/4Nol07Dmo7M

https://rumble.com/embed/v14tatr/?pub=4

Q DROP #1950

Holy See Corrupt Universal Government of the Catholic Church

Q !!mG7VJxZNCI 28 Aug 2018 - 4:12:23 PM

U.S.-HOLY SEE RELATIONS

"The Holy See is the universal government of the Catholic Church and operates from Vatican City State, a sovereign, independent territory. The Pope is the ruler of both Vatican City State and the Holy See. The Holy See, as the supreme body of government of the Catholic Church, is a sovereign juridical entity under international law."

https://www.state.gov/r/pa/ei/bgn/3819.htm

Wealth?

Power?

Sanctuary against criminal prosecution?

Recipe for …….

Q

Q Drop #416

Anonymous 12/21/2017 20:31:58 ID: deb9fa

8chan/cbts: 143329

Soros takes orders fromP.

You have no idea how sick and evil these people are.

Fight, fight, fight.

Day of days.

Game over.

Q

Q DROP #1413

Guardian of the Pope Owl Photo

Q !4pRcUA0lBE 17 May 2018 - 8:15:27 PM

Guardian_P.png

Guardian of thePope.

[Personal]

Q

PAYSEUR PART 4: TRUST the Plan 12/14 Q Lounge Live #Qarmy

"Starting at 20:00 after we go over the Q linkING to to my Twitter once again. Q2582.

Part 4 PAYSEUR, TRUST the Plan with myself and host @ShadyGrooove. Bringing ALL the PAYSEUR information to today!"

"A 1000 year old illusion!"

"Conspiracy analysts"

"Q uses the word Trust all the time"

"The mirror of Trust is anti Trust!"

"Trust trust trust!"

"When Q says "TRUST the plan" Q is referring to the Payseur trust!"

"it's not Pope, it's not Pindar, it is Payseur!"

https://rumble.com/v188h6f-q-lounge-live-trust-the-plan-payseur-part-4.html

https://youtu.be/SYC-owQuIeE

https://rumble.com/embed/v15mb8n/?pub=4

>>20451307

NEW EYES

Yes it would.

"Read the Bible. God wins."

Past tense Future tense.

Anonymous ID: bbc18d Feb. 21, 2024, 7:36 a.m. No.20451470 🗄️.is 🔗kun >>1566

>>20451247

>>20451255

A Stunning 10 Million Illegals Have Entered The US Under Biden; Tucker Warns They Are "Destroying" The Country

https://www.zerohedge.com/economics/stunning-10-million-illegals-have-entered-us-under-biden-tucker-country-being-destroyed

Anonymous ID: 388337 Feb. 21, 2024, 7:36 a.m. No.20451472 🗄️.is 🔗kun >>1479

>>20451452

>>20451461

Three words that blew my little mind at 12 years old watching this movie for the first time, and literally molded my behavior moving forward from that point. 100% of the time it works every time.

>>20451459

Not OSS

but in teaching mood. Catholic religion is the worst "Christian" religion of them all. My opinion.

And yes, they are powerful. But the Catholic religion is a tool used by the Rothschilds. Hence the 1832 loan.

And why did the ultra wealth Vatican need a loan?

The MSM's degenerate hero, what a surprise.

Parakletos ID: 4c12a4 Feb. 21, 2024, 7:38 a.m. No.20451477 🗄️.is 🔗kun >>1483 >>1505

>>20451468

OK, so the Vatican runs the world. Now what?

The pinned thread in which we thanked Q team and expressed our appreciation for them, has been archived.

So I would like to take some space and thank them for their sleepless nights, give prayers for operators in harm’s way, and share our optimism for the future.

Let us take take a moment too, to thank them for this front row seat. Even though it’s the front row of a death defying roller coaster, this here is the unprecedented ride of a lifetime.

>>20451452

>>20451472

Flags Out, Anons?

FLAGS OUT!

Anonymous ID: a3b5ca Feb. 21, 2024, 7:40 a.m. No.20451480 🗄️.is 🔗kun >>1528

>>20449409 (pb) Apparently some ways to boost your reach on the socials algorithm

Just a reminder that this 'relics of 1.0' is bullshit apologetics for Muskhead

Dozens of complete social media platforms have been built from the ground up without censorship or algorithm manipulation - JUST SINCE MUSK TOOK OVER.

He could have rebuilt it, he chose not to. Or does not have the power to.

Use Nostr Instead

Anonymous ID: 8a9098 Feb. 21, 2024, 7:41 a.m. No.20451481 🗄️.is 🔗kun >>1576

>>20451280

This makes me feel old

THE BETTER QUESTIONS ARE

1: WHY WOULD THE VATICAN OR THE ROTHS WISH FOR THAT KNOWLEDGE TO BECOME PUBLIC KNOWLEDGE?

2: WHY WOULD THE ROTHSCHILDS ACCEPT ADMITTANCE INTO THE KNIGHTS OF MALTA OR OTHER PAPAL RELIGIOUS ORGANIZATION AFTER THE LOAN?

3: WHAT IS A COURT FACTOR?

4: stop ignoring the decode of drop #133

These 3 questions destroy your MUH JOO narrative and it is quite the anomally that a deep digging thinker does not seem capable of considering these questions.

>>20451477

you havent seen the CLICK CLICK decode or you just don't want to?

>>20451466

Are the gold sneakers available?

>Satan, or the Devil, is one of the best-known characters in the Western traditions of Judaism, Christianity, and Islam. Surprisingly, this entity was a late-comer in the ancient world. Satan, as a totally evil being, is nowhere to be found in the Jewish Bible. He evolved during the height of the Persian Achaemenid Empire (beginning c. 550 BCE) and was adopted by Jews living under Persian rule at the time. His formal name, Satan, derives from the Hebrew 'ha-Satan'. 'Ha' means 'the' and 'Satan' means 'opposer' or 'adversary'. The name described his eventual function as the opposer of God’s creation. Greek 'diabolos', English 'devil', meant 'accuser', 'slanderer', again describing his role. The concept of Satan emerged over time and in phases.

>Evil has always existed. Humans encountered natural disasters (earthquakes, floods), wars with pillage and rape, disease, plagues, and infant mortality, man-made evil such as murders and theft, and of course, death. As the ancients constructed their religious systems, the existence of evil had to be explained and rationalized. Creation myths often designated a high god or a king of the gods, who controlled everything including the other gods as well as nature. In this capacity, they were responsible for both good and evil. The term to describe this ability is omnipotence (all-powerful). In Deuteronomy 28, God declares that he controls both prosperity and suffering. Many creation myths addressed how and why evil arose.

they worship satan meaning they worship deceit, lies, and evil

https://www.worldhistory.org/article/1685/the-origin-of-satan/

thoughts in your own mind - good/evil

follow good - you are of truth

follow evil - you are of lies, deceit

they are not supernatural beings that will one day come from under the earth or down from the clouds

>>20451452

>timestamp?

>archived?

>>20451473

>>20451478

Anonymous ID: ed7101 Feb. 21, 2024, 7:43 a.m. No.20451487 🗄️.is 🔗kun >>1490

>>20451155