Anonymous ID: aee2d4 Q Research General #1611 What's in the Boooox?!? Edition May 3, 2018, 6:27 a.m. No.1285122   πŸ—„οΈ.is πŸ”—kun   >>5401 >>5469 >>5638

Welcome To Q Research General

 

Q's Tripcode: Q !xowAT4Z3VQ

 

Q's Latest Posts

 

Wednesday 5.02.2018

>>1280616 ------------------ (Shipping Pallets)

>>1280036 ------------------ (Apple HQ)

>>1280030 ------------------ (JetBlue taking off from San Jose?)

 

Monday 4.30.2018

>>1249365 ------------------ Knowing what you know now.

>>1248119 ------------------ Define the terms of the Iran nuclear deal.

>>1247406 ------------------ No name out.

>>1244154 ------------------ Emmy awards. Red carpet event?

>>1243783 rt >>1243759 Assets in place.

>>1243605 rt >>1243593 EagerLion18: Live fire exercise with Jordanian Marines.

>>1243597 rt >>1243510 Connect. No coincidences.

>>1243510 ------------------ Pompeo visits Jordan.

 

Sunday 4.29.2018

>>1242689 rt >>1242682 (Q verifies anonymous post)

>>1242682 rt >>1242608 rt >>1242545 R=18 (QAnon ID:038c68)

>>1242619 rt >>1241774 , >>1241803 Do you believe in Coincidences?

>>1233880 rt >>1233553 Operators have died. They lay down their lives so that others may live, FREE!

>>1233553 rt >>1233458 Personal thank you to (you).

>>1233458 ------------------ Be careful who you are following.

 

Saturday 4.28.2018

>>1229092 rt >>1228857 Stay strong. Stay united. BOOM week ahead.

>>1228613 rt >>1228588 Noted:IP-Ghost:

>>1228588 rt >>1228489 You know that we know. You know what we have. Your move.

>>1218893 rt >>1218465 We are in this together

 

Friday 4.27.2018

>>1218390 rt >>1218316 Autists need Red Bull?

>>1218299 ------------------ Peace in the Korean Peninsula.

>>1218147 ------------------ Focus only on the FBI [for now]

>>1215845 ------------------ Question everything

>>1215294 ------------------ Questions will reveal answers

>>1214085 ------------------ Reconcile

>>1211768 rt >>1211682 Re_read drops

>>1211682 rt >>1211560 EYES OPEN? COMMS GOOD?

>>1211560 rt >>1211493 What is the purpose of a laser pointer?

>>1211343 rt >>1211294 "Done in 30"

>>1211294 ------------------ Who knows where the bodies are buried?

 

Thursday 4.26.2018

>>1203338 rt >>1203096 GOOD people are acting on the information.

>>1203057 ------------------ Patience isn't always easy

>>1198932 rt >>1198778 Important note [texts only].

>>1197788 rt >>1197573 How many pics can you find of JL & HRC?

>>1197560 ------------------ Sessions playing 4D chess

 

Wednesday 4.25.2018

>>1189217 rt >>1189008 Try harder.

>>1187806 rt >>1187631 Welcome to the WH.

>>1187631 ------------------ What happens to...

>>1187021 rt >>1187000 Note 187.

>>1187000 rt >>1186910 Non-public release of Strzock texts

>>1184271 ------------------ Are you awake?

>>1183319 ------------------ Did you know?

>>1181425 rt >>1181379 WW = worldwide. Try harder.

>>1181379 rt >>1181185 They tried to delete the proof.

>>1181185 rt >>1180770 We knew this day would come.

>>1180770 rt >>1180605 The world is Connected. All or nothing.

>>1180770 rt >>1180604 The world is Connected. All or nothing.

>>1180605 rt >>1180433 Think logically\u2026Power shift. Rise of the people.

>>1180433 rt >>1180390 "Politics." Same for Merkel. Think movie.

>>1180364 ------------------ They Feel Threatened By Us

 

Find Previous Q Posts at: qanonmap.bitbucket.io/ qanon.pub

If it ever goes down, the mirrors are: qntmpkts.keybase.pub & qanonmap.bitbucket.io

 

Backup Q Posts

>>>/comms/226

 

Board Rules >>3138

NEWBIES >>1254488

 

* Spreadsheet: docs.google.com/spreadsheets/d/1Efm2AcuMJ7whuuB6T7ouOIwrE_9S-1vDJLAXIVPZU2g/

* Searchable, interactive archive with user-explanations: qanon.pub

* Q Raw Text Dump: pastebin.com/3YwyKxJE

 

Redpill for normies >>1087693 Proof POTUS was behind Q even before he appeared on the chans.

>>1071025 How to Quickly Spot a Shill

>>1113115, >>1113120 How to filter a Shill

READ: SOCIAL MEDIA PROTOCOLS

1. DO NOT CONFRONT accounts that are being tracked. WATCH. ARCHIVE. REPORT.

2. If you find an important account, ARCHIVE OFFLINE BEFORE POSTING''' link to 8ch.

We must avoid tipping off the black hats until archiving is complete.

 

>>1126202 , >>1207179 For Instagram mirroring

>>1127332 For Website mirroring

>>1272084 For Twitter mirroring

Anonymous ID: aee2d4 May 3, 2018, 6:28 a.m. No.1285134   πŸ—„οΈ.is πŸ”—kun   >>5278 >>5776

Notables

are not endorsements

 

#1610

>>1284410 Hollywood Has Ignored Law Protecting Children From Predators

>>1284892 ADRENO + CHROME DAYDREAM Ready

>>1284645 Not a normal shipment zero identifying/normal shipping related labels/doc

>>1284656 Left/Right TV - possible left/right up/down explanation

>>1284841 "17" signatures nominating POTUS for Nobel

>>1285012 April Indictment Count Tops 28,000

>>1284982 ; >>1284860 ; >>1284887 β†’ Q photos probably related to new about Pentagon banning Chinese phones

 

#1609

>>1283850 Q images DO NOT mean Q is allied to, or visiting Apple HQ

>>1283960 Cryptic Posts dropped after Q posted

>>1284055 Our great financial team is in China tweet analysis

>>1284059 Chinese hold the the keys to apples I cloud storage clue

>>1284076 Planefag spots a similarity

>>1284075 Lots of "flood" in the news lately.

>>1284121 Logistics-fag notes Refrigerated trailer.

>>1284145 Sauce on global shill machine

>>1284175 Refrigerated trailer comparison

>>1284185 Sir Jonathan Paul Ive,Chief design officer (CDO) of Apple Inc. DIGz

>>1284227 Apple factories in China, bad working conditions, suicides

>>1284053 MapFag finds a bone?

>>1284248 More Q post pic related map digs .

>>1284296 Anon putting it together

 

#1608 TAG TEAM NOTABLES

>>1283032 Distribution fag on the shipping containers

>>1282709 Marker Timestamps

>>1282975 5 services members died recently in c-130

>>1283143 Anon confirms Q's pic locations

>>1283382 How to hide msg inside a file or img

 

#1607 TAG TEAM NOTABLES

>>1282178 Enhanced photos of shipping container

>>1282491 namefag Apple Q+ responds to anon post mimicing Q's format

>>1282232 Q posts links to Hillary Clinton and Remote Tracking company

>>1282402 Q's image naming format vs MySQL relation (requires digging)

 

#1606 TAG TEAM NOTABLES

>>1282435 US moving tons of radioactive material to Russia

>>1281453 Pentagon orders military stores to stop selling Chinese phones

 

#1605 TAG TEAM NOTABLES

>>1281348 Soros funding tied to EU Council of Foreign Relations

>>1281422 Timemarkers 11:37 and 11:45 link to Nixon and Trump China relations

 

#1604 TAG TEAM NOTABLES

>>1279851 We need to find the key.

>>1279958 this post key to everything.

>>1280033 timestamps

>>1279871 who knows where the bodies are buried?

>>1279916 anon kisses our ass before gives up

>>1279927 Aaron Traywick, CEO/Founder Ascendance Biomedical –"no foul play" in Spa Room [RIP]

>>1279928 [CLAS-N-DI_9]

>>1279992 Embedded chips in Planes/Trains/etc

>>1280030 Q

>>1280036 Q

>>1280387 JetBlue conf_

>>1280419 TimCook..Apple happenings prior to Q

>>1280431 apple Hq conf_

>>1280295 Vegas body cam release

 

#1603 TAG TEAM NOTABLES

>>1279156

>>1279204 KIM K + Kushner

>>1279354 VOTE THEM OUT

>>1279408 Puzzle pieces after Rudy

>>1279432 Fishy Feinstein

>>1279450 Iran Turkish Gold Rush

>>1279552 NK possible detainee release

>>1279582 Argentinian Prez claims BHO asked to provide Nuke Fule to Iran

>>1279612 Iran Nuclear Details..2011

>>1279624 Ask Spielberg ?Heather ORourke

>>1279650 Standard Hotel, Acid

>>1279756 Obama/Iran Negotiations 2015

>>1279774 Tehran to pay $6B to 9/11 victims

>>1279778 CT house explosionβ€”Officer down

 

#1602

>>1278327 Heather O'Rourke was murdered?

>>1278684 John Podesta on season premiere of "Ancient Aliens"

>>1278765 North Korea moves 3 detained Americans to hotel ahead of planned Trump summit, reports say

 

#1601

>>1277611 The Sum of All Fears Analysis

>>1277940 wikileaks just tweeted this and immediately removed it, >>1278484 Nope, just a correction

>>1277998 True Pundit - giuliani-calls-muellers-demands-to-sit-down-with-trump-a-bullshit-interview

>>1278033 TP gets it wrong again?

>>1278062 Trust Sessions.

 

#1600

All posts from ID 7f3c77:

>>1276770, >>1276785, >>1276788, >>1276798, >>1276809, >>1276820

>>1276850, >>1276865, >>1276892, >>1276916, >>1276934, >>1276965

>>1276993, >>1277004, >>1277027, >>1277044, >>1277140, >>1277201

>>1277290, >>1277308

>>1276904 Security guards sue Johnny Depp for unpaid wages, dangerous conditions

>>1276969 Black Male Approval For Trump Doubles In One Week

>>1277016 GEOTUS tweet: 'This isn't some game...', >>1277152 ? btw tweets...

>>1277108 TEXAS WINS VOTER I.D. FOR 2018 MID-TERMS, >>1276975 Arkansas, too

 

#1599

>>1276273 The Stage Is Set.

>>1276333 MUELLER CONNECTED TO PATENT TEAM...

 

Best Of Bread >>311157

Archive of Notables >>>/comms/225 (Batch 740~ present)

Anonymous ID: aee2d4 May 3, 2018, 6:29 a.m. No.1285137   πŸ—„οΈ.is πŸ”—kun   >>5766 >>5893

Your continued help collecting Notable posts from each bread is greatly appreciated.

Help collect the gems that fall here, they are too ephemeral and precious to disappear in the chaff

ThanQ for all your assistance in collecting Notable posts.

The fruits of our labors should not be lost in the chaff of shills, shitposters & clowns.

EVERYTHING of value should be saved offline on multiple formats.

Please keep in mind, not all of these things are verified. In case you're unaware,

you should be critical towards everything you read on the internet.

NOTABLE SUBMISSION

To highlight a notable post, please format your post using the following below.

Call for the bakers attention (Red text is acceptable), link the post number in question

and write a short description on the same line as the linked post. Here's an example:

 

β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”

HEADS UP BAKER

or

Baker Notable

 

>>####### <Brief description of notable> (Without any brackets, quotes, etc.)

β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”

 

War Room

Tweet Storm: THE WAVE: hit them with everything you got! THINK MOAB BABY!

[1] #QAnon ON EVERY twat/reply/quote/post: This is how newbies & normies can find our twats'

[2] Q's request: KEEP DEMANDING #ReleaseTheTexts until #Unredacted release

[3] Throw in ANY EXTRA hashtags you want! Trending: #FakeNews, #MOAB #InternetBillOfRights #MAGA, #Treason WHATEVER YOU WANT!

[4] Meme and Meme and Meme some MOAR! Your memes are what's waking up the normies.

Hit them hard, from all angles, with every meme you have, RT others tweets. KEEP GOING!

Be your own tweet storm army.

Useful twat hints on war room info graphs

CURRENT EXPOSURE #QAnon: 40 – 70 MILLION EXPOSURES/DAY!

Best Times to TWEET:

10-11 AM EASTERN /// AFTER 6 PM EASTERN

Wanna (re)tweet FASSSSSSST? Use TWEETDECK.com on laptop or PC

 

Threads & Research Section

>>945070 Welcome! You've been expected...

>>1254488 QBOARD QUESTIONS (testing/ questions about how to post/italic/bold/etc)

>>1121104 Q QUESTIONS THREAD (post your Questions to Q here!)

>>1119245 TTDDTOT - Things That Don't Deserve Their Own Thread

>>143179 META

>>494745 QUEST FOR SEARCHABILITY

>>16785 Prayer

>>1215912 Letters of Gratitude II

>>311157 Notable Post Discussion

>>198093 Q memed/Newsweak/GreatAwakening

>>566073 Q Cards Collection

>>870846 The Letter Q

>>694579 Hispanic Qresearch

>>674740 Qanon auf Deutsch

.

>>93735 Side-by-Side Graphics

>>1115338 Advanced Graphics, Proofs, Maps, Side-by-Sides, Good Memes

>>169315 Notable Resignations Thread 1/2

>>1147812 Notable Resignations Thread 2/2

>>4352 RESOURCES LIBRARY

>>4356 Tools and Information

>>4852 Free Research Resources

>>4362 Planefag Tools

>>4369 Research Threads

>>1245678 Germanarchiveanon

>>1233401 All Executive Orders

>>1241760 Shill posters

>>1243929 JFK Files released

.

>>32223 Qs chess game

>>256741 Alien, UFO, Advanced/Hidden Technology, Antigravity, DUMBs, etc.

>>410413 Q Communications re:deltas

>>489697 Biblefags vs Unleavened Bread

>>618758 Merkel research thread

>>622132 Antarctica

>>693544 HUMAN SEX TRAFFICKING

>>810563 NXIVM info collection

>>885933 P=C

>>904395 The Plan

>>911014 Occult music and pop culture

>>918092 Great and Little Saint James

>>945864 EMINEM THREAD

>>957083 No Name Research Thread

>>1009786 DARPA/FB/Lifelog/5g/2020

>>1013812 Crazy Days and Nights Dig?

>>1049327 666 Fifth Avenue Research Thread III

>>1143658 Abramovic.

>>1272206 43 Confirmed Connections workspace

Anonymous ID: aee2d4 May 3, 2018, 6:30 a.m. No.1285144   πŸ—„οΈ.is πŸ”—kun   >>5491

Quick Access Tools

Q Graphics all in GMT

>>1185216 Q Graphics all in GMT #01-#05 >>>/comms/486 , >>>/comms/487 , >>>/comms/488

>>1185220 Q Graphics all in GMT #06-#10 >>>/comms/488 , >>>/comms/489 , >>>/comms/490

>>1185224 Q Graphics all in GMT #11-#15 >>>/comms/491 , >>>/comms/545 , >>>/comms/950

>>1185089 Q Graphics all in GMT #16 >>>/comms/951

>>1185101 Q Graphics all in GMT #17 >>>/comms/952

>>1185120 Q Graphics all in GMT #18 >>>/comms/953

>>1248765 Q Graphics all in GMT #19 >>>/comms/975

 

Q Graphics all in EST

>>1148124 Qmap_graphic_2018-04-21_2018-04-22)Earth Day.jpg >>>/comms/968

>>1147122 Qmap_graphic_2018-04-17_2018-04-21_They think they are clever).jpg >>>/comms/967

>>1147113 Qmap_graphic_2018-04-10_2018-04-16_TheWHERE-TheWHY).jpg >>>/comms/966

>>1147103 Qmap_graphic_2018-04-07_2018-04-09_Read carefully).jpg >>>/comms/965

>>1147098 Qmap_graphic_2018-04-03_2018-04-07_Open the door.jpg >>>/comms/964

>>1147092 Qmap_graphic_2018-03-10_2018-04-03_Safe.jpg >>>/comms/963

>>1147087 Qmap_graphic_2018-03-06_2018-03-10_More coming.jpg >>>/comms/962

>>1147080 Qmap_graphic_2018-02-23_2018-03-06_Eyes in the SKY.jpg >>>/comms/961

>>1147072 Qmap_graphic_2018-02-15_2018-02-22_DISTRACTION.jpg >>>/comms/960

>>1147063 Qmap_graphic_2018-02-07_2018-02-14_PAY THE PRICE.jpg >>>/comms/959

>>1147057 Qmap_graphic_2018-01-31_2018-02-07_Think intel.jpg

>>1147051 Qmap_graphic_2018-01-26_2018-01-31_FREEDOM DAY_.jpg >>>/comms/958

>>1147032 Qmap_graphic_2018-01-13_2018-02-05]].jpg

>>1147018 Qmap_graphic_2017-10-28_2017-11-20]].jpg >>>/comms/957

>>1147010 Qmap_graphic_2017-10-29_2017-11-09]](lastconfirmed).png >>>/comms/956

 

Advanced Graphics

>>1115338 Advanced Graphics, Proofs, Maps, Side-by-Sides, Good Memes

 

Resources Library

* Spreadsheet: docs.google.com/spreadsheets/d/1Efm2AcuMJ7whuuB6T7ouOIwrE_9S-1vDJLAXIVPZU2g/

* Searchable, interactive archive with user-explanations: qanon.pub (Backup: qntmpkts.keybase.pub & qanonmap.bitbucket.io)

* QMap PDF (Version >8.14.0 [updated 4/24]) Thread: >>122807

* Q Raw Text Dump: pastebin.com/3YwyKxJE

* Expanded Q Text Drops: pastebin.com/dfWVpBbY

* Updated Q archives: qarchives.ml | masterarchivist.github.io/qarchives/

* QMap zip: enigma-q.com/qmap.zip

* Qcode guide to abbreviations: pastebin.com/UhK5tkgb

* Deleted Trump Tweets: https://factba.se/topic/deleted-tweets

* POTUS-tweet archive: trumptwitterarchive.com

* Merge QT - Awesome archive of Q Posts and POTUS Tweets in Chronological order: https://anonsw.github.io/qtmerge/

* All My Tweets: Archive/Scan any Twatter account in text form. https://www.allmytweets.net/

* Memo & OIG Report Links: 8ch.net/qresearch/res/426641.html#427188

* Pavuk Systems Q Database: https://www.pavuk.com;user:pass = qanon:qanon

* Independent Q archive resource: irc.qclearancearchive.net browsable versions of /thegreatawakening/ from before the purge >>1176816 http://irc.qclearancearchive.net/02.%20QMaps/Q%27s%20posts%20-%20CBTS%20-%208.14.0.pdf

* Full JSON Q archive: qanon.news/Archives (~135MB/~817MB Unzipped) [Updated: 4/20/2018]

* Stock Movement Scraper: http://qest.us (for seeing LARGE movements of $)

* Redpill Flag / Printable Q Cards with QR Link >>851957

* https://commandandcontrol.center/ aggregation of twitter feeds, Qanon.pub, meme making/archiving/research tools.

* archive.is / https://web.archive.org

* LEGAL NEWS: www.justice.gov/usao/pressreleases

* WebAlert app can be used to create alerts for Qanon.pub (vetted by >>968129 )

Research Section Backup >>>/comms/220

Backup Q Map/Graphic Set >>>/comms/283

 

Q Research Graphics Library

Nearly 17,000 memes and infographs.

https://mega.nz/#F!XtNhURSb!1Mdrvt-Y_onBw5VlFDRdCQ

 

Memes: Stockpiles

Memes20 >>1232995, 19 >>1144040 , 18 >>1027465

Meme Templates >>113884

Meme Generator kek.gg/draw/

 

ARCHIVE

https://docs.google.com/spreadsheets/d/1M2AzhZKh2PjL7L7GVPN42Em0hZXKWMdhGnj59ZQ3YcQ/

 

Learn to Bake! For God & Country!

New Bakers Please Go To Cooking Class >>>/comms/154

Bakers Manual: >>1010064 / or https://pastebin.com/aY5LyDPY

Anonymous ID: e707a8 May 3, 2018, 6:34 a.m. No.1285181   πŸ—„οΈ.is πŸ”—kun   >>5222 >>5232

Driving is a privilege BUT Traveling is a RIGHT (freedom)(liberty). There is NO difference other than legaleze (lawyer speak). NEVER ADMIT TO DRIVING!!!! ALWAYS ADMIT TO TRAVELING.

We have been lied to!

Drivers licenses are NOT needed

Anonymous ID: 995176 May 3, 2018, 6:39 a.m. No.1285213   πŸ—„οΈ.is πŸ”—kun

Today's Google doodle 360. "back to the moon". Consider the original, and nasa just canceled moon expedition. Water event. Satan even makes an appearance.

Anonymous ID: deb21e May 3, 2018, 6:40 a.m. No.1285223   πŸ—„οΈ.is πŸ”—kun   >>5245 >>5275

So my take on Guiliani last night is basically Trump's using the money to keep things focused on Cohen to drag him as far as possible thru the mud? Looks like it was Cohen that slept with Daniels and both Trump and Daniels have his balls in a vise, because (Just my theory) Cohen tried to extort Trump, so Trump played Cohen like a fool and trapped Daniels in their own lies to torture them both. Soon to be unraveled.

Anonymous ID: 0824eb May 3, 2018, 6:40 a.m. No.1285224   πŸ—„οΈ.is πŸ”—kun   >>5237

>>1285210

How do you know the truck wasn't unloaded and the pic was taken with what was left for the next destination? I worked at UPS as a late teen/early 20's, you'd be surprised how many 53 foot semi's run through a hub with only a third of the trailer filled. Not as uncommon as some might think.

Anonymous ID: c0d648 May 3, 2018, 6:41 a.m. No.1285227   πŸ—„οΈ.is πŸ”—kun   >>5856

You realize Trump literally tweeted the court case in a nutshell.

 

  1. He paid that slag 130k in an NDA out of his pocket(absolving him of wrongdoing).

  2. She also signed an agreement stating she did not have a realtionship with him.

  3. She and her lawyer broke the NDA countless times

  4. She and her lawyer also lied and broke the agreement stating she didn't have a relationship.

 

In other words that slag and her ambulance chaser lawyer are so stupid it's insulting to the term stupid. They are liable for massive damages……….

Anonymous ID: 64a72b May 3, 2018, 6:42 a.m. No.1285229   πŸ—„οΈ.is πŸ”—kun   >>5235 >>5246 >>5247 >>5251 >>5260 >>5305 >>5369 >>5415 >>5452 >>5731 >>5871

I was able to extract the following snip of data from this image. Interesting date, so not a recent image.

 

===

 

IHDR

aiCCPkCGColorSpaceDisplayP3

OGbC

iTXtXML:com.adobe.xmp

<x:xmpmeta xmlns:x="adobe:ns:meta/" x:xmptk="XMP Core 5.4.0">

<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">

<rdf:Description rdf:about=""

xmlns:photoshop="http://ns.adobe.com/photoshop/1.0/"

xmlns:exif="http://ns.adobe.com/exif/1.0/">

<photoshop:DateCreated>2018-05-02T19:51:34</photoshop:DateCreated>

<exif:UserComment>Screenshot</exif:UserComment>

</rdf:Description>

</rdf:RDF>

</x:xmpmeta>

IDATx

 

==

Anonymous ID: be2352 May 3, 2018, 6:42 a.m. No.1285231   πŸ—„οΈ.is πŸ”—kun   >>5248

Anons, latest shill tactic - morality shills.

 

Sliding the bread about Trump/Stormy/Melania issues. Propose to engage shields and filter them back to the depths from which they issue.

Anonymous ID: 7f2232 May 3, 2018, 6:44 a.m. No.1285241   πŸ—„οΈ.is πŸ”—kun   >>5292 >>5296 >>5856

>>1284906

Jet Blue and Apple

https://skift.com/2013/12/04/jetblue-takes-a-shortcut-to-add-apple-passbook-capabilities/

 

JetBlue is one of the first airlines to go live with Apple Passbook using the SITA API. Malaysia Airlines is also using it as are other airlines that SITA declined to identify.

 

(Interesting mention of Malaysia Airlines while declining mention of others)

 

Side note Don't remember hearing this

 

http://abc11.com/travel/jetblue-flight-from-boston-makes-emergency-landing-at-rdu-/3266371/

 

https://www.theatlantic.com/technology/archive/2014/03/todays-malaysia-airlines-370-news-what-it-means-that-the-plane-apparently-kept-flying/284414/

 

Posted for description of a/c comms.If speculation was correct that MH370 was compd  then compd again, a backup  hack to the qrs11 in a cellphone just in case...

Anonymous ID: 074f90 May 3, 2018, 6:44 a.m. No.1285245   πŸ—„οΈ.is πŸ”—kun   >>5257 >>5273 >>5350

>>1285223

>>1285200

No one here is saying TRUMP cheated on his wife. The payment Trump made to Cohen, could just have been for expenses … which is what has been said all along and of which Trump did not know the details of. Hey boss I have about 130,000 worth of expenses this month I am going to need you reimburse me for that I need to take care of this month… is all Cohen has to say.

Anonymous ID: 64a72b May 3, 2018, 6:45 a.m. No.1285251   πŸ—„οΈ.is πŸ”—kun

>>1285229

 

However, look what w3.org is 'About'

 

ABOUT W3C

The World Wide Web Consortium (W3C) is an international community where Member organizations, a full-time staff, and the public work together to develop Web standards.

 

Led by Web inventor and Director Tim Berners-Lee and CEO Jeffrey Jaffe, W3C's mission is to lead the Web to its full potential. Contact W3C for more information.

 

β€”-

 

Combine that with Apple + JetBlue = Net Neutrality and Clowns Wi-Fi via Satellites

 

https:// appleinsider.com/articles/17/01/11/jetblue-completes-fleet-wide-rollout-of-high-speed-fly-fi

Anonymous ID: d77b07 May 3, 2018, 6:45 a.m. No.1285253   πŸ—„οΈ.is πŸ”—kun   >>5267

>>1285232

yes, "driving" implies a commercial pursuit, which is why they call it "operating a motor vehicle"

Lawfag (me). This has been attempted about 1000 times and has worked 0 times. You can appeal and appeal, but even at the federal SC you LOSE. We need think anons here, not retard dufus anons. File you with flat-earthers

Anonymous ID: 56a8a7 May 3, 2018, 6:45 a.m. No.1285254   πŸ—„οΈ.is πŸ”—kun   >>5552

Just woke up so not sure if it was posted overnight, but the picture of the Apple store had to be taken from this walkway because its obviously above ground level and from that position, makes perfect sense. That walkway runs into a building on one end, and on the other end runs only to a few piers.

Anonymous ID: d921a4 May 3, 2018, 6:45 a.m. No.1285255   πŸ—„οΈ.is πŸ”—kun   >>5396 >>5770 >>5826

>>1285141 (last)

>Thanks, not ~~Think~~ (but think too)

>>1284656 >β€œambitious television news series” JV w/

<Red Arrow subsid. "Left/Right Tv" +

>NY Times Co. keynote interview :: CEO Mark Thompson (pictured)

>http://realscreen.com/2017/12/01/wcsfp-17-nyts-mark-thompson-on-politics-platforms-and-proper-journalism/

During the keynote interview, the former chief executive of Channel 4 and director-general of the BBC tackled questions on Trump (who, for the record, has a β€œperfectly normal handshake”),

the impact of the growing FAANG empire on the global mainstream media (β€œThe fate of all of us is likely to be determined by the major digital platforms,” he maintained),

attacks on the free press from both ends of the political spectrum,

 

Its digital product has seen subscriptions increase, and Thompson is looking at a move to TV for the brand.

Anonymous ID: 3c93fe May 3, 2018, 6:46 a.m. No.1285256   πŸ—„οΈ.is πŸ”—kun

Here's a CBS news report on the building of the new Apple HQ. It is strange they talk about pizza in it. Are they messaging to customers?

 

https://www.cbsnews.com/video/apples-massive-glitzy-new-headquarters/

Anonymous ID: 9668b6 May 3, 2018, 6:47 a.m. No.1285259   πŸ—„οΈ.is πŸ”—kun

>>1285212

screaming + no markers = man down.

 

b/c MOS (= mobile operating system) SEC (security) is bunk.

 

f.h.p.p needs to learn how to OC it's own MOS_SEC.

 

tim, are you woke?

you get phones from foxconn.

you have more than you know.

do you need help making new chips?

we'll fix taxes a little to bring manufacturing in house.

Anonymous ID: 33e74d May 3, 2018, 6:48 a.m. No.1285267   πŸ—„οΈ.is πŸ”—kun

>>1285253

I never said it would work. It is exactly the same thing as trying to convict the queen of a crime in her court. it won't ever work. The court does not follow the written law. I agree it won't work. It's like trying to start a gasoline engine when the there isn't any piston in it. You have to shit can the entire thing and replace it with something that is not corrupt. The court is a huge part of the problem.

UCC

Commerce Clause corruption and meaning stretching.

It's all rotten.

Anonymous ID: 4afc22 May 3, 2018, 6:48 a.m. No.1285270   πŸ—„οΈ.is πŸ”—kun   >>5317

Just an FYI if someone wants to dig further

 

ZTE can no longer use Qualcomm chips

Leads me to believe they were the ones who reverse engineered a backdoor into the phone chipsets for the Chinese Government. This would also explain the merger being halted between Qualcomm and Broadcom.

Anonymous ID: deb21e May 3, 2018, 6:49 a.m. No.1285273   πŸ—„οΈ.is πŸ”—kun

>>1285245

>No one here is saying TRUMP cheated on his wife

Right. I'm not either.

>could just have been for expenses

Possibly, but why drag out something for simple expenditures?

Trump has a plan in place for Cohen and Daniels. Trump Curse, after all.

Anonymous ID: e707a8 May 3, 2018, 6:49 a.m. No.1285276   πŸ—„οΈ.is πŸ”—kun   >>5306 >>5321

CASE #1: β€œThe use of the highway for the purpose of travel and transportation is not a mere privilege, but a common fundamental right of which the public and individuals cannot rightfully be deprived.” Chicago Motor Coach v. Chicago, 169 NE 221.

Anonymous ID: 074f90 May 3, 2018, 6:49 a.m. No.1285280   πŸ—„οΈ.is πŸ”—kun   >>5308

What is Rosenstein and Mueller doing. Trying to bankrupt anyone who knows President Trump or worked for him. How many of these guys has Mueller and Rosenstein been doing this too over the past year and half?

 

http:// dailycaller.com/2018/05/02/michael-caputo-senate-intelligence/

 

β€˜God Damn You To Hell’: Ex-Trump Aide Blows Up During Senate Interview

β€œToday, I can’t possibly pay the attendant legal costs and live near my aging father, raising my kids where I grew up,” Caputo said during his three-hour interview. β€œYour investigation and others into the allegations of Trump campaign collusion with Russia are costing my family a great deal of money β€” more than $125,000 β€” and making a visceral impact on my children.”

 

β€œForget about all the death threats against my family. I want to know who cost us so much money, who crushed our kids, who forced us out of our home, all because you lost an election,” he added. β€œI want to know because God damn you to hell.”

Anonymous ID: e707a8 May 3, 2018, 6:49 a.m. No.1285282   πŸ—„οΈ.is πŸ”—kun   >>5289 >>5306

CASE #2: β€œThe right of the citizen to travel upon the public highways and to transport his property thereon, either by carriage or by automobile, is not a mere privilege which a city may prohibit or permit at will, but a common law right which he has under the right to life, liberty, and the pursuit of happiness.” Thompson v. Smith, 154 SE 579.

Anonymous ID: e707a8 May 3, 2018, 6:50 a.m. No.1285283   πŸ—„οΈ.is πŸ”—kun   >>5306

CASE #3: β€œThe right to travel is a part of the liberty of which the citizen cannot be deprived without due process of law under the Fifth Amendment.” Kent v. Dulles, 357 US 116, 125.

Anonymous ID: e707a8 May 3, 2018, 6:50 a.m. No.1285284   πŸ—„οΈ.is πŸ”—kun   >>5306

CASE #4: β€œThe right to travel is a well-established common right that does not owe its existence to the federal government. It is recognized by the courts as a natural right.” Schactman v. Dulles 96 App DC 287, 225 F2d 938, at 941.

Anonymous ID: 6d92f7 May 3, 2018, 6:50 a.m. No.1285287   πŸ—„οΈ.is πŸ”—kun

Apple would ship to distribution center with a full tractor trailer and than ups would ship on ups truck.

This is a tractor trailer.

It would not only have three pallets.

Unless the picture was taken during unload stage. And if that's the case where's the spotter/pallet jack guy. He's always waiting for extended boom or fork lift to come back.

Anonymous ID: ee7c64 May 3, 2018, 6:51 a.m. No.1285292   πŸ—„οΈ.is πŸ”—kun

>>1285241

Is this "the beginning of the (((chip))). The phone that knows the user and is 100% accurate as far as identification purposes? Would eliminate the need for passports, then drivers license, everything.

The Mark of the Beast technology…..

Anonymous ID: 2bb43d May 3, 2018, 6:51 a.m. No.1285293   πŸ—„οΈ.is πŸ”—kun   >>5444

Former highest German State Attorney (Generalbundesanwalt) Harald Range - who did not investigate the German Pedogate known as "Sachsensumpf", downsized the "investigation" into NSA spying in Germany and mislead the complete hoax of the official story regarding the "NSU" terrorist cell (who is basically a story told by the secret agencies to subsummize several murder and crime done by state or allied forces under the cover of shot do death neonazis) breaks down dead in a cafe.

 

https:// www.tagesschau.de/inland/range-nachruf-101.html

Anonymous ID: 6f46e1 May 3, 2018, 6:51 a.m. No.1285295   πŸ—„οΈ.is πŸ”—kun

>>1280616

>>1280036

Trump’s China β€˜hawks’ Robert LIGHThizer, Peter Navarro, and Wilbur Ross on that flight?

 

Fags state Q was not on the plane but could someone on this trade team be on the Q team?

 

https:// www.macrumors.com/2012/07/04/apples-retail-push-into-china-still-limited-but-ramping-up/

http:// www.businessinsider.com/trump-trade-team-china-hawks-2017-1

Anonymous ID: ff3c93 May 3, 2018, 6:53 a.m. No.1285307   πŸ—„οΈ.is πŸ”—kun   >>5438

Not sure if you Anons have seen this….I'm still eating breads to catch up.

 

This is floating around on Twitter…looks like a messsage between Stormy D & someone where she is denying she slept with Trump.

 

Like I said, it is floating on Twitter so it might be fake or it might not be.

Anonymous ID: f039c1 May 3, 2018, 6:53 a.m. No.1285312   πŸ—„οΈ.is πŸ”—kun   >>5323 >>5335 >>5353 >>5460 >>5693

"Watch The Water" https ://www.militarytimes.com/news/your-military/2018/04/26/dod-126-bases-report-water-contaminants-harmful-to-infant-development-tied-to-cancers/

https ://www.military.com/daily-news/2017/04/25/nearly-400-military-bases-must-be-tested-water-contamination.html

Anonymous ID: c0f04a May 3, 2018, 6:54 a.m. No.1285315   πŸ—„οΈ.is πŸ”—kun

>>1284666

>>1284708

 

New Zealanders are good, hard-working people with a generous heart, and willing to hep those in need.

 

But, here she comes again, and she wants more of your money.

 

Read The Clinton Foundation and Haiti.

 

HRC will put on a lot of makeup and a big smile to hide what is really in her heart, which many claims she does not have, and it's not for good for mankind.

Anonymous ID: 4afc22 May 3, 2018, 6:54 a.m. No.1285317   πŸ—„οΈ.is πŸ”—kun

>>1285270

The flaws affect Qualcomm chip software drivers installed at the point of manufacture, meaning updates must be pushed from the hardware company to phone vendors before it can flow to users.

Anonymous ID: 19f1ff May 3, 2018, 6:55 a.m. No.1285318   πŸ—„οΈ.is πŸ”—kun   >>5346

>>1284590 LB

HAHA always a shill if we just admit that it is really confusing ..I mean holy shit how is it NOT confusing? By definition they are cryptic messages that are only a small % of hints and some are literally disinfo that we don't know which ones are….come on fag play chess that makes it clear instantly

Anonymous ID: 45364b May 3, 2018, 6:56 a.m. No.1285332   πŸ—„οΈ.is πŸ”—kun

>>1285266

It doesn't look like cash to me. Those are individual cases stacked and wrapped in plastic sheets…taped.

 

I think this may have to do with computer chips, maybe for planes but because it's going to china where the slave like phone factories are. Maybe they implemented a change.

Anonymous ID: 1091ad May 3, 2018, 6:57 a.m. No.1285333   πŸ—„οΈ.is πŸ”—kun

>>1285326

Meaning

 

According to Merriam-Webster's Dictionary, "86" is a slang term that is used in the American popular culture as a transitive verb to mean throw out or get rid of, particularly in the food service industry as a term to describe an item no longer available on the menu, or to refuse service to a customer.[1] The Merriam Webster dictionary suggests the term may be associated with the word "nix" ("no" or a more general prohibition).[1]

Anonymous ID: f72da3 May 3, 2018, 6:58 a.m. No.1285344   πŸ—„οΈ.is πŸ”—kun

>>1284612 (pb)

Not sure if related but here's some interesting information if anyone wants to dig about Sandia in Bay Area and New Mexico RE Nuclear, underground circular structure:

 

A Brief History of Sandia National Laboratories and the

Department of Energy’s Office of Science:

Interplay between Science, Technology,and Mission

 

http://prod.sandia.gov/techlib/access-control.cgi/2011/115462.pdf

 

β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”

 

ALSO, found this:

 

Organizations Β»

Q-DO

Weapon Stockpile Modernization

Ensuring tomorrow’s U.S. nuclear deterrent through stockpile life extensions, while maintaining and advancing knowledge and capabilities

 

The Weapon Stockpile Modernization (Q) Division provides the system engineering, program management, component technology development, and system and sub-system testing necessary to field modernizations authorized to extend the life of Los Alamos National Laboratory-designed weapons in the active United States nuclear stockpile

 

http://www.lanl.gov/org/padwp/adw/weapon-stockpile-modernization/index.php

Anonymous ID: 33e74d May 3, 2018, 6:58 a.m. No.1285346   πŸ—„οΈ.is πŸ”—kun   >>5378

>>1285318

Play chess, play football, box, play baseball, doesn't matter.

The question is, do you intend to win or lose the match?

You're chess strategy looks like you're throwing the game. On purpose? Do you know? Do they know? Does anyone care? Does anyone wear underwear?

Heh, fuck it. At some point the law of diminishing returns kicks in. Cloak and dagger shit can only be taken so far before it all becomes the joke that it is.

Anonymous ID: be2352 May 3, 2018, 6:59 a.m. No.1285350   πŸ—„οΈ.is πŸ”—kun   >>5361

>>1285245

I was responding to a morality fag. I don't know if Trump cheated or not. Wouldn't be surprised, because of past history. But frankly, don't care. Not my business, it's between Melania and him (and God, if you want to go there).

 

What I do care about is whether Trump knowingly broke any laws in what his lawyer did on his behalf, and my opinion is he didn't.

 

The takeaway from Rudy should be that. He didn't break any laws, and he didn't use campaign or government money to pay off anyone. UNLIKE almost all the diddling senators and representatives, I might add, who diverted campaign funds or used the government coffers for the payoffs.

Anonymous ID: e8955a May 3, 2018, 6:59 a.m. No.1285353   πŸ—„οΈ.is πŸ”—kun

>>1285312

military base drinking water has been shit for decades, Lejeune has had ongoing problems forever. Why not poison the military that are being used as puppets asked the CFR as directed by Bilderberg!

 

Is qanon.pub anon lurking?

-Printed Crumbs

-Cut them out->sorted by timestamps[HH:MM:SS]->taped together

I am looking at big picture strings and if your sites can sort the same way and printable, future Patriots can print these big strings together and make their own offline map to share. Save time and tape. The hours put them qposts into catagories, you can pick out a theme among the cats once you sort all q posts this way ignoring the dates during sort

Anonymous ID: e707a8 May 3, 2018, 7 a.m. No.1285356   πŸ—„οΈ.is πŸ”—kun   >>5482

LICENSING LIBERTY

β€œNo state shall convert a liberty into a license and charge a fee therefore.”(Murdock v. Pennsylvania, 319 U.S. 105)

β€œIf the state converts a right (liberty) into a privilege, the citizen can ignore the license and fee and engage in the right (liberty) with impunity.”(Shuttlesworth v. City of Birmingham, Alabama, 373 U.S. 262)

Anonymous ID: 70122c May 3, 2018, 7:01 a.m. No.1285363   πŸ—„οΈ.is πŸ”—kun   >>5381 >>5513 >>5856

With the photos Q was drawing a link between Apple corporate, retail in China and pallets that were photographed

 

Cook has been brought to heel.

 

Discovery could be

A) fake US currency -another way to devalue the US dollar as POTUS repeatedly accused China of doing ( after inauguration they would have been able to check the amount of cash in circulation vs how much legally printed and available). Offshoring money (panama papers and tax avoidance) is one way but flooding the market with illegally printed money (see RM 39 in NK) is another.

B) Fentanyl (or other drugs)

C) Uncomped phones for Black Hats to use for comms

D) Unmentionables re: human cargo

 

Whatever it is, they have disrupted another RAT LINE and leveraged Apple/Cook

Anonymous ID: 4afc22 May 3, 2018, 7:01 a.m. No.1285364   πŸ—„οΈ.is πŸ”—kun   >>5392 >>5431

What the fuck was Comey up to? Was he working for the MB or China? Selling hacks into our technology through the FBI?

 

https://en.wikipedia.org/wiki/FBI%E2%80%93Apple_encryption_dispute

 

https://oig.justice.gov/reports/2018/o20180413.pdf

Anonymous ID: 7e7011 May 3, 2018, 7:02 a.m. No.1285369   πŸ—„οΈ.is πŸ”—kun

>>1285229

 

That's when the specifications for the file format was created, not when the file itself was created. It's like if every jpg had the date 9/18/1998 inside because the JPEG format was standardized on that date.

Anonymous ID: 6d92f7 May 3, 2018, 7:03 a.m. No.1285375   πŸ—„οΈ.is πŸ”—kun   >>5391

>>1285362

Yeah except that never happens. They help bring the items from the front of their trucks to where you can pick them up with a piece of equipment.

Let me guess you didn't unload as many trucks as I have in the past month.

Anonymous ID: 034d67 May 3, 2018, 7:04 a.m. No.1285377   πŸ—„οΈ.is πŸ”—kun   >>5409

>>1285359

>twitter.com/WhiteHouse/status/992040078770950145

 

However, President Barack Obama has chosen not to personally participate nor host events for the National Day of Prayer at the White House, which seems to be the origin of this widely circulated email. Although he has not participated as his predecessors did, he has written a proclamation for the day of prayer every year of his presidency, which are available on our website, www.nationaldayofprayer.org . In fact, every President since 1952 has written proclamations calling for a National Day of Prayer.

Anonymous ID: 0b79ab May 3, 2018, 7:05 a.m. No.1285386   πŸ—„οΈ.is πŸ”—kun   >>5857

>>1285297

Higgins had stood by Trump during the Khizr Khan attacks. And he had written a memo warning that β€œthe left is aligned with Islamist organizations at local, national, and international levels” and that β€œthey operate in social media, television, the 24-hour news cycle in all media and are entrenched at the upper levels of the bureaucracies.”

 

Like Harvey and Ezra Watnick-Cohen, Higgins had warned of an enemy within. And paid the price.

 

McMaster’s cronies had allegedly used the NSC’s email system to track down the source of the memo. The left and its useful idiots were indeed entrenched at the upper level of the bureaucracy.

 

Higgins was fired.

 

Like Harvey and Watnick-Cohen, Higgins had also become too dangerous to the Obama holdovers. Harvey had assembled a list of names and a plan to dismantle the Iranian nuclear deal. Watnick-Cohen had dug into the Obama surveillance of Trump officials. And Higgins had sought to declassify Presidential Study Directive 11. PSD-11 was the secret blueprint of Obama’s support for the Muslim Brotherhood.

Pete Hoekstra, the former Chairman of the House Intelligence Committee, linked PSD-11 to the rise of ISIS and called for its declassification.

https://counterjihadreport.com/tag/psd-11/

 

Obama rolls dice on foreign policy in secretive presidential directive

by Pete Hoekstra

| October 03, 2016 12:04 AM

https://www.washingtonexaminer.com/obama-rolls-dice-on-foreign-policy-in-secretive-presidential-directive/article/2603354

 

The Investigative Project on Terrorism

___________

STATEMENT OF

PETER HOEKSTRA

SHILLMAN SENIOR FELLOW

INVESTIGATIVE PROJECT ON TERRORISM

An official in the Obama White House indicated at the time, β€œIt’s a roll of the dice…”

https://t.co/Etf8NFmzYB

Anonymous ID: b0a429 May 3, 2018, 7:06 a.m. No.1285391   πŸ—„οΈ.is πŸ”—kun   >>5427

>>1285375

 

Do probably 30 a day. Truckers dont go on the dock. They're a liability waiting to happen with forktruck traffic. They are confined to a lounge area with bathrooms and a TV while we load/unload with a window for paperwork. After loading, they pull forward to inspect the load before seal is applied and shipment is released.

Anonymous ID: d921a4 May 3, 2018, 7:06 a.m. No.1285396   πŸ—„οΈ.is πŸ”—kun

>>1285255 NY Times CEO Mark Thompson, former Channel 4 & BBC

  • (prev.)

>>1284186 Sir Jony Ive,( CDO) Apple Inc. DIGz

< + Sir BONO at (RED) Benefit

  • >>1284774 >Aldous Huxley,

>Brit Royal Society intellectual in Holy Wood (L.A.) in early 60's

  • >>1284286 >Sultan India & wife of Brit adviser to Sultan arrive in L.A. 1934 during excavation into "Lizard People Catacomb City" downtown L.A.

( >>1283854 >>1284363 )

< = (pic related) ???

cc >>1284483

Anonymous ID: e0da34 May 3, 2018, 7:07 a.m. No.1285401   πŸ—„οΈ.is πŸ”—kun   >>5638 >>5846

>>1285122

 

Whoever's managing the qanonposts.com site

 

There's a phishing virus popping up there (again) on my Android device (Kindle). Says it's from "2p2017shopgratis.site". A window appears with the usual BS about my device being infected, "continue with instructions to fix," yadda, yadda.

 

Whoever's managing the site, please sanitize. Thanks!

Anonymous ID: 7efbd9 May 3, 2018, 7:07 a.m. No.1285408   πŸ—„οΈ.is πŸ”—kun

I found out yesterday that Charleston Heston also had Q clearance waaaay back in the day, he used to do narration for atomic bomb videos for the army before he went into movies

 

pretty cool

Anonymous ID: e97ff9 May 3, 2018, 7:08 a.m. No.1285412   πŸ—„οΈ.is πŸ”—kun   >>5422 >>5464 >>5726

>>1284892

>just throwing this out there.

New phones -something in the screen making young people make more adreno chrome? levels check able in iris scan? (23&me commercial launched?) if "great sample"show up - > location is known - > grab and serve 4 dinner?

Anonymous ID: 19f1ff May 3, 2018, 7:10 a.m. No.1285424   πŸ—„οΈ.is πŸ”—kun   >>5588

Hey could a caring anon post for me what they think are the best settings to read the boards as fast as possible…I'm not a newfag to Q boards but haven't been on the boards before that so I am always trying to mess with it and I think aI fked it up

Anonymous ID: e75123 May 3, 2018, 7:10 a.m. No.1285426   πŸ—„οΈ.is πŸ”—kun

"Adidas doesn't need Kanye anymore"

German company founded by Adolf Dassler

 

https://www.bloomberg.com/view/articles/2018-05-03/kanye-west-is-on-the-way-out-with-fashionistas

Anonymous ID: af1df9 May 3, 2018, 7:11 a.m. No.1285430   πŸ—„οΈ.is πŸ”—kun   >>5454 >>5497 >>5506 >>5539 >>5563 >>5633 >>5665 >>5856

en.wikipedia.org/wiki/Bill_McDermott

something's fishy about the guy..some would even say cunty..

when i saw it live that day i thought the same..but now in light of planes crashing regularly it gets even worse with smelling that cunty breath of cuntiness..

www.sap.com/industries/defense-security.html

en.wikipedia.org/wiki/SAP_SE

 

"Bill McDermott, CEO of SAP, compared the release of SAP S/4HANA to a "moonshot", describing it as the most important launch in the company's history."

 

So..if the guy is not a friendly friend, he probably is into soemthing very BAD. his thing could very well be blackmailing POTUS.

 

BAKER this could be NOTABLE

Anonymous ID: 4afc22 May 3, 2018, 7:11 a.m. No.1285431   πŸ—„οΈ.is πŸ”—kun   >>5479

>>1285411

>>1285392

>>1285364

 

Extracting Qualcomm's KeyMaster Keys - Breaking Android Full Disk Encryption

After covering a TrustZone kernel vulnerability and exploit in the previous blog post, I thought this time it might be interesting to explore some of the implications of code-execution within the TrustZone kernel. In this blog post, I'll demonstrate how TrustZone kernel code-execution can be used to effectively break Android's Full Disk Encryption (FDE) scheme. We'll also see some of the inherent issues stemming from the design of Android's FDE scheme, even without any TrustZone vulnerability.

 

I've been in contact with Qualcomm regarding the issue prior to the release of this post, and have let them review the blog post. As always, they've been very helpful and fast to respond. Unfortunately, it seems as though fixing the issue is not simple, and might require hardware changes.

 

If you aren't interested in the technical details and just want to read the conclusions - feel free to jump right to the "Conclusions" section. In the same vein, if you're only interested in the code, jump directly to the "Code" section.

 

SETTING THE STAGE

 

https://bits-please.blogspot.in/2016/06/extracting-qualcomms-keymaster-keys.html

Anonymous ID: 7c504d May 3, 2018, 7:11 a.m. No.1285434   πŸ—„οΈ.is πŸ”—kun

lol…these posts are all ridiculous….im out….recent q pics ridiculous too….the moab to irans nuke plant last week….was damn amazing though…

Anonymous ID: 731c0b May 3, 2018, 7:12 a.m. No.1285446   πŸ—„οΈ.is πŸ”—kun

https://www.zerohedge.com/news/2018-01-25/comey-rosenstein-mccabe-all-named-fisa-memo-according-first-leak

 

Comey, Rosenstein, McCabe All Named In FISA Memo, First Leak Reveals

 

A bombshell four-page "FISA memo" alleging egregious surveillance abuse by the FBI, DOJ and Obama administration, specifically names FBI Deputy Director Andrew McCabe, former FBI Director James Comey and Deputy Attorney General Rod Rosenstein, according to the Daily Beast.

 

The GOP-authored memo made waves last week after it was made available to the full House of Representatives for viewing. With over 60 GOP lawmakers calling for its release, Capitol Hill sources on both sides of the aisle tell The Daily Beast that it's only a matter of time before the general public is allowed to view the document - which is likely to stoke already-inflamed tensions between GOP lawmakers and the individuals named in the leak.

 

The facts contained in the Republican majority-authored report are said to be "jaw-dropping and demand full transparency," according to Rep. Matt Gaetz (R-FL), while the top ranking Democrat on the House Intel Committee, Adam Schiff (D-CA) dismissed the memo as "profoundly misleading" talking points drafted by Republican staffers.

 

Several other GOP Congressmembers have weighed in. "I have read the memo," tweeted Rep. Steve King (R-IA), adding "The sickening reality has set in. I no longer hold out hope there is an innocent explanation for the information the public has seen. I have long said it is worse than Watergate. It was #neverTrump & #alwaysHillary. #releasethememo."

 

Along with the four-page memo, Congressional investigators learned from a new batch of text messages between anti-Trump FBI investigators that several individuals within the Department of Justice and the FBI may have come together in the "immediate aftermath" of the 2016 election to undermine President Trump, according to Rep. John Ratcliffe (R-TX) who has reviewed the texts.

 

This is particularly interesting since the memo allegedly names Deputy Attorney General Rod Rosenstein - who created Robert Mueller's special counsel after former FBI Director James Comey was fired.

Anonymous ID: e02a8a May 3, 2018, 7:13 a.m. No.1285452   πŸ—„οΈ.is πŸ”—kun

>>1285229

 

Has anybody identified which flight that is?

 

Because the flight data websites will let you go back in time and see what other plane was in the air nearby where Q could have photographed the JetBlue plane. If we identify the Jetblue flight, then from that, we can identify the flight carrying Q and the destination of Q's flight.

Anonymous ID: 6054bc May 3, 2018, 7:14 a.m. No.1285462   πŸ—„οΈ.is πŸ”—kun

>>1285395

Kinda ironic that he was the catalyst for creating the Special counsel. If Trump hired Rosenstein, and Rosenstein hired Mueller, and Comey was the "reason" Rosenstein hired Mueller, then Comey has to be white hat. White hats needed the Special Counsel, clearly wanted Mueller to head it…

Anonymous ID: b215f3 May 3, 2018, 7:14 a.m. No.1285466   πŸ—„οΈ.is πŸ”—kun   >>5867

Q's pics mean to me that Apple is using Hong Kong and their port front flagship store as a transshipment point for items that should not be shipped from China to the USA or elsewhere, and whitehats know all about it. either human trafficking or comped chips

Anonymous ID: 4afc22 May 3, 2018, 7:15 a.m. No.1285479   πŸ—„οΈ.is πŸ”—kun   >>5493

>>1285431

In Apple's case you can't extract the hardware key no matter what software attack you carry out (w/ the OEMs or without). At most, you can bypass the software protections, but you'll still have to perform the bruteforce attempt strictly on the device.

Anonymous ID: e97e19 May 3, 2018, 7:16 a.m. No.1285484   πŸ—„οΈ.is πŸ”—kun   >>5607

3 "Prisoners" from NK that Previous Admin "wanted"

3 Pallets

Apple in China

Apple Headquarters

Jet Blue

 

NK producing corrupt Apple Products, Shipped through China to be used in US

Anonymous ID: af1df9 May 3, 2018, 7:17 a.m. No.1285488   πŸ—„οΈ.is πŸ”—kun

last night guy on Tucker before time went out told us that they are also focussing on Guccifer, Wikileaks and DCleaks..

could be important to know.

at least he seemed to think it's good having it out there..when you see the complete interview you can see how they constructed the whole thing..in the beginning Caputo starts the sentence, gets interrupted by another of Tckers questions..they semm to dance around the thing a bit and in the end Caputo gets to drop his thing..

Anonymous ID: 9668b6 May 3, 2018, 7:17 a.m. No.1285490   πŸ—„οΈ.is πŸ”—kun   >>5531

>>1285436

 

compromised mobile operating security

leads to

clandestine trusted app backdoor

leads to

tracking abilities

leads to

pin-point accuracy and perfect aim.

 

our pilots are not safe because we didn't know they were being tagged at the factory.

Anonymous ID: 9128b5 May 3, 2018, 7:17 a.m. No.1285491   πŸ—„οΈ.is πŸ”—kun   >>5505 >>5514 >>5517

>>1285144

 

 

 

 

 

β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”

 

BAKER CORRECTION NEEDED

 

The dough for Memes18 is incorrect. The link should be β†’

>>1027465

 

I tested https://8ch.net/qresearch/res/1027465.html#1027642

and it works.

I don't understand why the link in the dough doesn't highlight since the numerals are correct.

Can you have a look and see if there's a space or a foreign character in there?

 

ThankQ!

 

β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”β€”-

Anonymous ID: 6ed370 May 3, 2018, 7:18 a.m. No.1285496   πŸ—„οΈ.is πŸ”—kun   >>5856

https://www.msn.com/en-us/news/world/giuliani-says-3-americans-held-by-north-korea-to-be-released-thursday/ar-AAwFn0D?ocid=spartandhp

<Giuliani says 3 Americans held by North Korea to be released Thursday

Anonymous ID: 4afc22 May 3, 2018, 7:19 a.m. No.1285500   πŸ—„οΈ.is πŸ”—kun

>>1285493

CONCLUSIONS

 

The key derivation is not hardware bound. Instead of using a real hardware key which cannot be extracted by software (for example, the SHK), the KeyMaster application uses a key derived from the SHK and directly available to TrustZone.

OEMs can comply with law enforcement to break Full Disk Encryption. Since the key is available to TrustZone, OEMs could simply create and sign a TrustZone image which extracts the KeyMaster keys and flash it to the target device. This would allow law enforcement to easily brute-force the FDE password off the device using the leaked keys.

Patching TrustZone vulnerabilities does not necessarily protect you from this issue. Even on patched devices, if an attacker can obtain the encrypted disk image (e.g. by using forensic tools), they can then "downgrade" the device to a vulnerable version, extract the key by exploiting TrustZone, and use them to brute-force the encryption. Since the key is derived directly from the SHK, and the SHK cannot be modified, this renders all down-gradable devices directly vulnerable.

Android FDE is only as strong as the TrustZone kernel or KeyMaster. Finding a TrustZone kernel vulnerability or a vulnerability in the KeyMaster trustlet, directly leads to the disclosure of the KeyMaster keys, thus enabling off-device attacks on Android FDE.

Anonymous ID: 2b2eb8 May 3, 2018, 7:20 a.m. No.1285506   πŸ—„οΈ.is πŸ”—kun

>>1285430

SAP software is used extensively in key data operations of at least one of the biggest banks on the planet.

 

Not only does it suck, it's German, and + to the cuntiness of the CEO makes it a trifecta.

Anonymous ID: df0479 May 3, 2018, 7:20 a.m. No.1285507   πŸ—„οΈ.is πŸ”—kun

>>1285468

I kind of agree. The only thing that we can really get from these pics is that something from or to Apple is being shipped. We would assume something nefarious. We cannot know what until it is revealed. So, unless we can SEE what is in the boxes, we know nothing.

Anonymous ID: ca3cca May 3, 2018, 7:21 a.m. No.1285509   πŸ—„οΈ.is πŸ”—kun

Per POTUS tweet, we can infer that Cohen had the roll of film from the SOTU which captured the threat to POTUS, and now Mueller has it logged as evidence.

Anonymous ID: 9128b5 May 3, 2018, 7:21 a.m. No.1285514   πŸ—„οΈ.is πŸ”—kun   >>5569

>>1285491

>>1285505

Something weird going on. The bread still exists in the catalog because I can navigate to it from a browser bookmark that I saved when I created that bread.

 

https://8ch.net/qresearch/res/1027465.html#1027642

 

I don't know what to say. Weird.

Anonymous ID: a6110e May 3, 2018, 7:22 a.m. No.1285521   πŸ—„οΈ.is πŸ”—kun   >>5584

>>1285210

I don't think it's money, I have seen pallets of copy paper that size and they didn't have special pallets, gold would be smaller size because of the weight, I am guessing it's silicon chips, but each of those boxes would be heavy as shit still a mystery.

Anonymous ID: c547e2 May 3, 2018, 7:23 a.m. No.1285528   πŸ—„οΈ.is πŸ”—kun   >>5615 >>5641 >>5856

Another datapoint from the Wall Street Journal - (Sry - I use El-Autismo Dark themes)

 

Relative to the Aircraft Incidents and EW (Electronic Warfare)

 

Source:

https://www.wsj.com/articles/laser-from-chinese-base-aimed-at-u-s-military-pilots-in-africas-skies-pentagon-charges-1525351775

 

From the article "

 

The new signs of military tension also come as U.S.-China economic relations have sunk to their lowest point in decades. President Donald Trump says he considers Chinese counterpart Xi Jinping a friend, but has imposed tariffs on some Chinese goods and is threatening tariffs on $150 billion more, while his administration has imposed new restrictions on U.S. technology exports to China.

 

There have been a number of laser-related incidents in the past several weeks, Pentagon officials said. In one of the most recent, two American service members piloting a C-130 turboprop experienced minor eye injuries after being exposed to the laser beam, according to a Pentagon official.

"

Anonymous ID: 1091ad May 3, 2018, 7:23 a.m. No.1285530   πŸ—„οΈ.is πŸ”—kun

The tweets were about Stormy.

The delta between the (3) tweets is 8 & 6 = 86. 86 means to get rid or.

 

The misspelling of roll combined with 86 is telling me that the Stormy thing is about to be 86ed, nothing to do with China. WTF?

Anonymous ID: af1df9 May 3, 2018, 7:24 a.m. No.1285535   πŸ—„οΈ.is πŸ”—kun

>>1285497

have never met one..thank god..

guy could also be some vampire like sun hating shitneck..he was the only one wearing sunglkasses and hat this fucked up smug look..spoke last..sat to the right of POTUS for all the time..most of the guys at roundtable seemed to have shit their pants in comparison to this guy..when he began talking it felt very uncomfortable..his smile..his whole appearance was annoying to say the least.

Anonymous ID: b97d2d May 3, 2018, 7:24 a.m. No.1285538   πŸ—„οΈ.is πŸ”—kun   >>5547 >>5574

>>1285439

The only real physics you'll ever need.

Einstein?-FRAUD

CERN? Money Pit to drain tax revenue into a cult of bumping particles trail that leads nowhere, but keeps a bunch of retards looking busy & employed for life on your dime

Read this, reread this reread this again till you GET IT

& you will reach the same conclusion

ALL ACADEMIA IS A CIRCLE JERK

MODERN PARTICLE PHYSICS IS A CULT

https://archive.org/details/magnetism1small

Anonymous ID: 45364b May 3, 2018, 7:24 a.m. No.1285543   πŸ—„οΈ.is πŸ”—kun   >>5856

OK this weird anon post that was in notables said

"INTEL? C_hips? SUNG of SAM"

 

And then I found this article about Samsung to manufacture iPhone chips again.

 

https://www.washingtonpost.com/news/innovations/wp/2017/07/18/samsung-to-manufacture-iphone-chips-for-apple-again-report-says/?utm_term=.42896df6ddf8

 

Maybe this post is more than it seems?

Anonymous ID: c33a3e May 3, 2018, 7:25 a.m. No.1285544   πŸ—„οΈ.is πŸ”—kun

>>1284928 (prev.)

>it was always supposed to be that way

true, true

>anons were always supposed to contribute notables to the BAKER

>some anons got lazy

>some anons forgot

>some anons never knew

>I think it's a great idea

>just wasn't sure of what the TAG TEAM NOTABLES' label was supposed to mean

>after all it was the night shift crew, and we all know they are a little different

yeah, i guess we can loose the TAG eventually/soon, but felt like leaving it for a while would help spread knowledge of the method...

personally i loved every moment baking, but keeping an eye on the thread count while watching for heads up (and selecting and writing the titles because anons don't do it) gets intense - and if Q drops on top of that, even moar of a rush...

CoBaking settles that, then you can concentrate on the posts and Q, while anons concentrate on the thread/notables

Anonymous ID: c1f1d7 May 3, 2018, 7:25 a.m. No.1285550   πŸ—„οΈ.is πŸ”—kun   >>5559 >>5635

>>1285266

are these 'special' apple phones for the cabal to communicate with? blackberry types?

 

Re-read 'apple' crumbs:

 

Wed 15 Nov 2017 00:38:48 No.149490950

Conf_D-TT^_v891_0600_yes

_green1_0600

Bunker Apple Yellow Sky [… + 1]

Yes

Godspeed.

Q

 

Tue 21 Nov 2017 18:43:15 No.150388962

Expand your thinking.

Captain Mike Green.

Conf_D-TT^_v891_0600_yes

_green1_0600

Bunker Apple Yellow Sky [… + 1]

Yes.

Who countered?

Do you believe in coincidences?

Learn how to read the map.

Q

 

Fri 22 Dec 2017 01:13:36 5902e7 No.146268

>>146142

Why is EM provided BIG WW subsidies?

No subsidies = ?

Clown contribution in exchange for access code?

Why relevant?

Amazon Echo?

Google Home?

Clown contributions?

Apple Face ID Tech?

FB Face ID Tech?

Catching on?

Bombs Away.

Q

 

Fri 22 Dec 2017 01:36:43 5902e7 No.146599

We are moving fast.

Remember, not all within the C-A, D-J, F-I are bad apples.

House cleaning (TOP).

Restructuring (1 to 2).

Operations 24/7.

Speed.

Q

 

Thu 15 Feb 2018 15:47:34 6d0fd8 No.388588

>>388528

Why is Big Pharma essential?

Expand your thinking past cures.

Think Google [new Pixel phone].

Think Apple [vs. Samsung].

Why was Blackberry destroyed?

We can guide but you must organically uncover the TRUTH.

THEY are watching.

ARCHIVE EVERYTHING OFFLINE.

Q

Anonymous ID: b06664 May 3, 2018, 7:28 a.m. No.1285568   πŸ—„οΈ.is πŸ”—kun   >>5590 >>5613 >>5658

From yersterday's CDAN blind.

 

Some guy on this blog says it's J Depp. It's prly not. Says 3 floors, this is 2 floors.

 

Had property in this building in LA. Owned 5 penthouse suites,

 

The blind says 3 floors.

 

http ://www.condopedia.com/wiki/Eastern_Columbia_Lofts#Layout_and_Features

 

Back to believing its Dopey. 3 floors = Mandalay Bay. The blind specifically mentions sunglasses belonging to bodyguard. I think that was slipped in the blind because we are always seeing dopey in sunglasses.

Anonymous ID: 607f0b May 3, 2018, 7:30 a.m. No.1285577   πŸ—„οΈ.is πŸ”—kun

>>1285555

nice quads. sadly no. one thing that sticks out in my mind was (the time was after 9/11) she was adamant almost upset that I assumed she was from Iran by her characteristics. I AM PERSIAN! kek

 

yes, memories, thanks anon

Anonymous ID: 87cb9d May 3, 2018, 7:33 a.m. No.1285593   πŸ—„οΈ.is πŸ”—kun   >>5620

>>1285476

>>1285297

This.

 

Remember, Story scandal is nothing more than a MSM distraction. They raided Cohen's office(s) for dirt, and got more than they bargained for:

>>1215845

 

Q very specifically stated that he will neither confirm/deny that the SC is on the team. The Stormy thing is nothing more than a laser pointer to distract the MSM. Again, "they fall for it every time".

>>1242619

Anonymous ID: 074f90 May 3, 2018, 7:33 a.m. No.1285595   πŸ—„οΈ.is πŸ”—kun

What is this moron up to.

 

Kellyanne Conway's husband trolls Trump with FEC rules

 

The husband of White House counselor Kellyanne Conway took a veiled shot at President Trump following revelations the president repaid his longtime attorney, Michael Cohen, for the $130,000 given to former adult film actress Stormy Daniels.

 

George Conway, a lawyer who removed his name from consideration for a top Justice Department post, tweeted Thursday a link to the Federal Election Commission’s web page for handling personal loans from a candidate for federal office.

 

Conway included in his tweet a screenshot from the page, which explained what is not considered the candidate’s personal funds.

 

β€œIf any person, including a relative or friend of the candidate, gives or loans the candidate money β€˜for the purpose of influencing any election for federal office,’ the funds are not considered personal funds of the candidate even if they are given to the candidate directly. Instead, the gift or loan is considered a contribution from the donor to the campaign, subject to the per-election limit and reportable by the campaign. This is true even if the candidate uses the funds for personal living expenses while campaigning," the passage highlighted by Conway states.

https:// www.washingtonexaminer.com/policy/courts/kellyanne-conways-husband-trolls-trump-with-fec-rules

Anonymous ID: 345feb May 3, 2018, 7:34 a.m. No.1285600   πŸ—„οΈ.is πŸ”—kun   >>5646

>>1285266

Looks to me like FIVE pallets. The one in the back looks like a double stack. One in the foreground, two behind that and then a single double stack in the back. Look at the wood pallets themselves, not what is on them. It looks like the one in the back has had the plastic wrap partially pulled down, probably to grab a box off the top or examine contents.

 

When you load a truck, you put the heavier stuff over the axles, you have to distribute the load correctly when you load the trailer.

Anonymous ID: 2f6a0b May 3, 2018, 7:34 a.m. No.1285601   πŸ—„οΈ.is πŸ”—kun

>>1285584

Or the picture could just be about showing a partially filled trailer that indicates business isn't so good. Yeah, yeah, I know the whole truck may have been full and several stops have emptied it out, Or it could just have been taken at the beginning of the loading of it. But we could just be looking at a metaphor for business isn't so good.

Anonymous ID: a87a8c May 3, 2018, 7:34 a.m. No.1285602   πŸ—„οΈ.is πŸ”—kun   >>5663 >>5671 >>5801 >>5856

Today Trump tweets:

 

Mr. Cohen, an attorney, received a monthly retainer, not from the campaign and having nothing to do with the campaign, from which he entered into, through reimbursement, a private contract between two parties, known as a non-disclosure agreement, or NDA. These agreements are…..

 

..very common among celebrities and people of wealth. In this case it is in full force and effect and will be used in Arbitration for damages against Ms. Clifford (Daniels). The agreement was used to stop the false and extortionist accusations made by her about an affair,……..

 

despite already having signed a detailed letter admitting that there was no affair. Prior to its violation by Ms. Clifford and her attorney, this was a private agreement. Money from the campaign, or campaign contributions, played no roll in this transaction.

 

Lets review the Stormy Story shall we:

 

Stormy makes affair claim (privately) against Trump

Cohen paids her to keep quiet, $130,000

She signs statement denying affair and NDA (non-disclosure agreement)

In some way Trump reimburses Cohen the $130,000

MSM catches wind of this and claims campaign contribution violations.

Then Stormy violates the NDA and goes public

Cohen reveals the settlement

Trump says he did not know anything about the $130,000 payment.

Cohen’s office is raided

Rudy comes out with a statement that says Trump did reimburse Cohen for the $130,000

Trump confirms in his tweets, yeah I did reimburse the $130,000

Hello possible Stormy Trump affair, big yawn

Bye bye campaign contribution violations

 

Truth:

Trump NEVER had an affair with Stormy Daniels (she is a Trump woman and can work with Trump and any Story he wants)

Donald Trump Jr. HAD an affair with Aubrey O’Day in 2012 -2013 (O’Day is a loose cannon, NOT workable)

 

Now let’s re-read the above summary with this in mind.

 

Aubrey O’Day (NOT Stormy) makes affair claim (privately) against Trump Jr. (NOT Trump)

Cohen paids her to keep quiet, $130,000

She signs statement denying affair and NDA (non-disclosure agreement)

In some way Trump reimburses Cohen the $130,000

MSM catches wind of this and claims campaign contribution violations.

Now Trump has a problem, these pesky MSM allegations of campaign contribution violation.

Stormy to the rescue!

Stormy goes public, she PRETENDS to violate the NDA and that she is the one involved in all this (even though she isn’t, it is O’Day who got paid off), that she got the $130,000 pay off.

Cohen reveals the settlement

Trump says he did not know anything about the $130,000 payment.

Cohen’s office is raided (how convenient)

Rudy comes out with a statement that says Trump did reimburse Cohen for the $130,000

Trump confirms in his tweets, yeah I did reimburse the $130,000

Hello possible Stormy Trump affair, big yawn

Bye bye campaign contribution violations

 

Trump what a gentleman, protecting his eldest son Donald Trump Jr. and his affair with O’Day.

IMAO he’s not worth it

 

I guess Vanessa agrees with me.

Anonymous ID: c1f1d7 May 3, 2018, 7:35 a.m. No.1285611   πŸ—„οΈ.is πŸ”—kun

>>1285579

 

Foxconn - Wikipedia

 

https://en.wikipedia.org/wiki/Foxconn

 

Hon Hai Precision Industry Co., Ltd., trading as Foxconn Technology Group, is a multinational electronics contract manufacturing company headquartered in Tucheng, New Taipei, Taiwan.Foxconn is the world's largest contract electronics manufacturer and the fourth-largest information technology company by revenue. The company is the largest private employer in China and one of the largest …

History Β·

International operations Β·

Major customers Β·

FIH Mobile Β·

Controversies

.

 

Foxconn suicides - Wikipedia

 

https://en.wikipedia.org/wiki/Foxconn_suicides

 

The Foxconn Suicides were a spate of suicides linked to low pay at the so-called "Foxconn City" industrial park in Shenzhen, China, that occurred alongside several additional suicides at various other Foxconn-owned locations and facilities in Mainland China. Within 2010, there were 18 attempted suicides by Foxconn (Chinese: 富士康) employees resulting in 14 deaths in the

 

Foxconn Wisconsin assembly work to generate millions in …

 

https://www.jsonline.com/story/money/business/2017/12/01/foxconn…

 

Foxconn's Wisconsin operations are expected to employ 2,000 people and generate $1 billion in sales by 2019 - well before its Racine County factory is built.

Anonymous ID: 652f05 May 3, 2018, 7:35 a.m. No.1285612   πŸ—„οΈ.is πŸ”—kun

Apple has given a series order for 10 episodes of "Are You Sleeping," a drama series that will star Octavia Spencer, who is known for her work in movies that include "Hidden Figures," "The Help," "Gifted," and "The Shape of Water."

 

News of Apple's work on "Are You Sleeping" first surfaced in January, but now Variety says the company has decided to move forward with production on the show.

 

"Are You Sleeping" is based on a novel by Kathleen Barber, which has been described as a psychological thriller. The book focuses on a podcast that reopens a murder case, similar to the popular "Serial" podcast that led to a new trial for Adnan Syed, in jail for allegedly murdering a former girlfriend. Sarah Koenig, who created and produced "Serial," will consult on "Are You Sleeping."

 

The novel the TV show is based on explores how the reopening of the murder case impacts the victim's daughter and disrupts her life, and it's likely the TV show will follow a similar plot.

 

"Are You Sleeping" was written by Nichelle Tramble Spellman, and the series will be produced by Reese Witherspoon's Hello Sunshine and Chernin Entertainment/Endeavor Content.

 

Apple is also working with Reese Witherspoon's production company on an as of yet untitled "morning show drama" that takes a look into the cutthroat would of morning TV.

 

Apple now has more than a dozen television shows in the works, with a full list of what's on the horizon available in the original content section of our Apple TV roundup.

 

It's not yet known when the first of Apple's TV shows will debut nor how they'll be distributed, but rumors have suggested we could see the first fruits of Apple's efforts in 2019.

Anonymous ID: 8439f9 May 3, 2018, 7:36 a.m. No.1285618   πŸ—„οΈ.is πŸ”—kun   >>5851

>>1285584

 

im telling you now, after quite a bit of digging

 

i have came to the conclusion that what is on the

 

boxes on the pallets are:

 

Big Toes

 

there seams to be a huge shortage in China.

 

machete' accidents from cutting rice stalks.

Anonymous ID: 51f512 May 3, 2018, 7:36 a.m. No.1285619   πŸ—„οΈ.is πŸ”—kun

Some reverse psychology here.

A few from the Voter ID memes collection

to celebrate Court decisions allowing the obvious, the identification of citizens as legitimate voters.

Anonymous ID: e75123 May 3, 2018, 7:37 a.m. No.1285624   πŸ—„οΈ.is πŸ”—kun   >>5660 >>5678 >>5688

HOLY FUCKING SHIT

 

EVERY ANON ON THIS BOARD

 

Read about fucking John Jay McCloy

Seriously, never ever have I heard of him before.

He's the freaking financier of WW2! He was the concierge for the cruel financing of Hitler! He was sent by the Rockefellers and gave millions to Germans Nazi regime and also the dictatorship in Italy (Mussolini)

 

wikipedia.org/wiki/John_Jay_McCloy

 

Also notice today's Nazi post of Bloomberg:

https://www.bloomberg.com/news/articles/2018-05-03/world-s-youngest-billionaires-are-shadowed-by-ghosts-of-german-past

Anonymous ID: fb2108 May 3, 2018, 7:38 a.m. No.1285629   πŸ—„οΈ.is πŸ”—kun   >>5681 >>5743 >>5856

I linked this a few days ago, but everyone was arguing and it was missed.

But with Q’s posts last night and Fox article yesterday, take a look please. This is worth a deeper dig. Pics related.

This links to Iran as well.

 

http:// www.foxnews.com/politics/2018/05/02/pentagon-orders-stores-to-ban-certain-chinese-phones-amid-spying-concerns.html

 

https:// wikileaks.org/hackingteam/emails/emailid/597644

 

https:// www.wired.com/2012/07/fbi-zte/

Anonymous ID: 66a798 May 3, 2018, 7:38 a.m. No.1285633   πŸ—„οΈ.is πŸ”—kun

>>1285430

>So..if the guy is not a friendly friend, he probably is into soemthing very BAD. his thing could very well be blackmailing POTUS.

Definitely bad.

Definitely into blackmail

Definitely NOT blackmailing potus

 

we talked about this back in Jan

the guy is connected to NSA (meaning that that is most likely his MAIN job)

He was the only American there

Potus brought him to tell all the CEOS at the table that he HAS IT ALL via SAP/NSA spying over the decades.

McDermott mentions infant mortality to say "we know about your involvement in trafficking" blah blah blah

Anonymous ID: 903612 May 3, 2018, 7:38 a.m. No.1285634   πŸ—„οΈ.is πŸ”—kun

Record exports cut US trade deficit to $49 billion https://apnews.com/ea766935a9224d6fa59ecabbd780b70f/Record-exports-cut-US-trade-deficit-to-$49-billion?utm_campaign=SocialFlow&utm_source=Twitter&utm_medium=APBusiness

Anonymous ID: ee7c64 May 3, 2018, 7:40 a.m. No.1285646   πŸ—„οΈ.is πŸ”—kun   >>5737

>>1285600

 

>When you load a truck, you put the heavier stuff over the axles, you have to distribute the load correctly when you load the trailer.

You are correct unless there are only three (or even 5) pallets. The loading above the goose neck is not only normal but necessary to install the load lockers to prevent movement back and forth..

Anonymous ID: cfd191 May 3, 2018, 7:44 a.m. No.1285665   πŸ—„οΈ.is πŸ”—kun

>>1285430

Jokes aside, SAP is in the same big date & AI business as amazon, google et el. I attending a SAP presentation a couple of years ago about a project in San Palo Brazil where HANA is connected to a live data feeds from 1000's of security cameras across the city. Based on facial and license place recognition and travel patters of everyone, they claimed the system could quickly identify suspects when crimes happened and could also predict who was GOING TO commit a crime. The predictions where supposedly filtered out to the cops on the street to look for and watch the pre-crime suspects.

Anonymous ID: d921a4 May 3, 2018, 7:46 a.m. No.1285680   πŸ—„οΈ.is πŸ”—kun

>>1284552

that's high autism anon. Q crumb above + new @realDonaldTrump banner related?

>>1284638

brilliant idea…from Pentagon to hex-a-decimalgon. love it.

>>1285572

>last pic related?

 

ICYMI, also related & educational: FEBRUARY 27, 2018

Fiscal Year 2019 Cyber Command Budget Request

Admiral Michael Rogers note missing 's' on c-span.org is director of the National Security Agency and the head of U.S. Cyber Command, which runs the military’s computer network defenses.

>https://www.c-span.org/video/?441677-1/nsa-chief-testifies-fiscal-year-2019-budget

Anonymous ID: 868884 May 3, 2018, 7:46 a.m. No.1285685   πŸ—„οΈ.is πŸ”—kun   >>5773 >>5856

Manafort Lawyers Claim Leaky Mueller Probe Has Provided No Evidence Of Contacts With Russian Officials

thefederalist.com/2018/05/03/manafort-lawyers-claim-leaky-mueller-probe-has-provided-no-evidence-of-contacts-with-russian-officials/

 

The alleged lack of evidence would be in sharp contrast to the repeated leaks from anonymous

but highly placed government officials that led to the appointment of a special counsel.

 

The special counsel’s office says it has no evidence in its possession responsive to Manafort’s

request for transcripts, notes, or tapes of any and all conversation or contacts between Russian

intelligence or government officials and Manafort, according to the filing.

Anonymous ID: 01422e May 3, 2018, 7:47 a.m. No.1285694   πŸ—„οΈ.is πŸ”—kun

Reading couple past breads. Regarding random info drops after first pics i.e. Qf35 or whatever. I remember Q saying something to the effect of his info drops are not only for us anons. And since then, Q has told us repeatedly that the whole world is watching. Perhaps someone is trying to setup comms with a close by F35 strike fighter? Just the vibe I got from Qf35 drop.

Anonymous ID: f31949 May 3, 2018, 7:49 a.m. No.1285704   πŸ—„οΈ.is πŸ”—kun   >>5753

>>1282527

 

I GOOGLED HOW TO WIND A CLOCK

 

"To wind the clock simply place the key, or crank, into the winding point and turn clockwise sixteen revolutions. When the clock is fully wound an internal mechanism will prevent you from winding any further"

Anonymous ID: 556a87 May 3, 2018, 7:49 a.m. No.1285708   πŸ—„οΈ.is πŸ”—kun

>>1285675

 

Turns out that the 8-4-4-4-12 is a completely standard thing …. a UUID …

 

https://en.wikipedia.org/wiki/Universally_unique_identifier

 

In its canonical textual representation, the sixteen octets of a UUID are represented as 32 hexadecimal (base 16) digits, displayed in five groups separated by hyphens, in the form 8-4-4-4-12 for a total of 36 characters (32 alphanumeric characters and four hyphens). For example:

 

123e4567-e89b-12d3-a456-426655440000

xxxxxxxx-xxxx-Mxxx-Nxxx-xxxxxxxxxxxx

 

The four bits of digit M indicate the UUID version, and the one to three most significant bits of digit N indicate the UUID variant. In the example, M is 1 and N is a (10xx), meaning that the UUID is a variant 1, version 1 UUID; that is, a time-based DCE/RFC 4122 UUID.

 

The canonical 8-4-4-4-12 format string is based on the "record layout" for the 16 bytes of the UUID

Anonymous ID: e49e9d May 3, 2018, 7:49 a.m. No.1285712   πŸ—„οΈ.is πŸ”—kun   >>5721

I have a feeling that something big is about to happen. It wpuld be smart to drop the cohen payment bombshell rigjt before anothet huge bombshell that will take the attention off cohen.

 

Im expecting something to drop soon.

Anonymous ID: edc754 May 3, 2018, 7:49 a.m. No.1285713   πŸ—„οΈ.is πŸ”—kun   >>5722

>>1285655

It looks they used thin metal bands (I don't know the actual name for it) to hold the boxes together, then shrinkwarpped over it. That would be my explanation for the vertical lines.

I don't think it is a server frame, both pallets look like they're made up of multiple smaller boxes.

Whoever packaged them went out of their way to make sure they would be secure.

Anonymous ID: e97ff9 May 3, 2018, 7:51 a.m. No.1285726   πŸ—„οΈ.is πŸ”—kun   >>5735 >>5786 >>5797 >>5856

>>1285412 (me)

>>1285422

>>1285464

FUCKING HELL ANONS

I think I found it.

Check out this source, got KICKED offline as soon as I found it (#coincidence)

IRIS SCANS are used to scan for AIDS, CANCER, HEREDETORY diseases and a whole bunch of other stuff.

Did you know that??? I sure as fuck don't!

So why don't they scan us huh?? no one has to "find out too late".

http:// smallbusiness.chron.com/dangers-retinal-scanners-70631.html

 

SO Adreno + chrome + iris scan + your location + your metadata = they can look for PERFECT healthy yummy specimens, and I have NO DOUBT (guessing here) that 5g or other nasty frequency shit makes (young) people produce moar adrenochrome.

That's why there all going ape shit and triggered into clubbing someone over the head for wearing "the wrong prom dress.

Anonymous ID: 5479dd May 3, 2018, 7:51 a.m. No.1285727   πŸ—„οΈ.is πŸ”—kun   >>5734 >>5837 >>5856

>>1285648

Q POSTS PHOTO ID

B3D12FDF-7189-4836-AD41-F4

DB0379CC-9229-43B5-AD54-F4

EB072EBC-0DF3-4A2C-BE89-E3

8466691D-0F75-44F5-AA92-43

39E6E8ED-2D45-4AB9-A4EA-68

901FFF2C-CFFC-4586-8226-7

9E1AB60E-071C-4226-ADEC-B

9E1AB60E-071C-4226-ADEC-B

95DDEF59-7086-4535-985D-5

0568570F-2EA7-4162-A75F-4E

A3589E21-85D1-4056-9DC7-5

703C92E0-E064-4400-932F-2

83139841-57B9-47B5-8FA6-D

AA00D4A7-BF25-44EC-BB62-4

BC185452-3F1B-493B-98D9-92

EFABC59D-40D3-4570-81E3-5

C8F91EAD-51C7-47FA-96C5-C

72C68DD2-F512-4DC8-ADA8-E

CAFB8AB7-539E-4AFB-9EC0-E

CC1B1FD7-8B70-4CEB-A4F7-F5

89F919D3-5900-4DCA-BA1B-DB

25666BD0-F5F9-4A63-AE62-4A

C13A8327-8986-4D5E-AC6B-EC

EA29DD13-F16F-4580-9DC8-0D

8B01A899-533A-4231-8BAF-6

763B79E9-EA56-4EBD-A42A-2

EF3D1B1B-2E68-4FD4-814F-E

B42CA278-6C32-4618-A856-0

D6C46F7A-C7B1-4A32-9576-E28854C1C1DC

F0704A26-CA59-40E8-9285-5

ABD8260F-EBBB-4C18-A9AE-8

13372080-45DC-4E32-B340-3

31506F85-476A-4DD6-BDF4-56

C879615C-3616-402C-B3F6-81

FC8DF5A5-6BB2-4A87-90BF-B4

CBFE279C-FAD2-403C-A11C-E

683C2B19-0FF1-4C01-B33B-3C

32AD9484-F41A-4806-AD48-6C

18454392-100A-4B49-A774-67

784A60C6-B1C0-4DCE-ACE1-A9

BF865568-AABA-4354-A7C6-18

18A539B4-3085-4E11-8945-D

B1ADF2C9-65EF-42CB-A3D8-8B

7F0F82A1-151F-4868-96EE-054CE9876425

7803B61A-1F3E-47BD-88D4-F

DEA28E7A-5339-4D0B-A991-AB

482D19E4-6664-478F-8836-30

3155B65F-063D-445E-A3BD-5

2C880EB2-FFFC-4E95-B22C-B

5D00DA74-A956-474C-A7A1-5

8BF7AC13-C658-41A6-A0E3-8

54950FD4-115E-404E-B1DF-4

A783B991-11D9-40D0-BD69-1

710102CD-50EE-4035-93E4-6

E349DAAB-AEE3-45EF-B056-2

C2C6E563-AEEE-46D4-95F9-0

9AB57841-1F3F-4630-889B-4

77C6EF7B-C1F0-49A6-BD1E-C

29ABE882-37B0-472A-A79E-F

9B7BDECB-79FD-4D3C-BE97-A

BA1C5CD5-5C3B-4FE5-93B1-F

540296AD-9205-4253-B4CF-B

25346004-2104-4DBA-9B88-E9

B6C47FD8-1F66-4549-8A4B-2

0704911B-FBA8-4DE7-9C53-9

03821C90-07E4-4906-B30D-A

6AECCB3F-2186-4C21-9749-06

C7248201-F913-4F0C-A667-9

 

Exec_y.png

c7829.jpg

DUGtJVsU8AElqAt.jpg-large.jpg

Unknown.jpg

switzerland-davos-forumjpe….jpg

alkd839.jpg

6a0120a610bec4970c0162fc20

kT4H8Kfh.jpg

soros-and-rothschild.jpg

rothschilddavidwjcyfranc.jpg

QFF.jpg

RTM.png

learn-some-history-13th-am

Unknown.jpg

Unknown.jpg

WDSHN_ISIS_TRAITOR_NN.jpg

Clown_Comm_Narrative.png

FREEDOM_.png

NSA_Traf_CAM_LONDON2847.png

Just_Waiting.png

Anonymous ID: 903612 May 3, 2018, 7:52 a.m. No.1285732   πŸ—„οΈ.is πŸ”—kun

β€œEric Bolling, one of the most influential and successful conservative media figures, is joining CRTV, announced CRTV president Gaston Mooney,” a press release from Conservative Review reads."

http://dailycaller.com/2018/05/03/eric-bolling-new-show/

Anonymous ID: e97ff9 May 3, 2018, 7:52 a.m. No.1285735   πŸ—„οΈ.is πŸ”—kun

>>1285726

QUOTE FROM WEBSITE

>Health Risks

Retinal scans are often used in health scanning procedures – to identify communicable diseases including AIDS, chicken pox and malaria – and to scan for hereditary diseases including various types of cancers. The scan itself poses no threat to the eye or to your overall health, though users of retinal scans complain of discomfort from the technology as they must lean in and keep their eye close to the machine for 30 seconds in order for a scan to be accurate.

Anonymous ID: 10216b May 3, 2018, 7:52 a.m. No.1285736   πŸ—„οΈ.is πŸ”—kun   >>5775

>>1285311

C-130 looks like remotely controlled. Normal descent, then suddenly dives and corkscrews into the ground.

 

9/11 airplanes into WTC seemed remotely controlled. One 747 captain said he couldn't turn a 757 or 767, whatever it was, as tightly as one turned going into one of the towers.

 

This control can be accomplished thru the Flight Management System, locking out the cockpit and flying thru the FMS. I read some posts saying that tech. had indeed been developed. Heavy jets all have FMS and have for years. Smaller ones like 737 I am not sure.

 

C130 crash happened right after Trump blamed Iran for 9/11 by demanding repayment from them. Was the C130 crash Iran spitting at him because of this?

Anonymous ID: 345feb May 3, 2018, 7:52 a.m. No.1285737   πŸ—„οΈ.is πŸ”—kun   >>5812

>>1285646

Yup. Also, the second pallet back on the right seems to be of a different height, suggesting that the boxes are of a different size possibly indicating a different product than the other pallets. No idea if that even matters though.

Anonymous ID: edbee9 May 3, 2018, 7:54 a.m. No.1285748   πŸ—„οΈ.is πŸ”—kun

>>1285325

 

All the other pallets were in front of those. They were the last one's to come off.

 

And who says that pallets with boxes full of money can't be lifted? I saw that comment previously on here from someone else.

 

Anyone whose ever operated a fork truck will tell you that merely taking some weight of the pallet off the floor allows you to slowly drag/slide the pallet out if need be.

 

Does anyone really think that whomever went to this amount of trouble didn't think through how they would unload or distribute boxes full of cash?

Assuming it is cash, of course.

Anonymous ID: 21c811 May 3, 2018, 7:54 a.m. No.1285750   πŸ—„οΈ.is πŸ”—kun   >>5766 >>5893

GERMANARCHIVEANAON UPDATE

 

I added #1593 to #1610 to the folder, and updated the checksums.

 

mega.nz/#F!LPZxEIYJ!N5JwCNoxOxOtAoErKdUgvw

 

1593-1610.zip MD5: 19e1afbe9ed6f8df09f1fdd7329b8d82

 

The archive now contains 1616 breads.

 

The ZIPs contain .webarchive files as usual. So these files are still SAFARI ONLY.

 

GERMANARCHIVEANON OUT

Anonymous ID: e4dcc6 May 3, 2018, 7:55 a.m. No.1285756   πŸ—„οΈ.is πŸ”—kun

That’s according to Apple Insider, which today posted a number of photos taken outside the 70,000 square-foot building, reportedly referred to by employees as β€œAthena.” Shipments of equipment, wrapped in anti-static foil and labeled β€œdelicate instruments,” have become routine at the facility in the months since Apple acquired it.

 

This activity suggests that Apple plans to put the facility to work, but for what is far from certain. Apple designs the processors in its mobile devices, but it contracts the actual manufacturing out to Taiwan Semiconductor Manufacturing Company and Samsung.

 

https:// www.digitaltrends.com/apple/apple-fabrication-building-san-jose-california/

 

Exclusive: Apple's top secret 'Athena' chip fab gets new 'delicate equipment'

https://iphone.appleinsider.com/articles/16/04/29/exclusive-apples-top-secret-athena-chip-fab-gets-new-delicate-equipment

Anonymous ID: db24bd May 3, 2018, 7:55 a.m. No.1285757   πŸ—„οΈ.is πŸ”—kun

Could this be a possibility?

Just found this article regarding a large fentanyl shipment from China:

 

Mar 28, 2018 3:29 pm ET

 

Men Shipped Fentanyl, Carfentanil From China To Montco Homes: DA

 

Breaking: The pair shipped massive quantities of the lethal drugs from China directly to doorsteps of Montgomery County homes, the DA said.

 

https:// patch.com/pennsylvania/norristown/men-shipped-fentanyl-carfentanil-china-montco-homes-da

Anonymous ID: a9a4d7 May 3, 2018, 7:56 a.m. No.1285759   πŸ—„οΈ.is πŸ”—kun

>>1282527

Wind a clock 16 times is that the 16 year plan, is the key a number of a man, who is the anti Christ? 666 Is this Hillary's handler? Is he more evil than Soros? And is 17 Q the new plan?

Anonymous ID: c0a23d May 3, 2018, 7:57 a.m. No.1285763   πŸ—„οΈ.is πŸ”—kun

>>1285728

The picks look like they may be server racks. Or, maybe, storage racks with tons of drives. Could be moving a lot of currency in the form of crypto contained within.

Maybe. Refrigerator truck would make sense, you would want to keep the equipment cool, even when powered off, to make damn sure no data is lost.

Anonymous ID: 4f5c64 May 3, 2018, 7:58 a.m. No.1285770   πŸ—„οΈ.is πŸ”—kun   >>5826 >>5881

>>1285255

Just come back to the thread so not 100% sure what this is about. However, Mark Thompson covered up the Jimmy Savile affair at the BBC. He blocked a documentary that was going to out Savile as a Pedo. Then he escaped the country with a parachute job at the New York Times I think.

 

https://www.telegraph.co.uk/news/uknews/crime/jimmy-savile/10512203/Former-BBC-boss-Mark-Thompson-lied-over-Savile-evidence-Nick-Pollard-claims.html

 

https://www.theguardian.com/media/2012/oct/16/new-york-times-mark-thompson-jimmy-savile-bbc

Anonymous ID: 777edd May 3, 2018, 7:58 a.m. No.1285773   πŸ—„οΈ.is πŸ”—kun

>>1285685

 

β€œAccordingly, if the representations of the Special Counsel are accurate, and there is not, in fact, any evidence of communications between Mr. Manafort and foreign officials, then the perpetrators of this elaborate hoax must be identified and punished and the substantial unfair prejudice to Mr. Manafort must be remedied,” the filing continued.

 

Interesting article, ty anon !!!!

Anonymous ID: 4c53f3 May 3, 2018, 7:59 a.m. No.1285775   πŸ—„οΈ.is πŸ”—kun   >>5803

>>1285736

Keep in mind this C130 was VERY old, and was on its last flight to AMARG in New Mexico for mothballing. In fact it was probably one of the least-automated C130s flying today so any sort of hacking of the FMS is less than likely. Most likely reasons IMHO: Broken control linkage, shifted CG, loss of hydraulics, rudder actuator failure, flaps set incorrectly.

Anonymous ID: 6610aa May 3, 2018, 7:59 a.m. No.1285776   πŸ—„οΈ.is πŸ”—kun   >>5800 >>5822 >>5930

>>1285134

>>1285012

 

As I have repeatedly pointed on on Boards & SM,…….

 

The Pacer dot gov records are Sealed, so IMPOSSIBLE to know which are actually INDICTMENTS.

But keep following. . . . the numbers here are staggering & obviously atypical.

This is real.

Here's an amended one to reflect the RECORD.

 

TY for the attorneys & Anons behind the scenes working to tabulate on their own time…. & paying Pacer for the counts. YOU are patriots.

Winning will be Glorious!

#WWG1WGA indeed.

 

https://

www.pacer.gov/

Anonymous ID: 5cda55 May 3, 2018, 7:59 a.m. No.1285777   πŸ—„οΈ.is πŸ”—kun   >>5794

>>1285755

>muh aliens

Have they ever mentioned Pleiadians? Do you know what Pleiadians are? And how you can get in contact with them? All you can hear is

>muh distraction

>muh unexplained

>muh man made

>muh threat to national security

Secrets, fear mongering, PARTIAL disclosure.

We are in for a FULL DISCLOSURE.

Anonymous ID: f31949 May 3, 2018, 7:59 a.m. No.1285778   πŸ—„οΈ.is πŸ”—kun   >>5793 >>5841

>>1285753

There are only two.

 

This one:

[The 16 Year Plan To Destroy America]

 

And this one:

How bad is the corruption?

FBI (past/present)

#1

#1

#2

+29 (16)

DOJ (past/present)

#1

#1

#2

+18

STATE (past/present)

#1

#1

+41

 

I think with the markers we make like a clock and use a key in the middle and turn it 16 times?

Anonymous ID: 188591 May 3, 2018, 8 a.m. No.1285788   πŸ—„οΈ.is πŸ”—kun

money (laundering) beauty industries >feminine occult symbols

 

these people seem interested in DNA (every product has some sort of double helix like promo graphic)

 

american society for aesthetic plastic surgury inc == Nefertiti (conehead - king lineage? - vanity)

 

award statues for the beauty industry = gold female with wings "goddess"

Anti-Aging & Beauty Trophy

1st BIOPTRON (redcross insignia)

2nd mesoestetic

3rd Teoxane Laboratories +(redcross insignia) (RHA-4)

4th …..{lost interest}

(swiss) & all that but that, i know

but crosses stood out seems like an Lynn [LdR] & Red cross sorta thing,

might need a beautyfag? don't know the industry

could be nothing but i'll nick a bit of bread incase anyone else is on the beauty industry

Anonymous ID: f9f1ca May 3, 2018, 8 a.m. No.1285790   πŸ—„οΈ.is πŸ”—kun

>>1285238

That Hillary email is one of the "From Hillary To Hillary"… where they were probably all just using "drafts" without sending, THINKING they couldn't be surveilled/captured. But Q said THEY HAVE IT ALL… INDEED THEY DO!! oh Hillary and Cheryl Mills, not as smart as you think you are!

Anonymous ID: 30bab8 May 3, 2018, 8:01 a.m. No.1285791   πŸ—„οΈ.is πŸ”—kun

Maybe Q is showing us the extent of technology that is available. Were those pictures captured off of other people's phones. Perhaps even different phones. JetBlue has integrated apple wallet check-ins. Apple has given it all up. Think of Eagle Eye and Empire of the State. With geospatial information and root device access, "he has it all".

 

Want to see a story of shipping Apple products to HK? Now you have and from multiple perspectives.

 

Q has given us a demo and he could be on the east coast for all we know!

Anonymous ID: 72e318 May 3, 2018, 8:02 a.m. No.1285798   πŸ—„οΈ.is πŸ”—kun

Just a thought… Q posted a handful of random pics because (like 95% of us here), Q was also sick and tired of reading shit about Jews and gave these stupid fucks something new to play with.

Anonymous ID: e97ff9 May 3, 2018, 8:02 a.m. No.1285801   πŸ—„οΈ.is πŸ”—kun

>>1285602

VERY plausible &

NOTABLE imho

β€”-

btw: Rudy said it's VERY common for lawyers to handle that sorta smut claims themselves, SOP, and pay the STFU money. they get reimbursed thru their monthly retainer. Probably the only reason a client has this lawyer, gets a nice fee and has to handle the bimbo squad out of pocket

Anonymous ID: b06664 May 3, 2018, 8:03 a.m. No.1285804   πŸ—„οΈ.is πŸ”—kun   >>5937

This marker thing looks very promising. Spider web marker.

 

Crude image, but:

 

Looks like this string of messages points to falsifying identities to keep them secret, move them thru society and then put them out there on behalf of the cabal.

 

Connect this line.

 

Angela Merkel

Ray Chandler

NoName's wife

 

Is the spider web marker all about this?

Anonymous ID: 3b9ea1 May 3, 2018, 8:03 a.m. No.1285806   πŸ—„οΈ.is πŸ”—kun

There is a major shift underway in the public sentiment that is underscoring why our computer has been forecasting the collapse in Marxist/Socialism. The message of the Democrats has been the same since the Great Depression – vote for us and we will rob those who have more and give it to you. When we just look at the fact and put aside the political biases, the chart shows a very striking trend. When we combine both the Senate and the House and then plot the number of seats each party held as a percent of the whole combination, we see that the Democrats peaked with FDR. They have won at times ever since, but the percentage of seats held has been gradually declining.

Now an online survey of more than 16,000 registered voters ages 18 to 34 has revealed that support for Democrats over Republicans in Congress has continued to decline among the youth. It has fallen another 9% since the 2016 election to just 46%. The responses say that the Republican Party is a better steward of the economy. This should come as no surprise. The entire Marxist agenda resonated with the Great Depression generation as the Marxists blamed corporations and never mentioned the Global Sovereign Debt Crisis of 1931. The younger generations are simply viewing the world differently as to what they can do themselves rather than what government can do for them. They simply want to keep more of what they work for. The Marxist message of the Democrats is gradually fading out. Equal Justice for All means it should apply fairly to everyone, not just some.

 

-Armstrong Economics today.

 

https: //www.armstrongeconomics.com/international-news/politics/the-changing-wind-in-politics-by-generation/

Anonymous ID: 683915 May 3, 2018, 8:04 a.m. No.1285810   πŸ—„οΈ.is πŸ”—kun

>>1284613

 

The process starts in China, where pallets of iPhones are moved from factories in unmarked containers accompanied by a security detail. The containers are then loaded onto trucks and shipped via pre-bought airfreight space, including on old Russian military transports. The journey ends in stores where the world's biggest technology company makes constant adjustments based on demand, said people who have worked on Apple's logistics and asked not to be identified because the process is secret. https://www.engadget.com/2013/09/11/the-logistics-behind-transporting-millions-of-iphones-from-china/

Anonymous ID: 345feb May 3, 2018, 8:04 a.m. No.1285812   πŸ—„οΈ.is πŸ”—kun

>>1285737

Looking at it some more, it looks like there is a box missing on the one in the back because of the way that the shrink wrap sags. That usually happens when you take a box off the top and creates slack in the tension of the shrink wrap.

Anonymous ID: e97ff9 May 3, 2018, 8:05 a.m. No.1285814   πŸ—„οΈ.is πŸ”—kun

>>1285786

So why THE FUCK do they let us die of cancer if all it fucking takes is a 30 sec retina scan????

I'm gonna dig if they can measure hormonal levels in a ret scan. Get someone with elevated adreno chrome levels?? YUMMY

Anonymous ID: e02a8a May 3, 2018, 8:06 a.m. No.1285821   πŸ—„οΈ.is πŸ”—kun   >>5866

>>1285752

 

That is SJC, San Jose International. The plane's wheels are up so it is taking off. If you take off from SJC to the northwest, you go over the wetlands at the south end of San Francisco Bay. That looks like the Eden Landing Ecological Reserve in the photo.

Anonymous ID: 6610aa May 3, 2018, 8:06 a.m. No.1285822   πŸ—„οΈ.is πŸ”—kun

>>1285776

>>1285800

 

Sorry for the type = "on"

 

My best sources & my personal guess is most will be Sealed Arrest Warrants & Search Warrants.

 

Impossible to have these many Indictments w/o a record number of Grand Juries,

And so far, info on this fact has been virtually ZIPPO, Nil, Nada…..

Anonymous ID: 164379 May 3, 2018, 8:06 a.m. No.1285823   πŸ—„οΈ.is πŸ”—kun

>>1285808

 

Yes. You get more of those pixels filled in with detail, which means that when it's cropped, whatever you're cropping has more detail. You always start with the most amount of detail, so that as things get widdled down you still end up with the most amount of information possible.

Anonymous ID: 8c78b9 May 3, 2018, 8:06 a.m. No.1285824   πŸ—„οΈ.is πŸ”—kun

>>1285809

completely agree

the end of the which hunt, SIGNALS PHASE [3]>>1285811

let me guess, you are here ecause of the ONE post Q replied to about incarnated extraterrestrials (which Q DIDN'T even acknowledge, he replied to the picture, and the anon used SARCASTICALLY)

Anonymous ID: d921a4 May 3, 2018, 8:07 a.m. No.1285826   πŸ—„οΈ.is πŸ”—kun

>>1285770

>with a parachute job at the New York Times I think.

>>1285255 confirms.

>not 100% sure what this is about.

Original sauce for the Mark Thompson dig is in Notables #1610 -

>>1284656 Left/Right TV - possible left/right up/down explanation

Looks like the NY Times is getting into Cable TV with some "innovative programming".

>Mark Thompson covered up the Jimmy Savile affair at the BBC.

Quelle surprise. Thx. for the sauce. Picture is becoming earlier, yes?

Anonymous ID: 4c53f3 May 3, 2018, 8:09 a.m. No.1285843   πŸ—„οΈ.is πŸ”—kun   >>5904

>>1285803

Depends on what sort of INS sensors the autopilot on this particular C130 relied on and if the plane was flying with any sort of autopilot at the time. Theoretically, certain MEMs-based INS systems could be disrupted using electronic warfare, but doubtful this thing was using MEMs-based INS. C130s also have varying levels of EMP-hardening that would protect it from all but the most powerful of attacks.

Anonymous ID: 45364b May 3, 2018, 8:10 a.m. No.1285847   πŸ—„οΈ.is πŸ”—kun

>>1285667

>>1285628

LEARN[OC] = learn our comms

 

also [A]UDIT:PENT_S2:G5

 

could be audit Pentagon and s2…? G5 possibly means "Group of 5"

 

Recent Audit of Pentagon:

 

"Audit finds Pentagon failed to properly keep track of $800 million in projects, says report"

 

https://www.cnbc.com/2018/02/05/audit-finds-pentagon-failed-to-properly-keep-track-of-800-million-in-projects-says-report.html

Anonymous ID: c1f1d7 May 3, 2018, 8:10 a.m. No.1285850   πŸ—„οΈ.is πŸ”—kun

NEWS UNLOCKS CRUMBS

 

Do the Apple/boxes/plane pics have anything to do with today being National World Password Day

 

WORLD PASSWORD DAY – FIRST THURSDAY IN MAY | National Day …

Anonymous ID: aee2d4 May 3, 2018, 8:11 a.m. No.1285856   πŸ—„οΈ.is πŸ”—kun   >>5875 >>5879 >>5893 >>5898

NOTABLES SO FAR

 

#1611

>>1285096 ; >>1285225 Xiaomi (Chinese Electronics Producer)

>>1285227 You realize Trump literally tweeted the court case in a nutshell.

>>1285241 Jet Blue and Apple

>>1285363 Anon Analysis - Cook has been brought to heel.

>>1285430 Bill McDermott, CEO of SAP

>>1285496 Giuliani says 3 Americans held by North Korea to be released Thursday

>>1285528 Relative to the Aircraft Incidents and EW (Electronic Warfare)

>>1285543 Crytic Post Could Be More Than It Seems

>>1285316 POTUS tweet uses GOOD and GREAT (in that order), shout out to Q post

>>1285581 US Trade Deficit Drops Sharply

>>1285527 possible use of the word marker related to other Q posts at same time

>>1285605 ; >>1285625 Marker Graphics

>>1285629 Chinese Products in the USA

>>1285685 Manafort Lawyers Claim Leaky Mueller Probe Has Provided No Evidence Of Contacts With Russian Officials

>>1285727 Q Posts Photo ID

>>1285726 Perfect Way to Find Perfect Specimens

>>1285602 Analysis of the Stormy Situation

 

Anything I missed anons?

 

WARMING THE OVEN

Anonymous ID: 2b2eb8 May 3, 2018, 8:11 a.m. No.1285859   πŸ—„οΈ.is πŸ”—kun

>>1285786

First your employer will offer a $100 discount on your insurance if you get The Diagnostic Scan.

 

Then, if you hold out against that little carrot and all the peer shaming that will come not taking the scan, they're make a condition of ongoing employment.

 

#imho

Anonymous ID: d921a4 May 3, 2018, 8:12 a.m. No.1285867   πŸ—„οΈ.is πŸ”—kun

>>1285466

Which Q pics are you referring? The latest ones last appear to have nothing to do with HK (at this point).

Have you discovered a link between last night's and the ones from HK last month, etc.?

Anonymous ID: 17b2ac May 3, 2018, 8:13 a.m. No.1285876   πŸ—„οΈ.is πŸ”—kun   >>5880

Rudy Giuliani Says Trump Paid Back Stormy Daniels’ Hush Money, Rips β€˜Pervert’ Comey

 

In an appearance stuffed with odd factual errors, like saying no president had ever before been subpoenaed, and sweeping claims about β€œcriminal” Hillary Clinton and β€œdisgraceful liar” and β€œvery perverted man” James Comey, Giuliani flat out said Trump had paid back the money shelled out to buy the porn star’s silence, and that there was no problem there.

 

https ://www.thedailybeast.com/rudy-giuliani-says-trump-paid-back-stormy-daniels-hush-money-rips-pervert-comey

Anonymous ID: 7f2232 May 3, 2018, 8:13 a.m. No.1285877   πŸ—„οΈ.is πŸ”—kun   >>5895

>>1285835

https://www.zerohedge.com/news/2017-01-09/obama-gifts-iran-massive-uranium-shipment-russia-sufficient-more-10-nuclear-bombs

 

There are a few others. I like zero hedge as the comments provide more stuff to look through

Anonymous ID: 17b2ac May 3, 2018, 8:14 a.m. No.1285880   πŸ—„οΈ.is πŸ”—kun

>>1285876

In an appearance stuffed with odd factual errors, like saying no president had ever before been subpoenaed, and sweeping claims about β€œcriminal” Hillary Clinton and β€œdisgraceful liar” and β€œvery perverted man” James Comey, Giuliani flat out said Trump had paid back the money shelled out to buy the porn star’s silence, and that there was no problem there.

Anonymous ID: 083284 May 3, 2018, 8:15 a.m. No.1285884   πŸ—„οΈ.is πŸ”—kun

Pentagon bans sale of ZTE, Huawei phones on military bases, report says

 

http://www.foxnews.com/tech/2018/05/03/pentagon-bans-sale-zte-huawei-phones-on-military-bases-report-says.html

Anonymous ID: 6054bc May 3, 2018, 8:16 a.m. No.1285891   πŸ—„οΈ.is πŸ”—kun

I dont know where this Stormy Daniels thing is going. But the more I think about it, the more Stormy HAS to be working FOR Trump and playing some role that will ultimately benefit the storm movement

Anonymous ID: a756c8 May 3, 2018, 8:17 a.m. No.1285896   πŸ—„οΈ.is πŸ”—kun

>>1285882

Day shift and Friday nights …last night was a nightmare during drops …anons arguing it’s not a reefer when it obviously is …fine if ya don’t know but correcting the educated then saying β€œwell I drive a forklift” was just ugly last night

Anonymous ID: 992ef1 May 3, 2018, 8:17 a.m. No.1285899   πŸ—„οΈ.is πŸ”—kun   >>5906

MARKERS

 

Ok you fuck faces, here's the dealio

 

Q/Tweet Markers are not the only markers. That's a variety of them. Not sure what those ones are for, but those ones are number markers.

 

But there's many markers. For example, Q says Biden/Chine is an important marker.

 

Also, this fag here:

 

>>1282709

 

Has got the right zeal, but you can't count a rt as a marker too! WTF

 

So here's my theory.

 

Find markers that match each other, then check the timestamp of those two or three.

 

I'm not entirely sure if [marker] is a marker itself, but trying to hint that there's a marker inside the current crumb.

Anonymous ID: 777edd May 3, 2018, 8:18 a.m. No.1285904   πŸ—„οΈ.is πŸ”—kun

>>1285843

 

Curious thing is:

 

All nine crew members were Puerto Ricans who had helped with hurricane recovery efforts as part of the 198th Fighter Squadron, nicknamed the Bucaneros, which flies out of Base Muniz in the northern coastal city of Carolina.

 

http:// www.dailymail.co.uk/news/article-5686877/Doomed-military-cargo-plane-FINAL-FLIGHT-60-YEARS-service.html

Anonymous ID: c19122 May 3, 2018, 8:18 a.m. No.1285905   πŸ—„οΈ.is πŸ”—kun   >>5915 >>5919 >>5927 >>5953 >>5959 >>5971 >>5976

ANONS! Another anon above pbserved that Q posted about "Find the Roll"

 

>>279968

Find the roll.

1 of 4.

Find the 4th.

Find the film.

Not the capture.

Enhance.

Spread.

Will go viral.

Source _ archive offline.

Raw only.

Q

 

Here's what we know:

  • The images are screenshots from Q's iphone, not taken by the camera ("Find the film, not the capture")

  • The number 4 always appears in the file names as the 15th digit ("4th")

 

Is Q trying to tell us to FIND the source film from which he took these screenshots? Something in that film is important to archive and spread.

 

FIND IT ANONS!!!

Anonymous ID: 5479dd May 3, 2018, 8:19 a.m. No.1285908   πŸ—„οΈ.is πŸ”—kun   >>5912 >>5914 >>5973

>>1285837

example

LPFUDZUTUCVLMVMFCSTUDXURBMZAICMJWUXFCNLYOWZLSGSSWDQLWDEBWCSIXBHPMLLKABISBZCCYUEMXWVUMMSOGRCSASGEAISVYOHRZKBSAKOSDHRCJQCWPSISGGFTSMENJJGYDYIVQMGRWOKSARMCEGZJPPCUCMOJVBNAMNOLONXTHKXWEGEZHYBSNQNENRSEOXGVJWFJWVIPBVIKKZLZBESPBEJQAKSHOMHLKFDYMEYUGMHULHEBMGOFDPKBAZBSGGXQKYWARSDMSGXHDHSURWSAMSZO

 

VAU - S-E V-N

 

BJVQLSWFDQFVXOPJSRIXSNKCWCBKFJEFOVBNRAOTDLUIORBPINJQNKUYFQYRLXXIHRCFDCJIDWLWWKFWFIYABWAJAOYLLIOWFBIANRZNBHFEVXAGSSXPTEHTWIZROCESJTCPCDAGGSBQCWFLDWWZIYNHMNYQKYBRTZUHIMRFHJDGGYQQOTUBPUYREPNXEAHHRHANRECYZSHIBQFTSALBOWVVLGHUHGUMNSLRUKKJUWFTXWANDFQNXCQZNUUCOVYGVWDJJJMRLMIVOPCPONPMEWTKQMUEBJUR

??????? Doesn't look right at all. Should be something different?

 

↑↓ ↑↓ ↑↓

W 17Γ— 5.9%

F 15Γ— 5.21%

N 15Γ— 5.21%

R 15Γ— 5.21%

I 13Γ— 4.51%

U 13Γ— 4.51%

B 13Γ— 4.51%

J 13Γ— 4.51%

H 12Γ— 4.17%

Q 12Γ— 4.17%

C 12Γ— 4.17%

O 12Γ— 4.17%

Y 11Γ— 3.82%

L 11Γ— 3.82%

A 11Γ— 3.82%

S 10Γ— 3.47%

V 9Γ— 3.13%

X 9Γ— 3.13%

D 9Γ— 3.13%

T 9Γ— 3.13%

E 9Γ— 3.13%

P 9Γ— 3.13%

G 8Γ— 2.78%

K 8Γ— 2.78%

M 7Γ— 2.43%

Z 6Γ— 2.08%

#N : 26 Ξ£ = 288.00 Ξ£ = 100.03

 

ZZQ - Z-N A-C

 

ZHOANEYWAPHACPFWEGCARYCVZRNMOTVKVTUTMIMIZSRYRZWWTHUAUAIFDVWLADJFBAQIQOSPEDSNSTUIFTMCEXNVSXGMSDUUUOXOFRSNXOFACRMIUVCEXYZQCBNJEDBIIQMOXMVVNFDBXDBHKVNMMLQYRWWRYNMOGDUIMDYCKBFKAXNNQQMRQZZBASODHBOUHBKNKZQTALNUBHRRVQZMQQDANRVQGRKXQTEBFGLVBWHWCHQDILWNKVIYGCRCKLMXOYQUXDWJCKHWQNZNZXHAYWVRUNPLWFQE

 

Look like garabage? WTF

 

↑↓ ↑↓ ↑↓

N 18Γ— 6.25%

Q 18Γ— 6.25%

M 15Γ— 5.21%

R 15Γ— 5.21%

A 14Γ— 4.86%

V 14Γ— 4.86%

W 14Γ— 4.86%

U 13Γ— 4.51%

D 13Γ— 4.51%

B 12Γ— 4.17%

C 12Γ— 4.17%

X 12Γ— 4.17%

I 11Γ— 3.82%

H 11Γ— 3.82%

O 11Γ— 3.82%

Z 11Γ— 3.82%

Y 10Γ— 3.47%

F 10Γ— 3.47%

K 10Γ— 3.47%

E 8Γ— 2.78%

S 8Γ— 2.78%

T 8Γ— 2.78%

L 7Γ— 2.43%

G 6Γ— 2.08%

P 4Γ— 1.39%

J 3Γ— 1.04%

#N : 26 Ξ£ = 288.00 Ξ£ = 100.00

Well that didn't work for shit. Back to the drawing board. We need the Right Rotors and Plug board for this B…….

Anonymous ID: 5479dd May 3, 2018, 8:19 a.m. No.1285914   πŸ—„οΈ.is πŸ”—kun   >>5918 >>5988

>>1285908

OPERATIO DEFCON This seems off? Shouldn't it be OPERATION? That could be a clue. Looks like there is only one N? Maybe we got a keys right here? We need 3 rotors and the plug board. I think they normally have 2 sets? but there could be more?

 

OPE ← Rotors?

RATIO ←? Plug board? I guess we would have to match them up? R-A T-I

 

OPE Engima

 

IRBGJIGNIHIGIRIDKIKFTFIVRFRSTNGGIIRPWRGGIRRGIRIFIJGIIKSRIVRKIRIIIRFRSRTIRFQPIRTIRFRGRFIGIJSRURILSUFGIRGMIRIFJIIFJIOEIIVRIRNGIINLIRXGIIIGHFTIIRIPIRIFNAFQJFRGIIVGUIRRIRGBIIIIIRIRIIRFCISFIIIRIRGZIAGRIRIIIIUGIRTIRFKGRFRGIORFINRGSIRRIRGGIDLRIFIIIRFFIIUGIRGBYIRFNRFRIRIGIIIPJIRGIRRFHIRRGRGHRFFI

 

↑↓ ↑↓ ↑↓

I 94Γ— 32.64%

R 63Γ— 21.88%

G 33Γ— 11.46%

F 28Γ— 9.72%

N 7Γ— 2.43%

S 7Γ— 2.43%

J 7Γ— 2.43%

T 6Γ— 2.08%

K 5Γ— 1.74%

U 5Γ— 1.74%

H 4Γ— 1.39%

P 4Γ— 1.39%

V 4Γ— 1.39%

L 3Γ— 1.04%

B 3Γ— 1.04%

A 2Γ— 0.69%

O 2Γ— 0.69%

Q 2Γ— 0.69%

D 2Γ— 0.69%

C 1Γ— 0.35%

Y 1Γ— 0.35%

Z 1Γ— 0.35%

X 1Γ— 0.35%

W 1Γ— 0.35%

E 1Γ— 0.35%

M 1Γ— 0.35%

#N : 26 Ξ£ = 288.00 Ξ£ = 100.01

 

Seems like we are getting somewhere here. Notice that now we have 4 letters with really high frequency? Gotta mean we are geting close to something and it also means that this could be DNA since there is a high concentration of 4 letter.

 

OPE R-A T-I (0)

 

TABGJTGGTHTGTATDKTAFIFTTAFAGTNGGTTAPWAGGTAAGTATFTJGTTKSATVAFTATTTAFATATTAFQPTAITAFAGAFTGTTSATATLTAFGTAGGTATFTTTFJTTETTVATAGGTTNFTAXGTTTGHFTTTATFTATFTAFQJFAGTTVGUTAATAGGTTTTTATFTTAFCTSFTTTATAGZTAGATATTTTUGTATTAFAGAFAGTOAFTNAGTTAATAGGTDLATFTTTAFFTTUGTAGBYTAFTAFATATGTTTFTTAGTAAFHTAATAGTAFFT

 

↑↓ ↑↓ ↑↓

T 111Γ— 38.54%

A 67Γ— 23.26%

G 37Γ— 12.85%

F 33Γ— 11.46%

J 4Γ— 1.39%

V 3Γ— 1.04%

N 3Γ— 1.04%

H 3Γ— 1.04%

U 3Γ— 1.04%

S 3Γ— 1.04%

L 2Γ— 0.69%

Q 2Γ— 0.69%

P 2Γ— 0.69%

B 2Γ— 0.69%

K 2Γ— 0.69%

D 2Γ— 0.69%

I 2Γ— 0.69%

O 1Γ— 0.35%

Y 1Γ— 0.35%

Z 1Γ— 0.35%

X 1Γ— 0.35%

E 1Γ— 0.35%

W 1Γ— 0.35%

C 1Γ— 0.35%

#N : 24 Ξ£ = 288.00 Ξ£ = 99.980

 

Well shit we are getting closer! We have a bunch of T's, A's, and G's so we are on the right track it seems. Maybe we nee another part to the plugboard?

Anonymous ID: bfad46 May 3, 2018, 8:19 a.m. No.1285917   πŸ—„οΈ.is πŸ”—kun

(Ret.) General McChrystal is on the board of directors for JetBlue.

 

http:// blueir.investproductions.com/investor-relations/corporate-governance/board-of-directors

Anonymous ID: 5479dd May 3, 2018, 8:19 a.m. No.1285918   πŸ—„οΈ.is πŸ”—kun   >>5923

>>1285914

OPE R-A T-I O-D ← 3 on the plug?

 

TABGITGGTHTGTATOKTAFUFTTAFAGTNGGTTAPWAGGKAAGTATFTLGTTASATVAFTATTTAFATATTAFQPTAITAFAGAFTFTTSATATLTAFGTYGGTATFTTQFQTTETTVATAGGTTNFTAXGTTTGSFTTTATFTGTFTAFQJFAGTTVGUTTATAGGTTKTQATFTTAFCTSFTTTATAGZTAGASATTTTUGTATTAFAGAFAGTDAFTNAGTTAAWAGGTOZATFTTTAFFTTUGTAABATAFTAFATATGTTTFTTHGTAAFWTAATAGTAFFC

 

↑↓ ↑↓ ↑↓

T 105Γ— 36.46%

A 66Γ— 22.92%

G 36Γ— 12.5%

F 34Γ— 11.81%

Q 5Γ— 1.74%

S 5Γ— 1.74%

U 4Γ— 1.39%

W 3Γ— 1.04%

N 3Γ— 1.04%

V 3Γ— 1.04%

K 3Γ— 1.04%

Z 2Γ— 0.69%

C 2Γ— 0.69%

P 2Γ— 0.69%

B 2Γ— 0.69%

L 2Γ— 0.69%

H 2Γ— 0.69%

O 2Γ— 0.69%

I 2Γ— 0.69%

D 1Γ— 0.35%

E 1Γ— 0.35%

Y 1Γ— 0.35%

X 1Γ— 0.35%

J 1Γ— 0.35%

#N : 24 Ξ£ = 288.00 Ξ£ = 99.990

 

Same Bullshit, like it seems the F is an outlayer?

 

OPE R-A T-I O-D E-F ← Holy shit 4 plug's?

Anonymous ID: 51783e May 3, 2018, 8:20 a.m. No.1285920   πŸ—„οΈ.is πŸ”—kun

>>1285868

I see the same standing water in both pics. 99% sure it's San Jose. 30 min from Apple HQ.

 

Q's pic posts are usually to confirm their ties to the president and POTUS had hos China/trade tweet late last night when Q was here. Not sure we are meant to be chasing planes, I think it is another conf of Q.

Anonymous ID: e02a8a May 3, 2018, 8:20 a.m. No.1285922   πŸ—„οΈ.is πŸ”—kun

>>1285866

 

If the plane was squawking then it can be identified by going through the flight history data that the planefags are always showing us. Just have to find that jetBlue plane taking off at SJC on May 2 at the same time.

Anonymous ID: 5479dd May 3, 2018, 8:20 a.m. No.1285923   πŸ—„οΈ.is πŸ”—kun   >>5928 >>5985

>>1285918

TAKGITGGTHTGTATHKTAEUETTAEAGTNGGTTAYWAGGKAAGTATETLGTTAHATVAETATTTAEATATTAEQPTAXTAEAGAETETTSATATMTAEGTYGGTATETTQEQTTFTTVATAGGTTUETAUGTTTGSETTTATETGTETAEQGEAGTTVGUTTATAGGTTKTQATETTAEVTKETTTATAGOTAGOSATTTTOGTATTAEAGAEAGTJAETKAGTTAAWAGGTQZATFTTTAEETTKGTAAOATAETAEATATGTTTETTHGTAAEWTAATAGTAEEC

 

Same shit? hmmm That kinda Messed it up? The O and the D don't seem to be doing it right.

 

OPE R-A T-I D-E F-C

 

TAGGTTGGTTTGTATTTTACACTTACAGTTGGTTAATAGGTAAGTATCTTGTTTTATTACTATTTACATATTACAGTATTACAGACTGTTTATATTTACGTAGGTATCTTTCTTTTTTTATAGGTTACTAGGTTTGACTTTATCTATCTACTACAGTTGGTTAATAGGTTTTTATCTTACTTTCTTTATAGCTAGCTATTTTGGTATTACAGACAGTTACTTAGTTAATAGGTAGATATTTACCTTTGTAGGTTACTACATATGTTTCTTTGTAACTTAATAGTACCT

 

↑↓ ↑↓ ↑↓

T 137Γ—47.57%

A 73Γ— 25.35%

G 44Γ— 15.28%

C 34Γ— 11.81%

 

We got it! Look at all that A T G C peoples. Ok, then we probably gotta decode this DNA into binary like before? Fack I don't have my DNAsolver.exe, Wait Nevermind I found it.

https://www.dropbox.com/s/90f580t1gn62jy8/DNA_solver.exe?dl=0

Anonymous ID: 0d0d87 May 3, 2018, 8:20 a.m. No.1285924   πŸ—„οΈ.is πŸ”—kun

New blow for ZTE and Huawei: Devices pulled from military base stores

 

https://www.digitaltrends.com/mobile/senate-intelligence-committee-huawei-zte-news/

Anonymous ID: 5479dd May 3, 2018, 8:20 a.m. No.1285928   πŸ—„οΈ.is πŸ”—kun   >>5932

>>1285923

DNA to BINARY

 

01001010 01011010 01010110 01000101 01010011 00110101 00110010 01011010 01010000 01001010 01000010 01000111 01011001 01010100 01010011 01000101 01001100 01000101 00110010 01000101 00110010 00110110 01010100 01000101 01001110 01001010 01000111 01010111 01010101 01010100 01001010 01010011 01001010 01010110 00110101 01000111 01000111 01001101 00110010 01011010 01010000 01001010 01010101 01000111 01010011 01010111 01010100 01001011 01001011 01000101 01011010 01000101 00110010 00110010 01010011 01010010 01010000 01001010 01001000 01000101 01001111 01010110 01001010 01010011 01001100 01000110 01010111 01010110 01000011 01010000 01001001 00111101

 

010010100101101001010110010001010101001100110101001100100101101001010000010010100100001001000111010110010101010001010011010001010100110001000101001100100100010100110010001101100101010001000101010011100100101001000111010101110101010101010100010010100101001101001010010101100011010101000111010001110100110100110010010110100101000001001010010101010100011101010011010101110101010001001011010010110100010101011010010001010011001000110010010100110101001001010000010010100100100001000101010011110101011001001010010100110100110001000110010101110101011001000011010100000100100100111101

 

BINARY TO BASE64? ←- Malformed input Guess again?

 

JZVES52ZPJBGYTSELE2E26TENJGWUTJSJV5GGM2ZPJUGSWTKKEZE22SRPJHEOVJSLFWVCPI=

 

Let's think here. If the Binary to Base64 is out putting base64 then it usually mean there it another base. Let's Try base32.

 

Binary to Base32

 

010010100101101001010110010001010101001100110101001100100101101001010000010010100100001001000111010110010101010001010011010001010100110001000101001100100100010100110010001101100101010001000101010011100100101001000111010101110101010101010100010010100101001101001010010101100011010101000111010001110100110100110010010110100101000001001010010101010100011101010011010101110101010001001011010010110100010101011010010001010011001000110010010100110101001001010000010010100100100001000101010011110101011001001010010100110100110001000110010101110101011001000011010100000100100100111101

 

IIQAP2L6D9K00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000

Seem Fishy messed up.

Anonymous ID: 5479dd May 3, 2018, 8:21 a.m. No.1285932   πŸ—„οΈ.is πŸ”—kun   >>5939

>>1285928

 

Binary to Base64

 

SlpWRVM1MlpQSkJHWVRTRUxFMkUyNlRFTkpHV1VUSlNKVjVHR00yWlBKVUdTV1RLS0VaRTIyU1JQSkhFT1ZKU0xGV1ZDUEk9

 

Base64 to Base32

 

KNWHAV2SKZGTCTLMOBIVG22KJBLVMUSUKJKXQRSNNNKXSTTMKJDFI23QJBLDCVSVKNWE4S2WNJLEQURQGB4VO3CCJNLFKZCUKYYVETCTGBLGCUSUJF4VKMKKKFJWW2CGKQYVUS2VGB4EOVRRLJCFKRLLHE==

 

base32 to MD5

d41d8cd98f00b204e9800998ecf8427e

 

WTF AM I DOING? No idea schwellington, Didn't that f'n Phone Booth use MD5 hashes? Hmmm making a phone call…… (760) 733-9969….. nothing new it seems. Weird song playing in the background as usual. Sounds like some Mr. Robot type stuff.

 

Let's get this Straight. We Did Enigma to DNA. Then we took the DNA and ran it threw the DNA_solver.exe we where given and it gave us the binary. Now we need to figure out what to do with the binary code. It seems that binary to base64 does not do the trick and output's some funny business. I also tried to go to base32 and it also doesn't seem to be doing any good with an out that looks understandable. Oh dear me what's the problem son.

 

Square One. Binary to Base32 to Base64 to ????

 

01001010 01011010 01010110 01000101 01010011 00110101 00110010 01011010 01010000 01001010 01000010 01000111 01011001 01010100 01010011 01000101 01001100 01000101 00110010 01000101 00110010 00110110 01010100 01000101 01001110 01001010 01000111 01010111 01010101 01010100 01001010 01010011 01001010 01010110 00110101 01000111 01000111 01001101 00110010 01011010 01010000 01001010 01010101 01000111 01010011 01010111 01010100 01001011 01001011 01000101 01011010 01000101 00110010 00110010 01010011 01010010 01010000 01001010 01001000 01000101 01001111 01010110 01001010 01010011 01001100 01000110 01010111 01010110 01000011 01010000 01001001 00111101

Anonymous ID: 5479dd May 3, 2018, 8:22 a.m. No.1285939   πŸ—„οΈ.is πŸ”—kun   >>5940

>>1285932

Seems to do something interesting, well it worked we going with it.

https://emn178.github.io/online-tools/base32_encode.html

 

GAYTAMBRGAYTAIBQGEYDCMJQGEYCAMBRGAYTAMJRGAQDAMJQGAYDCMBREAYDCMBRGAYDCMJAGAYDCMJQGEYDCIBQGAYTCMBQGEYCAMBRGAYTCMBRGAQDAMJQGEYDAMBQEAYDCMBQGEYDCMBAGAYTAMBQGAYTAIBQGEYDAMBRGEYSAMBRGAYTCMBQGEQDAMJQGEYDCMBQEAYDCMBRGAYDCMJAGAYTAMBQGEYDCIBQGEYDAMJRGAYCAMBRGAYDAMJQGEQDAMBRGEYDAMJQEAYDCMBQGAYTAMJAGAYDCMJQGAYTAIBQGAYTCMBRGEYCAMBRGAYTAMJQGAQDAMJQGAYDCMBREAYDCMBQGEYTCMBAGAYTAMBRGAYTAIBQGEYDAMBRGEYSAMBRGAYTAMJRGEQDAMJQGEYDCMBREAYDCMBRGAYTAMBAGAYTAMBRGAYTAIBQGEYDCMBQGEYSAMBRGAYDtCMBRGAQDAMJQGEYDCMJQEAYDAMJRGAYTAMJAGAYTAMBQGEYTCIBQGEYDAMBRGEYSAMBRGAYDCMJQGEQDAMBRGEYDAMJQEAYDCMBRGEYDCMBAGAYTAMJQGAYDAIBQGEYDAMJQGEYCAMBRGAYTAMJQGEQDAMJQGAYDCMJREAYDCMBRGAYDCMJAGAYTAMJQGEYTCIBQGEYDCMBRGAYCAMBRGAYDCMBRGEQDAMJQGAYTAMJREAYDCMBQGAYTAMJAGAYTAMJRGAYTAIBQGEYDAMBRGAYSAMBQGEYTAMBRGAQDAMBRGEYDAMJQEAYDCMBRGAYDCMJAGAYTAMJQGAYTAIBQGEYDCMBQGAYCAMBRGAYDCMBRGAQDAMJQGAYTAMBQEAYDCMBQGAYTAMJAGAYTAMBRGEYTCIBQGEYDCMBRGEYCAMBRGAYDCMBRGAQDAMJQGEYDAMJREAYDCMBQGEYTAMBAGAYTAMBQGEYTAIBQGEYDCMBRGEYSAMBRGAYTAMJRGAQDAMJQGAYDAMJREAYDCMBRGAYDAMBAGAYTAMBRGAYDCIBQGAYTCMJRGAYSA===

 

The some Base32 to Base64 encoding

http://www.motobit.com/util/base64-decoder-encoder.asp

 

R0FZVEFNQlJHQVlUQUlCUUdFWURDTUpRR0VZQ0FNQlJHQVlUQU1KUkdBUURBTUpRR0FZRENNQlJF

QVlEQ01CUkdBWURDTUpBR0FZRENNSlFHRVlEQ0lCUUdBWVRDTUJRR0VZQ0FNQlJHQVlUQ01CUkdB

UURBTUpRR0VZREFNQlFFQVlEQ01CUUdFWURDTUJBR0FZVEFNQlFHQVlUQUlCUUdFWURBTUJSR0VZ

U0FNQlJHQVlUQ01CUUdFUURBTUpRR0VZRENNQlFFQVlEQ01CUkdBWURDTUpBR0FZVEFNQlFHRVlE

Q0lCUUdFWURBTUpSR0FZQ0FNQlJHQVlEQU1KUUdFUURBTUJSR0VZREFNSlFFQVlEQ01CUUdBWVRB

TUpBR0FZRENNSlFHQVlUQUlCUUdBWVRDTUJSR0VZQ0FNQlJHQVlUQU1KUUdBUURBTUpRR0FZRENN

QlJFQVlEQ01CUUdFWVRDTUJBR0FZVEFNQlJHQVlUQUlCUUdFWURBTUJSR0VZU0FNQlJHQVlUQU1K

UkdFUURBTUpRR0VZRENNQlJFQVlEQ01CUkdBWVRBTUJBR0FZVEFNQlJHQVlUQUlCUUdFWURDTUJR

R0VZU0FNQlJHQVlEdENNQlJHQVFEQU1KUUdFWURDTUpRRUFZREFNSlJHQVlUQU1KQUdBWVRBTUJR

R0VZVENJQlFHRVlEQU1CUkdFWVNBTUJSR0FZRENNSlFHRVFEQU1CUkdFWURBTUpRRUFZRENNQlJH

RVlEQ01CQUdBWVRBTUpRR0FZREFJQlFHRVlEQU1KUUdFWUNBTUJSR0FZVEFNSlFHRVFEQU1KUUdB

WURDTUpSRUFZRENNQlJHQVlEQ01KQUdBWVRBTUpRR0VZVENJQlFHRVlEQ01CUkdBWUNBTUJSR0FZ

RENNQlJHRVFEQU1KUUdBWVRBTUpSRUFZRENNQlFHQVlUQU1KQUdBWVRBTUpSR0FZVEFJQlFHRVlE

QU1CUkdBWVNBTUJRR0VZVEFNQlJHQVFEQU1CUkdFWURBTUpRRUFZRENNQlJHQVlEQ01KQUdBWVRB

TUpRR0FZVEFJQlFHRVlEQ01CUUdBWUNBTUJSR0FZRENNQlJHQVFEQU1KUUdBWVRBTUJRRUFZRENN

QlFHQVlUQU1KQUdBWVRBTUJSR0VZVENJQlFHRVlEQ01CUkdFWUNBTUJSR0FZRENNQlJHQVFEQU1K

UUdFWURBTUpSRUFZRENNQlFHRVlUQU1CQUdBWVRBTUJRR0VZVEFJQlFHRVlEQ01CUkdFWVNBTUJS

R0FZVEFNSlJHQVFEQU1KUUdBWURBTUpSRUFZRENNQlJHQVlEQU1CQUdBWVRBTUJSR0FZRENJQlFH

QVlUQ01KUkdBWVNBPT09

 

OK, well now what? Seems like some weird stuff? kinda looks like a PGP key or a hash or something. Like IDK? MD5? can you go base64 or MD5 and what the hell purpose would that serve us here? No idea.

https://cryptii.com/base64/md5 ← SHWING

 

d41d8cd98f00b204e9800998ecf8427e

 

Yay, we have a Hash……. The F that does do for us? password for something? or some crap? probably these cicada peoples like to do that kinda stuff.

 

I thought about it and it doesn't make sense to go from base32 to base64 since they are the same style of encoding I guess. I noticed that if we add a base32 to Hex, then covert the Hex to Base64 we get a different MD5 hash. It also is interesting be that would have made 7 layers or actions to get to the final hash. No idea what it's for and I'm not sure I have seen this before.

Anonymous ID: 5479dd May 3, 2018, 8:22 a.m. No.1285940   πŸ—„οΈ.is πŸ”—kun   >>5951 >>5956 >>5968 >>5970 >>5978

>>1285939

I thought about it and it doesn't make sense to go from base32 to base64 since they are the same style of encoding I guess. I noticed that if we add a base32 to Hex, then covert the Hex to Base64 we get a different MD5 hash. It also is interesting be that would have made 7 layers or actions to get to the final hash. No idea what it's for and I'm not sure I have seen this before.

 

Enigma

LPFUDZUTUCVLMVMFCSTUDXURBMZAICMJWUXFCNLYOWZLSGSSWDQLWDEBWCSIXBHPMLLKABISBZCCYUEMXWVUMMSOGRCSASGEAISVYOHRZKBSAKOSDHRCJQCWPSISGGFTSMENJJGYDYIVQMGRWOKSARMCEGZJPPCUCMOJVBNAMNOLONXTHKXWEGEZHYBSNQNENRSEOXGVJWFJWVIPBVIKKZLZBESPBEJQAKSHOMHLKFDYMEYUGMHULHEBMGOFDPKBAZBSGGXQKYWARSDMSGXHDHSURWSAMSZO

 

DNA

TAGGTTGGTTTGTATTTTACACTTACAGTTGGTTAATAGGTAAGTATCTTGTTTTATTACTATTTACATATTACAGTATTACAGACTGTTTATATTTACGTAGGTATCTTTCTTTTTTTATAGGTTACTAGGTTTGACTTTATCTATCTACTACAGTTGGTTAATAGGTTTTTATCTTACTTTCTTTATAGCTAGCTATTTTGGTATTACAGACAGTTACTTAGTTAATAGGTAGATATTTACCTTTGTAGGTTACTACATATGTTTCTTTGTAACTTAATAGTACCT

 

BINARY

01001010 01011010 01010110 01000101 01010011 00110101 00110010 01011010 01010000 01001010 01000010 01000111 01011001 01010100 01010011 01000101 01001100 01000101 00110010 01000101 00110010 00110110 01010100 01000101 01001110 01001010 01000111 01010111 01010101 01010100 01001010 01010011 01001010 01010110 00110101 01000111 01000111 01001101 00110010 01011010 01010000 01001010 01010101 01000111 01010011 01010111 01010100 01001011 01001011 01000101 01011010 01000101 00110010 00110010 01010011 01010010 01010000 01001010 01001000 01000101 01001111 01010110 01001010 01010011 01001100 01000110 01010111 01010110 01000011 01010000 01001001 00111101

 

Base32

IIQAP2L6D9IB984KGI7B5A56HAC8KP4ACHMAH2KSII7ATAL8IIJ99B3AHQ79KP5KK2AAL3L6LQK9D5KAMI568P56KIG9944AJQM999KOHINAP1L0I9T

 

HEX

422007E97E1A021E28C8F87A0EF8E01054FE0047600FA54908F826058508487603C3EA7F54AD000BDAFCB8287D50188EF82FEF948373804C18A71D0D03D6B722

 

base64

QiAH6X4aAh4oyPh6DvjgEFT+AEdgD6VJCPgmBYUISHYDw+p/VK0AC9r8uCh9UBiO+C/vlINzgEwYpx0NA9a3Ig==

 

MD5

fc74c3b9b2e74e2c1bd37a2db15e29eb

 

7 layers of Encoding it seems.

Anonymous ID: 4d4f5c May 3, 2018, 8:22 a.m. No.1285948   πŸ—„οΈ.is πŸ”—kun   >>5998

Soooo Rudy said his disclosure was "planned long in advance."

 

Hivemind thinking POTUS wants Stormy in the news a bit longer?

 

Hivemind being smart now thinking Stormy is a LARP?

Anonymous ID: c43e9b May 3, 2018, 8:24 a.m. No.1285961   πŸ—„οΈ.is πŸ”—kun

>>1285232

I look forward to your Sovereign Citizen takedown video. Stop trying to pretend you don't have to obey the law because your autism gives you technically abilities. Lawfags will pwn you every time, 100% of the time because you're WRONG and deluding yourself is just going to get you in trouble. There's a reason that driving is regulatedβ€”it has nothing to do with attempting to restrict your ability to fucking travel you retard.

Anonymous ID: f31949 May 3, 2018, 8:24 a.m. No.1285967   πŸ—„οΈ.is πŸ”—kun   >>5983 >>5997

>>1285841

Here is what I know

 

Q uses [MARKER] in brackets only 3 times, One more and we would have 4 making 4 points of a clock? 3,6,9,12. I'm trying to find a relation to an actual clock as Q says "Think Clock". Also the 3 in brackets, 2 of them have "Left eye" before them.

 

Q also says "wind the clock" which I googled and found that you use a key and rotate it clockwise 16 times. Maybe this is relevant maybe not.

 

Q also posted the following:

The "marker."

Learn to read the map.

News unlocks the map.

 

I believe Q also indicated by reposting someone talking about the deltas in the posts being markers and we all went off on the POTUS tweet and Q posting deltas but I think we need to focus on the timestamps. Re-reading the posts with "marker in them" makes me think we are supposed to focus on the timestamps themselves rather than just the deltas.

Anonymous ID: a87a8c May 3, 2018, 8:25 a.m. No.1285984   πŸ—„οΈ.is πŸ”—kun   >>5999

Isn’t this the worst rock and Roll musician ever?

I really can’t stand him or his politics.

Do us a favor U2 Bono and go away forever.

 

He deserves an β€œF”

 

Don’t you agree?

Anonymous ID: ce820e May 3, 2018, 8:26 a.m. No.1285989   πŸ—„οΈ.is πŸ”—kun

"JARED DISPOSABLE, RUDY SAYS"

 

And Rudy is exactly right. Rudy is incorrect when he states people would riot to protect Ivanka - he is mistaken. Ivanka is just as disposable.

 

When to an internal meeting last night of retired military, mostly fairly recently retired Intel guys, SOF guys, etc. People are PISSED. They have started "ABT" campaign - "Anybody but Trump" - and these people were very, very early on the Trump train and worked hard to "make the impossible possible". One guy brought a $1,500 certified check which he states represents "$10 symbolic donations from 150 people in his small town" to throw into the ABT kitty to generate ground support for a third party protest vote campaign.

 

Lots of heated anger, this are some of the highlights;

 

-Trump got elected in part because of his promise to "make sure our Veterans are taken care of". Veterans are being royally screwed over by this Administration, no different than prior admins. The focus should NOT be just fixing the VA hospital system, but the VA disability rating system - Veterans who are combat injured and the majority are WHITE guys are getting maximum ratings of 30% for serious injuries, including TBI with the long term, lifetime consequences that, while POC with "knee pain" have 60 - 80% disability ratings. The raters are also overwhelmingly POC as well, and it is a very racially biased system - biased AGAINST actual combat veterans and in particular, white guys. I can not over explain the depth of anger on this issue, and the WH is completely tone deaf and ignoring this, and it will cost them.

 

-Veteran hiring. Vets are being offered insultingly low wage jobs in the private sector while any new Fed Civ service jobs that open up are "interviewing" veterans for show, but the jobs all go to internal candidates. In 27 cases given in the slideshow presentation of job placement followup, those internal candidates were initially places as Special appointment by Obama and now have burrowed in. Trump not only refuses to get rid of them, he is refusing to do the same for his supporters. Hand another win over to the Progressives, they have no problem taking care of THEIR supporters while Trump tells his to go pound sand or be grateful for some shitty, low pay work. Trump can go get STUFFED was the consensus.

 

'White is the new Black". It has become very clear that the Trump administration has decided to chase after the black vote at the expense of white men. Apparently he forgot who got him to the finish line. The Trump attitude is that white guys are "locked in", military votes are "locked in" and therefore they can now treat white men and veterans with the same disdain the Dems have shown blacks. Trump campaign team assumes white male veterans are on their plantation and their votes can be taken for granted. BIG MISTAKE.

 

Lots of anger about this black chick nominated to be the "first black female General in the USMC". She is not well regarded by the troops and she was an express affirmative action promotion over better qualified white guys for political points. Again - this speaks to the "white is the new black" where the Trump campaign thinks they have the white male vote locked down and will now pander to get black votes. HUGE MISTAKE.

 

A social media consultant was hired with the initial $7500 put into the kitty, with a bigger rollout and on the ground fundraising campaign planned for May and early June. The ABT will be actively seeking an extreme candidate solely to be a store of protest votes with the goal of being the spoilers in many close districts.

 

Oh …. and many many references to the "Kushner White House" and not in a good way.

 

Such a shame. I know that these guys worked their guts out for Trump and honestly thought things would be different. Nope, same lies, same bullshit, same race pandering, same contempt for hard working white guys who are discriminated against simply for being white because it's important to have the "first ___ "

 

Interesting that Trump pushes the need for an immigration system based in "merit" but not for the military or for the federal civil service. We're back to the same cynical racial spoils system we've had in place since affirmative action took place.

 

Have fun Trump. Enjoy your whispering advice from liddle Jared. Once you've lost good will it's almost impossible to get it back.

 

I'm done here as well. Larp or no larp, it's pretty much impossible to support the Kushner White House any longer. I didn't vote to fight more wars for Israel and I sure didn't vote to have our government run by dual citizen Jews who are playing the same tired anti-White, anti-Veteran BS.

 

t. /out/ pissed off family member of a combat injured, Trump screwed over Veteran. "ABT" indeed. We will NOT be taken for granted.

Anonymous ID: 256a57 May 3, 2018, 8:26 a.m. No.1285996   πŸ—„οΈ.is πŸ”—kun

>>1285724

Captain Green was killed during an attempted extraction of a Rothin the UK.

The county where this took place is abbreviated "BAYS". (bunker, apple, yellow, sky)

This has NOTHING to do with apple company.

CONTEXT!