dChan - Q Origins Project Archive

Stop assuming it's money

Anonymous ID: c1737d May 3, 2018, 6:39 a.m. No.1285216 🗄️.is 🔗kun >>5226

Eipstein insland kiods?????

Can we fight 4 them?

>>1285192

Already added. It'll be in next bread.

Anonymous ID: 7f72b6 May 3, 2018, 6:40 a.m. No.1285218 🗄️.is 🔗kun >>5234

T DOES NOT = TRUMP

https://greenwaypsllc.com/how-much-does-a-pallet-hold/

Don't be afraid to send your sons and daughters to die for your (((greatest ally))) America.

They would do the (((same))) for you…wouldn't they?

100 million each

>>1285181

pic related

"operating a motor vehicle" You can walk anywhere you want. Try that in court and tell us how it goes ;)

So my take on Guiliani last night is basically Trump's using the money to keep things focused on Cohen to drag him as far as possible thru the mud? Looks like it was Cohen that slept with Daniels and both Trump and Daniels have his balls in a vise, because (Just my theory) Cohen tried to extort Trump, so Trump played Cohen like a fool and trapped Daniels in their own lies to torture them both. Soon to be unraveled.

Anonymous ID: 0824eb May 3, 2018, 6:40 a.m. No.1285224 🗄️.is 🔗kun >>5237

How do you know the truck wasn't unloaded and the pic was taken with what was left for the next destination? I worked at UPS as a late teen/early 20's, you'd be surprised how many 53 foot semi's run through a hub with only a third of the trailer filled. Not as uncommon as some might think.

Anonymous ID: d23c39 May 3, 2018, 6:40 a.m. No.1285225 🗄️.is 🔗kun >>5856

>>1285096 (last bread)

This is Def the reason for Q post.

Along with my prior post. Xiaomi!!!!!!

>>1285216

Ya kids packed and shrink wrapped for sure

Anonymous ID: c0d648 May 3, 2018, 6:41 a.m. No.1285227 🗄️.is 🔗kun >>5856

You realize Trump literally tweeted the court case in a nutshell.

He paid that slag 130k in an NDA out of his pocket(absolving him of wrongdoing).
She also signed an agreement stating she did not have a realtionship with him.
She and her lawyer broke the NDA countless times
She and her lawyer also lied and broke the agreement stating she didn't have a relationship.

In other words that slag and her ambulance chaser lawyer are so stupid it's insulting to the term stupid. They are liable for massive damages……….

Anonymous ID: eb0bec May 3, 2018, 6:41 a.m. No.1285228 🗄️.is 🔗kun >>5233

>>1285215

perhaps it's frozen penguin pineal glands

(like the shipment as referenced in WL cablegate drop)

I was able to extract the following snip of data from this image. Interesting date, so not a recent image.

===

IHDR

aiCCPkCGColorSpaceDisplayP3

OGbC

iTXtXML:com.adobe.xmp

<x:xmpmeta xmlns:x="adobe:ns:meta/" x:xmptk="XMP Core 5.4.0">

<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">

<rdf:Description rdf:about=""

xmlns:photoshop="http://ns.adobe.com/photoshop/1.0/"

xmlns:exif="http://ns.adobe.com/exif/1.0/">

<photoshop:DateCreated>2018-05-02T19:51:34</photoshop:DateCreated>

<exif:UserComment>Screenshot</exif:UserComment>

</rdf:Description>

</rdf:RDF>

</x:xmpmeta>

IDATx

==

Thanks, Baker! The heel is the best part.

Anonymous ID: be2352 May 3, 2018, 6:42 a.m. No.1285231 🗄️.is 🔗kun >>5248

Anons, latest shill tactic - morality shills.

Sliding the bread about Trump/Stormy/Melania issues. Propose to engage shields and filter them back to the depths from which they issue.

>>1285222

sheep.

>>1285181 is right.

Driving has a specific meaning in law.

Just cause the 'court' says something does not make it so. You're not really interested in fixing this nation when you take positions like this.

Anonymous ID: 7f72b6 May 3, 2018, 6:42 a.m. No.1285233 🗄️.is 🔗kun >>5561

>>1285228

BWAHAHAHA….Good one!

KEK

>>1285218

Orly?

SMH. Bogus date, everyone will look past it.

interesting that one of the pallets is crushed on top - so not full. also significant that the container itself is not full. apple cooking the books?

Anonymous ID: 6d92f7 May 3, 2018, 6:43 a.m. No.1285237 🗄️.is 🔗kun >>5249

>>1285224

That's ups.

You ship what is sent.

Where talking apple with probably millions ready to buy.

Those pallets would hold what a few thousand I phones.

But those pallets could hold many 100 dollar bills.

Could this be the guy she is referring to?

>>1284975 (Last bread)

Steganography maybe.

Q

Need me?

You know my skills.

Offering.

You know my comms.

No is ok too.

J

>>1284906

Jet Blue and Apple

https://skift.com/2013/12/04/jetblue-takes-a-shortcut-to-add-apple-passbook-capabilities/

JetBlue is one of the first airlines to go live with Apple Passbook using the SITA API. Malaysia Airlines is also using it as are other airlines that SITA declined to identify.

(Interesting mention of Malaysia Airlines while declining mention of others)

Side note Don't remember hearing this

http://abc11.com/travel/jetblue-flight-from-boston-makes-emergency-landing-at-rdu-/3266371/

https://www.theatlantic.com/technology/archive/2014/03/todays-malaysia-airlines-370-news-what-it-means-that-the-plane-apparently-kept-flying/284414/

Posted for description of a/c comms.If speculation was correct that MH370 was compd then compd again, a backup hack to the qrs11 in a cellphone just in case...

https://

www.telesurtv.net/english/news/US-Troops-Enters-Argentina-for-Military-Exercises-Without-Congressional-Approval-20180502-0005.html

The magnetic force in this post is strong.

Pallet is not crushed, it has a blanket over it. Further Enhance image, becomes clear. Beggs the question, was the blanket covering all? Pulled back for the Photo?

>>1285223

>>1285200

No one here is saying TRUMP cheated on his wife. The payment Trump made to Cohen, could just have been for expenses … which is what has been said all along and of which Trump did not know the details of. Hey boss I have about 130,000 worth of expenses this month I am going to need you reimburse me for that I need to take care of this month… is all Cohen has to say.

year/month/day

>>1285231

add to the list:

c130 was decoy/not real/no lives/

c130 contained the 3 pallets from Q pic

Anonymous ID: b0a429 May 3, 2018, 6:44 a.m. No.1285249 🗄️.is 🔗kun >>5445

>>1285237

Route truck making multiple stops from a distribution center. They start full, and end empty.

Anonymous ID: d772c5 May 3, 2018, 6:45 a.m. No.1285250 🗄️.is 🔗kun >>5367

It would not be absurd that Drudge is playing a role.

However, look what w3.org is 'About'

ABOUT W3C

The World Wide Web Consortium (W3C) is an international community where Member organizations, a full-time staff, and the public work together to develop Web standards.

Led by Web inventor and Director Tim Berners-Lee and CEO Jeffrey Jaffe, W3C's mission is to lead the Web to its full potential. Contact W3C for more information.

—-

Combine that with Apple + JetBlue = Net Neutrality and Clowns Wi-Fi via Satellites

https:// appleinsider.com/articles/17/01/11/jetblue-completes-fleet-wide-rollout-of-high-speed-fly-fi

comfy

Thank you, Baker!

Anonymous ID: d77b07 May 3, 2018, 6:45 a.m. No.1285253 🗄️.is 🔗kun >>5267

>>1285232

yes, "driving" implies a commercial pursuit, which is why they call it "operating a motor vehicle"

Lawfag (me). This has been attempted about 1000 times and has worked 0 times. You can appeal and appeal, but even at the federal SC you LOSE. We need think anons here, not retard dufus anons. File you with flat-earthers

Anonymous ID: 56a8a7 May 3, 2018, 6:45 a.m. No.1285254 🗄️.is 🔗kun >>5552

Just woke up so not sure if it was posted overnight, but the picture of the Apple store had to be taken from this walkway because its obviously above ground level and from that position, makes perfect sense. That walkway runs into a building on one end, and on the other end runs only to a few piers.

>>1285141 (last)

>Thanks, not ~~Think~~ (but think too)

>>1284656 >“ambitious television news series” JV w/

<Red Arrow subsid. "Left/Right Tv" +

>NY Times Co. keynote interview :: CEO Mark Thompson (pictured)

>http://realscreen.com/2017/12/01/wcsfp-17-nyts-mark-thompson-on-politics-platforms-and-proper-journalism/

During the keynote interview, the former chief executive of Channel 4 and director-general of the BBC tackled questions on Trump (who, for the record, has a “perfectly normal handshake”),

the impact of the growing FAANG empire on the global mainstream media (“The fate of all of us is likely to be determined by the major digital platforms,” he maintained),

attacks on the free press from both ends of the political spectrum,

Its digital product has seen subscriptions increase, and Thompson is looking at a move to TV for the brand.

Here's a CBS news report on the building of the new Apple HQ. It is strange they talk about pizza in it. Are they messaging to customers?

https://www.cbsnews.com/video/apples-massive-glitzy-new-headquarters/

Anonymous ID: 777edd May 3, 2018, 6:46 a.m. No.1285257 🗄️.is 🔗kun >>5343

>>1285245

Totally agree. It was not stated for sure that POTUS did anything with Stormy. Look at his tweets this morning. Pretty clear, I think.

TIM COCK IS A FAGGOT WITH AIDS THAT MAKES SHITTY SOFTWARE

screaming + no markers = man down.

b/c MOS (= mobile operating system) SEC (security) is bunk.

f.h.p.p needs to learn how to OC it's own MOS_SEC.

tim, are you woke?

you get phones from foxconn.

you have more than you know.

do you need help making new chips?

we'll fix taxes a little to bring manufacturing in house.

That's not how the w3 header works , non-tech fag.

>>1285252

kek

Anonymous ID: ee7c64 May 3, 2018, 6:47 a.m. No.1285262 🗄️.is 🔗kun >>5264

>>1285238

A related side note, John Kerry ended up marrying Theresa Heinz after the death of John Heinz…..

>>1285252

Hahaha! Noice!

>>1285262

I aint sayin he's a gold digger…

>>1285240

meet me at your mamas house in 2 hrs…wait there until further notified…do not pass go…do not collect $200

Ok guys, look.

Its NOT a blaket and its NOT crushed.

You r seeing the refer unit.

And the pallets have to be shorter to fit under the refer unit.

>>1285253

I never said it would work. It is exactly the same thing as trying to convict the queen of a crime in her court. it won't ever work. The court does not follow the written law. I agree it won't work. It's like trying to start a gasoline engine when the there isn't any piston in it. You have to shit can the entire thing and replace it with something that is not corrupt. The court is a huge part of the problem.

UCC

Commerce Clause corruption and meaning stretching.

It's all rotten.

>>1285222

>>1285264

Kek

Anonymous ID: 4afc22 May 3, 2018, 6:48 a.m. No.1285270 🗄️.is 🔗kun >>5317

Just an FYI if someone wants to dig further

ZTE can no longer use Qualcomm chips

Leads me to believe they were the ones who reverse engineered a backdoor into the phone chipsets for the Chinese Government. This would also explain the merger being halted between Qualcomm and Broadcom.

Anonymous ID: 7b42bc May 3, 2018, 6:48 a.m. No.1285271 🗄️.is 🔗kun >>5414

>>1285258

notable post?

>>1285245

>No one here is saying TRUMP cheated on his wife

Right. I'm not either.

>could just have been for expenses

Possibly, but why drag out something for simple expenditures?

Trump has a plan in place for Cohen and Daniels. Trump Curse, after all.

>>1285264

But he ain't messing with no broke?

>>1285223

Laser pointer for rabid kitties

>works every time

CASE #1: “The use of the highway for the purpose of travel and transportation is not a mere privilege, but a common fundamental right of which the public and individuals cannot rightfully be deprived.” Chicago Motor Coach v. Chicago, 169 NE 221.

Anonymous ID: d921a4 May 3, 2018, 6:49 a.m. No.1285278 🗄️.is 🔗kun >>5336

>>1285134

Baker, please see from last bread. Thx.

>>1284492

BAKER ———– BREAD EDIT NEEDED

>>1284186 Sir Jonathan Paul Ive,Chief design officer (CDO) of Apple Inc. DIGz

The current link is incorrect to this post.

Anonymous ID: 074f90 May 3, 2018, 6:49 a.m. No.1285280 🗄️.is 🔗kun >>5308

What is Rosenstein and Mueller doing. Trying to bankrupt anyone who knows President Trump or worked for him. How many of these guys has Mueller and Rosenstein been doing this too over the past year and half?

http:// dailycaller.com/2018/05/02/michael-caputo-senate-intelligence/

‘God Damn You To Hell’: Ex-Trump Aide Blows Up During Senate Interview

“Today, I can’t possibly pay the attendant legal costs and live near my aging father, raising my kids where I grew up,” Caputo said during his three-hour interview. “Your investigation and others into the allegations of Trump campaign collusion with Russia are costing my family a great deal of money — more than $125,000 — and making a visceral impact on my children.”

“Forget about all the death threats against my family. I want to know who cost us so much money, who crushed our kids, who forced us out of our home, all because you lost an election,” he added. “I want to know because God damn you to hell.”

Anonymous ID: b06664 May 3, 2018, 6:49 a.m. No.1285281 🗄️.is 🔗kun >>5286

quit shitposting

CASE #2: “The right of the citizen to travel upon the public highways and to transport his property thereon, either by carriage or by automobile, is not a mere privilege which a city may prohibit or permit at will, but a common law right which he has under the right to life, liberty, and the pursuit of happiness.” Thompson v. Smith, 154 SE 579.

Anonymous ID: e707a8 May 3, 2018, 6:50 a.m. No.1285283 🗄️.is 🔗kun >>5306

CASE #3: “The right to travel is a part of the liberty of which the citizen cannot be deprived without due process of law under the Fifth Amendment.” Kent v. Dulles, 357 US 116, 125.

Anonymous ID: e707a8 May 3, 2018, 6:50 a.m. No.1285284 🗄️.is 🔗kun >>5306

CASE #4: “The right to travel is a well-established common right that does not owe its existence to the federal government. It is recognized by the courts as a natural right.” Schactman v. Dulles 96 App DC 287, 225 F2d 938, at 941.

ANYTHING ABOUT STORMY CASE is a shill slide tactic

Do not engage

>>1285281

Apple would ship to distribution center with a full tractor trailer and than ups would ship on ups truck.

This is a tractor trailer.

It would not only have three pallets.

Unless the picture was taken during unload stage. And if that's the case where's the spotter/pallet jack guy. He's always waiting for extended boom or fork lift to come back.

>>1285282

which doesn't apply to US Citizens cause US Citizens are collateral to the US Corp for its debt.

The court knows this but wont tell you. Common law does not apply in a UCC corporate court.

That's called sauce! look shit up shill. fuck off

>>1284475

Posing as 'muslim'.

Just like the Mossad false flaggers alway do…

>>1285241

Is this "the beginning of the (((chip))). The phone that knows the user and is 100% accurate as far as identification purposes? Would eliminate the need for passports, then drivers license, everything.

The Mark of the Beast technology…..

Anonymous ID: 2bb43d May 3, 2018, 6:51 a.m. No.1285293 🗄️.is 🔗kun >>5444

Former highest German State Attorney (Generalbundesanwalt) Harald Range - who did not investigate the German Pedogate known as "Sachsensumpf", downsized the "investigation" into NSA spying in Germany and mislead the complete hoax of the official story regarding the "NSU" terrorist cell (who is basically a story told by the secret agencies to subsummize several murder and crime done by state or allied forces under the cover of shot do death neonazis) breaks down dead in a cafe.

https:// www.tagesschau.de/inland/range-nachruf-101.html

It is the insides of a smooth walled refrigerator truck. The packages on the top are arranged in order to not block the cooling fans. Its meat folks….human meat.

>>1280616

>>1280036

Trump’s China ‘hawks’ Robert LIGHThizer, Peter Navarro, and Wilbur Ross on that flight?

Fags state Q was not on the plane but could someone on this trade team be on the Q team?

https:// www.macrumors.com/2012/07/04/apples-retail-push-into-china-still-limited-but-ramping-up/

http:// www.businessinsider.com/trump-trade-team-china-hawks-2017-1

>>1285241

we need a meme showing passengers flying jet blue forced to watch apple tv with CNN playing on a loop.

Roll? Should be spelled ROLE in this instance

Why the typo?

maybe they were unloading

and this is a message that we intercepted

their vile cargo

>>1285178

Its a mind virus.

Use typos to indicate key

Key is 'L'

What is code?

Anonymous ID: 4afc22 May 3, 2018, 6:52 a.m. No.1285301 🗄️.is 🔗kun >>5311

Anons, why is the container or pallets so important?

Kinda seems like a useless venture or a shill tactic to keep the board distracted.

>>1285298

LTL trucking.

Happens every day.

True dat

HDR as in High Dynamic Range?

Anonymous ID: d77b07 May 3, 2018, 6:53 a.m. No.1285306 🗄️.is 🔗kun >>5314

citing 1800's court cases proves nothing, at the same time a murder could be justified by saying "he needed killing!" Someone might get arrested and jailed over your retard comments anon, so stop and lurk moar

Anonymous ID: ff3c93 May 3, 2018, 6:53 a.m. No.1285307 🗄️.is 🔗kun >>5438

Not sure if you Anons have seen this….I'm still eating breads to catch up.

This is floating around on Twitter…looks like a messsage between Stormy D & someone where she is denying she slept with Trump.

Like I said, it is floating on Twitter so it might be fake or it might not be.

>>1285280

Meant to say Senate Select Committee. Not discuss RR and Mueller…But heck you can blame them too. We wouldn't have this committee if they had been doing their job correctly.

Quote of the day:

"Is Q an Ai? I heard that Cicada is an internet company…"

Any chance that would be mossad docs taken from Iran? Just throwing it out there to consider…

$130,000 seems to be getting thrown around a lot lately also…

>>1285301

Clowns downed C-130 to destroy something

Q posts picture of pallets

Clowns missed

Package secured

"Watch The Water" https ://www.militarytimes.com/news/your-military/2018/04/26/dod-126-bases-report-water-contaminants-harmful-to-infant-development-tied-to-cancers/

https ://www.military.com/daily-news/2017/04/25/nearly-400-military-bases-must-be-tested-water-contamination.html

>>1285298

If their unloading where the driver with his pallet jack.

He wouldn't unload. He would wait with pallets for fork lift to return.

>>1285306

Sheep.

Must live in the UK and think that fella that flipped of the traffic cam deserved the state pitching him in the clink for 8 months is a great thing.

>>1284666

>>1284708

New Zealanders are good, hard-working people with a generous heart, and willing to hep those in need.

But, here she comes again, and she wants more of your money.

Read The Clinton Foundation and Haiti.

HRC will put on a lot of makeup and a big smile to hide what is really in her heart, which many claims she does not have, and it's not for good for mankind.

was this pointed out yet?

>>1285270

The flaws affect Qualcomm chip software drivers installed at the point of manufacture, meaning updates must be pushed from the hardware company to phone vendors before it can flow to users.

Anonymous ID: 19f1ff May 3, 2018, 6:55 a.m. No.1285318 🗄️.is 🔗kun >>5346

>>1284590 LB

HAHA always a shill if we just admit that it is really confusing ..I mean holy shit how is it NOT confusing? By definition they are cryptic messages that are only a small % of hints and some are literally disinfo that we don't know which ones are….come on fag play chess that makes it clear instantly

Ooops!

Corsi gets it wrong again.

Super Sensory Perception

>>1285276

>cannot rightfully be deprived…

…without due process

you are on to something here Brother. RE LOOK at past breads: https://8ch.net/qresearch/res/894238.html#894401

>>1285215

stop əˈkyooziNG anons of assuming

(you) are assuming others of assuming

Those pallets would not be able to lift that much cash…..Too Heavy. Also, other than a cool reference to cold hard cash, why would they ship cash in a refer? Let alone 3 pallets in a trailer that holds 18 pallets.

3:46 AM - 3 May 2018

8 min delta

3:54 AM - 3 May 2018

6 min delta

4:00 AM - 3 May 2018

ROLL vs. Role mispelling…

Possible getting ready to roll (86) this mf

>>1285019

Never.

Anonymous ID: 44d628 May 3, 2018, 6:56 a.m. No.1285328 🗄️.is 🔗kun >>5376

>>1280772

Cambridge Analytical servers?

The company went belly up yesterday.

wew

Anonymous ID: 7c504d May 3, 2018, 6:56 a.m. No.1285331 🗄️.is 🔗kun >>5394

>>1285258

technology is now truly our enemy…you cant escape it

It doesn't look like cash to me. Those are individual cases stacked and wrapped in plastic sheets…taped.

I think this may have to do with computer chips, maybe for planes but because it's going to china where the slave like phone factories are. Maybe they implemented a change.

>>1285326

Meaning

According to Merriam-Webster's Dictionary, "86" is a slang term that is used in the American popular culture as a transitive verb to mean throw out or get rid of, particularly in the food service industry as a term to describe an item no longer available on the menu, or to refuse service to a customer.[1] The Merriam Webster dictionary suggests the term may be associated with the word "nix" ("no" or a more general prohibition).[1]

Dump the container and pallets and I think you are on to something.

$130,000 is an interesting number to come up multiple times.

Veolia French water company

Anonymous ID: aee2d4 May 3, 2018, 6:57 a.m. No.1285336 🗄️.is 🔗kun >>5416

>>1285278

GOT IT

Those are cases of MAGA hats

to roll someone is to rob or to scam them

Capped this from last night for anybody who wants it.

What an asshole he is. Shows he really isn't trying to help Flynn, imho.

Anonymous ID: 19f1ff May 3, 2018, 6:58 a.m. No.1285341 🗄️.is 🔗kun >>5614

His son really wrote that? Haha shit Corsi , and Ive been kinda backing him up a little but lately I gotta be honest is living up to the criticism eek

Would poisoning the militaries water be classified as an act of war?

>>1285257

Trump hired Emmet Flood for a reason. Is he getting ready Dem's attempt to impeach Trump? It seems to circle around that whore.

>>1284612 (pb)

Not sure if related but here's some interesting information if anyone wants to dig about Sandia in Bay Area and New Mexico RE Nuclear, underground circular structure:

A Brief History of Sandia National Laboratories and the

Department of Energy’s Office of Science:

Interplay between Science, Technology,and Mission

http://prod.sandia.gov/techlib/access-control.cgi/2011/115462.pdf

—————————————————

ALSO, found this:

Organizations »

Q-DO

Weapon Stockpile Modernization

Ensuring tomorrow’s U.S. nuclear deterrent through stockpile life extensions, while maintaining and advancing knowledge and capabilities

The Weapon Stockpile Modernization (Q) Division provides the system engineering, program management, component technology development, and system and sub-system testing necessary to field modernizations authorized to extend the life of Los Alamos National Laboratory-designed weapons in the active United States nuclear stockpile

http://www.lanl.gov/org/padwp/adw/weapon-stockpile-modernization/index.php

role

as a role in a movie.

Anonymous ID: 33e74d May 3, 2018, 6:58 a.m. No.1285346 🗄️.is 🔗kun >>5378

>>1285318

Play chess, play football, box, play baseball, doesn't matter.

The question is, do you intend to win or lose the match?

You're chess strategy looks like you're throwing the game. On purpose? Do you know? Do they know? Does anyone care? Does anyone wear underwear?

Heh, fuck it. At some point the law of diminishing returns kicks in. Cloak and dagger shit can only be taken so far before it all becomes the joke that it is.

Disregard Flynn Jr.

Make sure you donate. Patriots stick together.

Also, pick up my book "Killing the Deepstate."

Anonymous ID: d630b6 May 3, 2018, 6:59 a.m. No.1285348 🗄️.is 🔗kun >>5384

Pizza ingredients?

Anonymous ID: be2352 May 3, 2018, 6:59 a.m. No.1285350 🗄️.is 🔗kun >>5361

>>1285245

I was responding to a morality fag. I don't know if Trump cheated or not. Wouldn't be surprised, because of past history. But frankly, don't care. Not my business, it's between Melania and him (and God, if you want to go there).

What I do care about is whether Trump knowingly broke any laws in what his lawyer did on his behalf, and my opinion is he didn't.

The takeaway from Rudy should be that. He didn't break any laws, and he didn't use campaign or government money to pay off anyone. UNLIKE almost all the diddling senators and representatives, I might add, who diverted campaign funds or used the government coffers for the payoffs.

Kek

military base drinking water has been shit for decades, Lejeune has had ongoing problems forever. Why not poison the military that are being used as puppets asked the CFR as directed by Bilderberg!

Is qanon.pub anon lurking?

-Printed Crumbs

-Cut them out->sorted by timestamps[HH:MM:SS]->taped together

I am looking at big picture strings and if your sites can sort the same way and printable, future Patriots can print these big strings together and make their own offline map to share. Save time and tape. The hours put them qposts into catagories, you can pick out a theme among the cats once you sort all q posts this way ignoring the dates during sort

So "perhaps" Q team rolled or captured the contents of what was on those pallets.

Shareblue was sneakily turned into Shareblues to funnel $$ into the crooked one's pockets-similar MO & by design?

Spamfag was right about Corsi but just too damn repetitive

LICENSING LIBERTY

“No state shall convert a liberty into a license and charge a fee therefore.”(Murdock v. Pennsylvania, 319 U.S. 105)

“If the state converts a right (liberty) into a privilege, the citizen can ignore the license and fee and engage in the right (liberty) with impunity.”(Shuttlesworth v. City of Birmingham, Alabama, 373 U.S. 262)

roll of film? Roll the tape?

Roll….ing on the floor with laughter at this ridiculous play that is making the media chase their tails endlessly?

https://twitter.com/WhiteHouse/status/992040078770950145

The White House

‏Verified account @WhiteHouse

President Donald J. Trump proclaims May 3 as a National Day of Prayer

6:56 AM - 3 May 2018

The pallets contain rolls of film - Hillary's sex video.

>>1285350

>between Melania and him (and God

Anonymous ID: b0a429 May 3, 2018, 7:01 a.m. No.1285362 🗄️.is 🔗kun >>5375

>>1285313

Sitting in his cab or in the truckers lounge and out of the fucking way of the loading dock personnel. That's where the driver is.

With the photos Q was drawing a link between Apple corporate, retail in China and pallets that were photographed

Cook has been brought to heel.

Discovery could be

A) fake US currency -another way to devalue the US dollar as POTUS repeatedly accused China of doing ( after inauguration they would have been able to check the amount of cash in circulation vs how much legally printed and available). Offshoring money (panama papers and tax avoidance) is one way but flooding the market with illegally printed money (see RM 39 in NK) is another.

B) Fentanyl (or other drugs)

C) Uncomped phones for Black Hats to use for comms

D) Unmentionables re: human cargo

Whatever it is, they have disrupted another RAT LINE and leveraged Apple/Cook

What the fuck was Comey up to? Was he working for the MB or China? Selling hacks into our technology through the FBI?

https://en.wikipedia.org/wiki/FBI%E2%80%93Apple_encryption_dispute

https://oig.justice.gov/reports/2018/o20180413.pdf

>>1285300

Lynch?

"Rolling" on someone can mean you snitched.

Typical slang in drug world when someone gets arrested.

"Did he roll?"

>>1285250

Do tell. A role in what, anon?

I think it was a shipment of adrenochrome for the vampires. They are growing weak and dying off slowly since their supply lines have been cut off. This shipment was going to bring them much needed energy but Q and team intercepted it so now the vampires are screwed.

That's when the specifications for the file format was created, not when the file itself was created. It's like if every jpg had the date 9/18/1998 inside because the JPEG format was standardized on that date.

>>1285366

yeah…could be someone "rolled over" or submitted

>>1285366

Yes that was the first one that popped into my semi-fried tired brain this morning. Keep the guessing going Anons, we'll get this soon it should be an easy peasy one

>>1284892

>ADRENO

Anonymous ID: 6d92f7 May 3, 2018, 7:03 a.m. No.1285375 🗄️.is 🔗kun >>5391

>>1285362

Yeah except that never happens. They help bring the items from the front of their trucks to where you can pick them up with a piece of equipment.

Let me guess you didn't unload as many trucks as I have in the past month.

>>1285328

Who wants got bet they've been destroyed and gone. Backups sitting in underground storage somewhere.

Anonymous ID: 034d67 May 3, 2018, 7:04 a.m. No.1285377 🗄️.is 🔗kun >>5409

>>1285359

>twitter.com/WhiteHouse/status/992040078770950145

However, President Barack Obama has chosen not to personally participate nor host events for the National Day of Prayer at the White House, which seems to be the origin of this widely circulated email. Although he has not participated as his predecessors did, he has written a proclamation for the day of prayer every year of his presidency, which are available on our website, www.nationaldayofprayer.org . In fact, every President since 1952 has written proclamations calling for a National Day of Prayer.

>>1285346

"you play to WIN THE GAME ..They were who thought they were,"….

You do realize how crazy you sound.

And hey at this point I may agree with you…

We were expecting arrests and sex videos.

What did we get? BOOM BOOMs and photos from a cheap phone.

Trump, please fire this Q.

>>1285363

This is second time someone posted a summary without linking a thread. Are we being fed?

To my knowledge, Q hasn't mentioned James Comey very often. Comey could be white hat (flipped black hat who took a deal)

>>1285359

mmmm I mean I know it's projection but I would expect something like that to be declared when serious stuff is about to rock the country.

>>1285348

>Its meat folks….human meat.

>Pizza ingredients?

Ahah! Flown in for the Apple cafeteria. Makes sense to me now.

Anonymous ID: 0b79ab May 3, 2018, 7:05 a.m. No.1285386 🗄️.is 🔗kun >>5857

Higgins had stood by Trump during the Khizr Khan attacks. And he had written a memo warning that “the left is aligned with Islamist organizations at local, national, and international levels” and that “they operate in social media, television, the 24-hour news cycle in all media and are entrenched at the upper levels of the bureaucracies.”

Like Harvey and Ezra Watnick-Cohen, Higgins had warned of an enemy within. And paid the price.

McMaster’s cronies had allegedly used the NSC’s email system to track down the source of the memo. The left and its useful idiots were indeed entrenched at the upper level of the bureaucracy.

Higgins was fired.

Like Harvey and Watnick-Cohen, Higgins had also become too dangerous to the Obama holdovers. Harvey had assembled a list of names and a plan to dismantle the Iranian nuclear deal. Watnick-Cohen had dug into the Obama surveillance of Trump officials. And Higgins had sought to declassify Presidential Study Directive 11. PSD-11 was the secret blueprint of Obama’s support for the Muslim Brotherhood.

Pete Hoekstra, the former Chairman of the House Intelligence Committee, linked PSD-11 to the rise of ISIS and called for its declassification.

https://counterjihadreport.com/tag/psd-11/

Obama rolls dice on foreign policy in secretive presidential directive

by Pete Hoekstra

| October 03, 2016 12:04 AM

https://www.washingtonexaminer.com/obama-rolls-dice-on-foreign-policy-in-secretive-presidential-directive/article/2603354

The Investigative Project on Terrorism

___________

STATEMENT OF

PETER HOEKSTRA

SHILLMAN SENIOR FELLOW

INVESTIGATIVE PROJECT ON TERRORISM

An official in the Obama White House indicated at the time, “It’s a roll of the dice…”

https://t.co/Etf8NFmzYB

>>1285382

Please.

>>1285380

I wonder if these are some electonic components that go into our military planes….that are made so that the Cabal can hack into with Apples help which is how they have been taking our planes down.

Thoughts?

Anonymous ID: b0a429 May 3, 2018, 7:06 a.m. No.1285391 🗄️.is 🔗kun >>5427

>>1285375

Do probably 30 a day. Truckers dont go on the dock. They're a liability waiting to happen with forktruck traffic. They are confined to a lounge area with bathrooms and a TV while we load/unload with a window for paperwork. After loading, they pull forward to inspect the load before seal is applied and shipment is released.

>>1285364

Anonymous ID: aee2d4 May 3, 2018, 7:06 a.m. No.1285393 🗄️.is 🔗kun >>5433

>>1285381

Wondered that myself, anon. Gonna add it to notables just in case.

>>1285331

<take it back

Anonymous ID: 45364b May 3, 2018, 7:06 a.m. No.1285395 🗄️.is 🔗kun >>5462

>>1285382

no way Comey is that great an actor

He's a slimeball

>>1285255 NY Times CEO Mark Thompson, former Channel 4 & BBC

(prev.)

>>1284186 Sir Jony Ive,( CDO) Apple Inc. DIGz

< + Sir BONO at (RED) Benefit

>>1284774 >Aldous Huxley,

>Brit Royal Society intellectual in Holy Wood (L.A.) in early 60's

>>1284286 >Sultan India & wife of Brit adviser to Sultan arrive in L.A. 1934 during excavation into "Lizard People Catacomb City" downtown L.A.

( >>1283854 >>1284363 )

< = (pic related) ???

cc >>1284483

Anonymous ID: df0479 May 3, 2018, 7:06 a.m. No.1285397 🗄️.is 🔗kun >>5440

>>1285382

Th e n why is he running around saying crazy shit?

good morning anons

lol, i see u cats are still playing with pics

future posts will make clear

future proves past

>>1285388

get `em

>>1285388

Yes my lovely Nasim, but I'm alive.

>>1285122

Whoever's managing the qanonposts.com site

There's a phishing virus popping up there (again) on my Android device (Kindle). Says it's from "2p2017shopgratis.site". A window appears with the usual BS about my device being infected, "continue with instructions to fix," yadda, yadda.

Whoever's managing the site, please sanitize. Thanks!

I love it, but……………

There's no blue check mark. I don't twat so I don't know but is this legit JC Twatter?

Whatever it is, it's being shipped clandestinely. I still believe these pallets were hidden behind pallets of brussel sprouts. Perfect cover.

Anonymous ID: 024e28 May 3, 2018, 7:07 a.m. No.1285404 🗄️.is 🔗kun >>5448

my head still hurts from that discussion, ive never stared at file names so much in my life

>>1285316

No … don't believe so. Looks good

>>1285379

yes, mainly sarcasm but you never know.

Anonymous ID: 1fc88c May 3, 2018, 7:07 a.m. No.1285407 🗄️.is 🔗kun >>5450

The packages on top are dented because people were laying on top of it. This trailer was filled with people. Trafficking.

I found out yesterday that Charleston Heston also had Q clearance waaaay back in the day, he used to do narration for atomic bomb videos for the army before he went into movies

pretty cool

>>1285377

its everywhere…doesnt matter….

Anonymous ID: 4afc22 May 3, 2018, 7:08 a.m. No.1285411 🗄️.is 🔗kun >>5431

>>1285392

>>1284892

>just throwing this out there.

New phones -something in the screen making young people make more adreno chrome? levels check able in iris scan? (23&me commercial launched?) if "great sample"show up - > location is known - > grab and serve 4 dinner?

>>1285359

it is needed irregardless

we know Obama was a phony.

Anonymous ID: 903612 May 3, 2018, 7:08 a.m. No.1285414 🗄️.is 🔗kun >>5537

>>1285271

'Tim Cook is a faggot' is notable?

Are you fucking high or stupid?

That's just the date for the xml standard used. Look at the DateCreated:

DateCreated>2018-05-02T19:51:34

>>1285336

Thx much. Easy to miss due to handoff.

Thx very much for taking the oven duties, Baker. Godspeed.

>>1285316

First time I've seen it - thanks for bringing to my/our attention.

Hong Kong

>>1285380

You fail, "muh instant gratification" SHILL!

kys

Anonymous ID: a59a63 May 3, 2018, 7:09 a.m. No.1285422 🗄️.is 🔗kun >>5726

>>1285412

could be…

>>1285389

I think electronic components. Use in planes, phones, autos? IDK

Anonymous ID: 19f1ff May 3, 2018, 7:10 a.m. No.1285424 🗄️.is 🔗kun >>5588

Hey could a caring anon post for me what they think are the best settings to read the boards as fast as possible…I'm not a newfag to Q boards but haven't been on the boards before that so I am always trying to mess with it and I think aI fked it up

you could say that FLIP

is a synonym for ROLL

but not ROLE

"Adidas doesn't need Kanye anymore"

German company founded by Adolf Dassler

https://www.bloomberg.com/view/articles/2018-05-03/kanye-west-is-on-the-way-out-with-fashionistas

>>1285391

Maybe,

but….. when delivering, even on a military base, the Drivers often unload themselves and stage in an open area in the warehouse or loading dock for easy in-check and recieving.

Anonymous ID: 6d92f7 May 3, 2018, 7:10 a.m. No.1285429 🗄️.is 🔗kun >>5441

There not people being shipped. You couldn't fit that many people in a pallett.

Maybe blood.

Maybe electronics (chips?)

en.wikipedia.org/wiki/Bill_McDermott

something's fishy about the guy..some would even say cunty..

when i saw it live that day i thought the same..but now in light of planes crashing regularly it gets even worse with smelling that cunty breath of cuntiness..

www.sap.com/industries/defense-security.html

en.wikipedia.org/wiki/SAP_SE

"Bill McDermott, CEO of SAP, compared the release of SAP S/4HANA to a "moonshot", describing it as the most important launch in the company's history."

So..if the guy is not a friendly friend, he probably is into soemthing very BAD. his thing could very well be blackmailing POTUS.

BAKER this could be NOTABLE

Anonymous ID: 4afc22 May 3, 2018, 7:11 a.m. No.1285431 🗄️.is 🔗kun >>5479

>>1285411

>>1285392

>>1285364

Extracting Qualcomm's KeyMaster Keys - Breaking Android Full Disk Encryption

After covering a TrustZone kernel vulnerability and exploit in the previous blog post, I thought this time it might be interesting to explore some of the implications of code-execution within the TrustZone kernel. In this blog post, I'll demonstrate how TrustZone kernel code-execution can be used to effectively break Android's Full Disk Encryption (FDE) scheme. We'll also see some of the inherent issues stemming from the design of Android's FDE scheme, even without any TrustZone vulnerability.

I've been in contact with Qualcomm regarding the issue prior to the release of this post, and have let them review the blog post. As always, they've been very helpful and fast to respond. Unfortunately, it seems as though fixing the issue is not simple, and might require hardware changes.

If you aren't interested in the technical details and just want to read the conclusions - feel free to jump right to the "Conclusions" section. In the same vein, if you're only interested in the code, jump directly to the "Code" section.

SETTING THE STAGE

https://bits-please.blogspot.in/2016/06/extracting-qualcomms-keymaster-keys.html

What if those are boxes of the QRS-11 chip…..that would be a lot of them……ideas??

>>1285393

Yes, so second time a short summary from someone has suggested the pics werent for us but a msg for the black hats.

lol…these posts are all ridiculous….im out….recent q pics ridiculous too….the moab to irans nuke plant last week….was damn amazing though…

>>1285357

roll out the red carpet

they see me 'rollin'

Anonymous ID: 226ef4 May 3, 2018, 7:12 a.m. No.1285437 🗄️.is 🔗kun >>5664

General message to the indictment-counter anons:

HUGE THANK YOU!

>>1285307

not proof of anything… anyone can name any random contact stormy daniels

anons need to learn to not latch onto everything that they want to be true

>>1285389

Oh, the thingy to take down plane is something different.

Something that would make you ultimately depressive, believe me.

>>1285397

Well if he is part of the plan, he would be saying exactly what he is saying

Anonymous ID: 7efbd9 May 3, 2018, 7:12 a.m. No.1285441 🗄️.is 🔗kun >>5478

>>1285429

what if they're small people?

Fuck off with the trucky chit chat bullshit. If you cant add facts about the photo's…STFU

Anonymous ID: be2352 May 3, 2018, 7:12 a.m. No.1285444 🗄️.is 🔗kun >>5473

>>1285293

Interdasting. See, it's habbening WW.

>>1285249

this.

https://www.zerohedge.com/news/2018-01-25/comey-rosenstein-mccabe-all-named-fisa-memo-according-first-leak

Comey, Rosenstein, McCabe All Named In FISA Memo, First Leak Reveals

A bombshell four-page "FISA memo" alleging egregious surveillance abuse by the FBI, DOJ and Obama administration, specifically names FBI Deputy Director Andrew McCabe, former FBI Director James Comey and Deputy Attorney General Rod Rosenstein, according to the Daily Beast.

The GOP-authored memo made waves last week after it was made available to the full House of Representatives for viewing. With over 60 GOP lawmakers calling for its release, Capitol Hill sources on both sides of the aisle tell The Daily Beast that it's only a matter of time before the general public is allowed to view the document - which is likely to stoke already-inflamed tensions between GOP lawmakers and the individuals named in the leak.

The facts contained in the Republican majority-authored report are said to be "jaw-dropping and demand full transparency," according to Rep. Matt Gaetz (R-FL), while the top ranking Democrat on the House Intel Committee, Adam Schiff (D-CA) dismissed the memo as "profoundly misleading" talking points drafted by Republican staffers.

Several other GOP Congressmembers have weighed in. "I have read the memo," tweeted Rep. Steve King (R-IA), adding "The sickening reality has set in. I no longer hold out hope there is an innocent explanation for the information the public has seen. I have long said it is worse than Watergate. It was #neverTrump & #alwaysHillary. #releasethememo."

Along with the four-page memo, Congressional investigators learned from a new batch of text messages between anti-Trump FBI investigators that several individuals within the Department of Justice and the FBI may have come together in the "immediate aftermath" of the 2016 election to undermine President Trump, according to Rep. John Ratcliffe (R-TX) who has reviewed the texts.

This is particularly interesting since the memo allegedly names Deputy Attorney General Rod Rosenstein - who created Robert Mueller's special counsel after former FBI Director James Comey was fired.

>>1285427

Your "never" turned to "often"…

>>1285404

Flat past out next to my keyboard. Did we ever move forward from this post?

>>1285407

No….just no

>>1285379

>You do realize how crazy you sound.

>And hey at this point I may agree with you…

Q warned us earlier that it goes very deep.

Has anybody identified which flight that is?

Because the flight data websites will let you go back in time and see what other plane was in the air nearby where Q could have photographed the JetBlue plane. If we identify the Jetblue flight, then from that, we can identify the flight carrying Q and the destination of Q's flight.

86 days ago Q said "find the roll"

Anonymous ID: aee2d4 May 3, 2018, 7:13 a.m. No.1285454 🗄️.is 🔗kun >>5616

ADDED

I think we need eyes on this. I use the SAP system at work, but it's for inventory control.

that would be a nice eye poke

The boxes are filled with copies of the cookbook, "To Serve Man."

Anonymous ID: 89e6d8 May 3, 2018, 7:13 a.m. No.1285457 🗄️.is 🔗kun >>5552

The Rolls of Oleron were some of the first Rules of the Sea

Maybe the pallets came by sea.

'roll' is POTUS' shout out to this Bread! lmao

¯_(ツ)_/¯

Anonymous ID: b97d2d May 3, 2018, 7:13 a.m. No.1285459 🗄️.is 🔗kun >>5486

>>1285439

Thauce?

Watch the water was referring to North Korea being freed from CIA control and the pics of calm instead of stormy seas. However, this may have more to do with Big Pharma. Worth digging.

>>1281335

That's just plastic shrink-wrap, anon…

>>1285395

Kinda ironic that he was the catalyst for creating the Special counsel. If Trump hired Rosenstein, and Rosenstein hired Mueller, and Comey was the "reason" Rosenstein hired Mueller, then Comey has to be white hat. White hats needed the Special Counsel, clearly wanted Mueller to head it…

Anonymous ID: b50eb2 May 3, 2018, 7:14 a.m. No.1285464 🗄️.is 🔗kun >>5726

>>1285412

Wow, thats a scarey hypothesis. What do we know about iris or face recognition?

Anonymous ID: 70122c May 3, 2018, 7:14 a.m. No.1285465 🗄️.is 🔗kun >>5562

>>1285381

Just an anon, anon. Putting a fine point in my thoughts for now so that I can move on.

Anonymous ID: b215f3 May 3, 2018, 7:14 a.m. No.1285466 🗄️.is 🔗kun >>5867

Q's pics mean to me that Apple is using Hong Kong and their port front flagship store as a transshipment point for items that should not be shipped from China to the USA or elsewhere, and whitehats know all about it. either human trafficking or comped chips

Anonymous ID: 3cc9e0 May 3, 2018, 7:14 a.m. No.1285467 🗄️.is 🔗kun >>5492

>>1285427

Why is it that Q like to post pics without explanation? Q likes to leave you hanging like this and you guys talk back and forth with speculation what it might be. Is this intentional? I have not seen single confirmation of "THIS IT IT!" Nothing burger.

>>1285122

Is that some sort of writing on the left side of the truck? sorry if this has been addressed, just getting going today.

I think the C-130s have a lot more to do with CONUS infiltration of whomever is grounding/downing flights in our ME operations in Syria, but I'm thinking this could be a potential theory.

>>1285456

Kek

>>1285444

>>1285456

No, this is what is in the boxes.

Anonymous ID: 1fc88c May 3, 2018, 7:15 a.m. No.1285475 🗄️.is 🔗kun >>5524

>>1285450

You sound so sure.

Tell us what you know, then… or shut up.

Anonymous ID: be2352 May 3, 2018, 7:15 a.m. No.1285476 🗄️.is 🔗kun >>5593

They are rolling out the plan to misdirect the MSM.

>>1285398

she reminds me of the sexy persian that got me through law school ;-P

Anonymous ID: 89e6d8 May 3, 2018, 7:15 a.m. No.1285478 🗄️.is 🔗kun >>5483

>>1285441

I knew it. Midgets rule the world!

Anonymous ID: 4afc22 May 3, 2018, 7:15 a.m. No.1285479 🗄️.is 🔗kun >>5493

>>1285431

In Apple's case you can't extract the hardware key no matter what software attack you carry out (w/ the OEMs or without). At most, you can bypass the software protections, but you'll still have to perform the bruteforce attempt strictly on the device.

Anonymous ID: 8439f9 May 3, 2018, 7:16 a.m. No.1285480 🗄️.is 🔗kun >>5659

>>1285435

How is Boom week coming along?

>>1285356

The right to clean drinking water and correct information.

>>1285478

until its time to ride the bumpercars

Anonymous ID: e97e19 May 3, 2018, 7:16 a.m. No.1285484 🗄️.is 🔗kun >>5607

3 "Prisoners" from NK that Previous Admin "wanted"

3 Pallets

Apple in China

Apple Headquarters

Jet Blue

NK producing corrupt Apple Products, Shipped through China to be used in US

>>1285477

u should of fought for her, f her arranged marriage

>>1285459

Books of advanced knowledge in physics.

Anonymous ID: 0b79ab May 3, 2018, 7:17 a.m. No.1285487 🗄️.is 🔗kun >>5531

>>1285436

Most definitely agree that the laser from the Chinese base was what was posted

last night guy on Tucker before time went out told us that they are also focussing on Guccifer, Wikileaks and DCleaks..

could be important to know.

at least he seemed to think it's good having it out there..when you see the complete interview you can see how they constructed the whole thing..in the beginning Caputo starts the sentence, gets interrupted by another of Tckers questions..they semm to dance around the thing a bit and in the end Caputo gets to drop his thing..

You r assuming pic is of finished load. Could b midway thru loading or unloading….move on.

Anonymous ID: 9668b6 May 3, 2018, 7:17 a.m. No.1285490 🗄️.is 🔗kun >>5531

>>1285436

compromised mobile operating security

leads to

clandestine trusted app backdoor

leads to

tracking abilities

leads to

pin-point accuracy and perfect aim.

our pilots are not safe because we didn't know they were being tagged at the factory.

>>1285144

—————————————————

BAKER CORRECTION NEEDED

The dough for Memes18 is incorrect. The link should be →

>>1027465

I tested https://8ch.net/qresearch/res/1027465.html#1027642

and it works.

I don't understand why the link in the dough doesn't highlight since the numerals are correct.

Can you have a look and see if there's a space or a foreign character in there?

ThankQ!

———————————————————-

>>1285467

Many apologies for this mistake!!

Anonymous ID: 4afc22 May 3, 2018, 7:18 a.m. No.1285493 🗄️.is 🔗kun >>5500

>>1285479

Anonymous ID: 607f0b May 3, 2018, 7:18 a.m. No.1285494 🗄️.is 🔗kun >>5504

>>1285477

Interdasting, I had a super sexy persian help me through DiffEQ.

Anonymous ID: b215f3 May 3, 2018, 7:18 a.m. No.1285495 🗄️.is 🔗kun >>5501

>>1285313

are you sure its on a truck?

could be a container on a dock or the ground no?

Anonymous ID: 6ed370 May 3, 2018, 7:18 a.m. No.1285496 🗄️.is 🔗kun >>5856

https://www.msn.com/en-us/news/world/giuliani-says-3-americans-held-by-north-korea-to-be-released-thursday/ar-AAwFn0D?ocid=spartandhp

<Giuliani says 3 Americans held by North Korea to be released Thursday

Anonymous ID: 6ac6c2 May 3, 2018, 7:18 a.m. No.1285497 🗄️.is 🔗kun >>5535

He looks like a Vegas mob boss

Anonymous ID: d921a4 May 3, 2018, 7:19 a.m. No.1285498 🗄️.is 🔗kun >>5608

>>1285327

Amazing story.

<gymnopedie no 1 erik satie man on wire (2008)

>warning: stream reverts to GOOGtube.

>>1285300

Losers (MSM).

>>1285493

CONCLUSIONS

The key derivation is not hardware bound. Instead of using a real hardware key which cannot be extracted by software (for example, the SHK), the KeyMaster application uses a key derived from the SHK and directly available to TrustZone.

OEMs can comply with law enforcement to break Full Disk Encryption. Since the key is available to TrustZone, OEMs could simply create and sign a TrustZone image which extracts the KeyMaster keys and flash it to the target device. This would allow law enforcement to easily brute-force the FDE password off the device using the leaked keys.

Patching TrustZone vulnerabilities does not necessarily protect you from this issue. Even on patched devices, if an attacker can obtain the encrypted disk image (e.g. by using forensic tools), they can then "downgrade" the device to a vulnerable version, extract the key by exploiting TrustZone, and use them to brute-force the encryption. Since the key is derived directly from the SHK, and the SHK cannot be modified, this renders all down-gradable devices directly vulnerable.

Android FDE is only as strong as the TrustZone kernel or KeyMaster. Finding a TrustZone kernel vulnerability or a vulnerability in the KeyMaster trustlet, directly leads to the disclosure of the KeyMaster keys, thus enabling off-device attacks on Android FDE.

>>1285495

Evergreen?

Anonymous ID: 401a68 May 3, 2018, 7:19 a.m. No.1285504 🗄️.is 🔗kun >>5542

>>1285494

Hmmm…I don't remember any girls in that class. o_O

>>1285491

Memes20 >>1232995, 19 >>1144040 , 18 ; >>1027465

testing to see if they work now

SAP software is used extensively in key data operations of at least one of the biggest banks on the planet.

Not only does it suck, it's German, and + to the cuntiness of the CEO makes it a trifecta.

>>1285468

I kind of agree. The only thing that we can really get from these pics is that something from or to Apple is being shipped. We would assume something nefarious. We cannot know what until it is revealed. So, unless we can SEE what is in the boxes, we know nothing.

>>1285501

HDC22@clintonemail.com

Per POTUS tweet, we can infer that Cohen had the roll of film from the SOTU which captured the threat to POTUS, and now Mueller has it logged as evidence.

Anonymous ID: aee2d4 May 3, 2018, 7:21 a.m. No.1285510 🗄️.is 🔗kun >>5518

>>1285505

Memes20 >>1232995, 19 >>1144040, 18 >>1027465

Anonymous ID: 06789c May 3, 2018, 7:21 a.m. No.1285511 🗄️.is 🔗kun >>5560

>>1283960

The letters from second post led me to this link

Yhmtyk

http://www.sanjoseca.gov/DocumentCenter/View/734

Totally off topic, but to my photoshop fags, anyone has any good advice on what useful plug-ins to get?

>>1285363

Agree Anon

Meant as shot across bow to black hats

We'll find out later

Anonymous ID: 9128b5 May 3, 2018, 7:21 a.m. No.1285514 🗄️.is 🔗kun >>5569

>>1285491

>>1285505

Something weird going on. The bread still exists in the catalog because I can navigate to it from a browser bookmark that I saved when I created that bread.

https://8ch.net/qresearch/res/1027465.html#1027642

I don't know what to say. Weird.

>>1285468

In this case, it would be because we arent supposed to know what Q is saying just yet, moreso file these pictures in the back of our heads and wait until they come to fruition

>>1285501

Evergreen containers… interesting

Anonymous ID: aee2d4 May 3, 2018, 7:22 a.m. No.1285517 🗄️.is 🔗kun >>5541

>>1285491

Not sure why the link is broken. Can you message BO or BV please?

>>1285510

keep your head up anon…

It's getting there. idk why tf…

Anonymous ID: 4afc22 May 3, 2018, 7:22 a.m. No.1285519 🗄️.is 🔗kun >>5534

SEC_TEST

>to roll someone is to rob or to scam them

>>1285326

>Possible getting ready to roll (86) this mf

Giuliani knocked over all their toys, kicked them, smashed them, set them on fire & then pissed out the fire.

Anonymous ID: a6110e May 3, 2018, 7:22 a.m. No.1285521 🗄️.is 🔗kun >>5584

I don't think it's money, I have seen pallets of copy paper that size and they didn't have special pallets, gold would be smaller size because of the weight, I am guessing it's silicon chips, but each of those boxes would be heavy as shit still a mystery.

>>1285435

KEK

Anonymous ID: 56347f May 3, 2018, 7:22 a.m. No.1285523 🗄️.is 🔗kun >>5545

>>1285325

Because it is not the mode of transportation the opponent was expecting.

>>1285475

I know ur stupid.

When is Iran Deal deadline? May 12?

>>1285516

epic bars?

>>1285448

nobody mentioned it but

if you take any Q post that says "marker" and take the time… there is almost always another Q post at the exact same time on a different day that connects

we need to farm all of these

Another datapoint from the Wall Street Journal - (Sry - I use El-Autismo Dark themes)

Relative to the Aircraft Incidents and EW (Electronic Warfare)

Source:

https://www.wsj.com/articles/laser-from-chinese-base-aimed-at-u-s-military-pilots-in-africas-skies-pentagon-charges-1525351775

From the article "

The new signs of military tension also come as U.S.-China economic relations have sunk to their lowest point in decades. President Donald Trump says he considers Chinese counterpart Xi Jinping a friend, but has imposed tariffs on some Chinese goods and is threatening tariffs on $150 billion more, while his administration has imposed new restrictions on U.S. technology exports to China.

There have been a number of laser-related incidents in the past several weeks, Pentagon officials said. In one of the most recent, two American service members piloting a C-130 turboprop experienced minor eye injuries after being exposed to the laser beam, according to a Pentagon official.

"

The tweets were about Stormy.

The delta between the (3) tweets is 8 & 6 = 86. 86 means to get rid or.

The misspelling of roll combined with 86 is telling me that the Stormy thing is about to be 86ed, nothing to do with China. WTF?

>>1285436

>>1285487

>>1285490

Rubber bullets are aka 'baton' rounds.

Batons can be used to direct much like a laser pointer can be used to direct.

BATON also happens to be a Type 1 block cyper used by the NSA.

Maybe Q is pointing out to us that BATON is how the NSA is accidentally leaking it all.

Anonymous ID: 556b89 May 3, 2018, 7:23 a.m. No.1285532 🗄️.is 🔗kun >>5604

https

://uk.reuters.com/article/us-tesla-results-research/tesla-shares-bonds-drop-as-ceo-musk-snubs-wall-street-idUKKBN1I41IY

Anonymous ID: eeed56 May 3, 2018, 7:23 a.m. No.1285534 🗄️.is 🔗kun >>5740

>>1285519

I hope this Q

>>1285497

have never met one..thank god..

guy could also be some vampire like sun hating shitneck..he was the only one wearing sunglkasses and hat this fucked up smug look..spoke last..sat to the right of POTUS for all the time..most of the guys at roundtable seemed to have shit their pants in comparison to this guy..when he began talking it felt very uncomfortable..his smile..his whole appearance was annoying to say the least.

>>1285516

Anonymous ID: 2b2eb8 May 3, 2018, 7:24 a.m. No.1285537 🗄️.is 🔗kun >>5564

>>1285414

Homosexuals have divided loyalties and may be blackmailable.

>>1285439

The only real physics you'll ever need.

Einstein?-FRAUD

CERN? Money Pit to drain tax revenue into a cult of bumping particles trail that leads nowhere, but keeps a bunch of retards looking busy & employed for life on your dime

Read this, reread this reread this again till you GET IT

& you will reach the same conclusion

ALL ACADEMIA IS A CIRCLE JERK

MODERN PARTICLE PHYSICS IS A CULT

https://archive.org/details/magnetism1small

Anonymous ID: cfd191 May 3, 2018, 7:24 a.m. No.1285539 🗄️.is 🔗kun >>5571

If the HANA launch was like a 'moonshot' for the company they must have hired their engineers from Negro American Space Society of Astronauts, NASSA.

https:// www.youtube.com/watch?v=9XPCzckUcYY

rifshocaa + yhmtyk?

Anonymous ID: 9128b5 May 3, 2018, 7:24 a.m. No.1285541 🗄️.is 🔗kun >>5549

>>1285517

OK have done so. Thank you & sorry for the trouble.

>>1285504

Yeah, I was like woob woob.

Went out of her way to help me out, absolutely stunning, but it was like patently obvious she was not interested in displeasing daddy. Tried anon, tried so hard. A girl like that with brains…

Anonymous ID: 45364b May 3, 2018, 7:24 a.m. No.1285543 🗄️.is 🔗kun >>5856

OK this weird anon post that was in notables said

"INTEL? C_hips? SUNG of SAM"

And then I found this article about Samsung to manufacture iPhone chips again.

https://www.washingtonpost.com/news/innovations/wp/2017/07/18/samsung-to-manufacture-iphone-chips-for-apple-again-report-says/?utm_term=.42896df6ddf8

Maybe this post is more than it seems?

>>1284928 (prev.)

>it was always supposed to be that way

true, true

>anons were always supposed to contribute notables to the BAKER

>some anons got lazy

>some anons forgot

>some anons never knew

>I think it's a great idea

>just wasn't sure of what the TAG TEAM NOTABLES' label was supposed to mean

>after all it was the night shift crew, and we all know they are a little different

yeah, i guess we can loose the TAG eventually/soon, but felt like leaving it for a while would help spread knowledge of the method...

personally i loved every moment baking, but keeping an eye on the thread count while watching for heads up (and selecting and writing the titles because anons don't do it) gets intense - and if Q drops on top of that, even moar of a rush...

CoBaking settles that, then you can concentrate on the posts and Q, while anons concentrate on the thread/notables

>>1285523

I'd agree based on that I believe they were expecting a C-30. IMO

>>1285258

Read CDAN

Tim likes Asian hot dogs

>>1285538

>Einstein?-FRAUD

>>1285541

No problem at all. Want to make sure the bread's not moldy!

are these 'special' apple phones for the cabal to communicate with? blackberry types?

Re-read 'apple' crumbs:

Wed 15 Nov 2017 00:38:48 No.149490950

Conf_D-TT^_v891_0600_yes

_green1_0600

Bunker Apple Yellow Sky [… + 1]

Yes

Godspeed.

Q

Tue 21 Nov 2017 18:43:15 No.150388962

Expand your thinking.

Captain Mike Green.

Conf_D-TT^_v891_0600_yes

_green1_0600

Bunker Apple Yellow Sky [… + 1]

Yes.

Who countered?

Do you believe in coincidences?

Learn how to read the map.

Q

Fri 22 Dec 2017 01:13:36 5902e7 No.146268

>>146142

Why is EM provided BIG WW subsidies?

No subsidies = ?

Clown contribution in exchange for access code?

Why relevant?

Amazon Echo?

Google Home?

Clown contributions?

Apple Face ID Tech?

FB Face ID Tech?

Catching on?

Bombs Away.

Q

Fri 22 Dec 2017 01:36:43 5902e7 No.146599

We are moving fast.

Remember, not all within the C-A, D-J, F-I are bad apples.

House cleaning (TOP).

Restructuring (1 to 2).

Operations 24/7.

Speed.

Q

Thu 15 Feb 2018 15:47:34 6d0fd8 No.388588

>>388528

Why is Big Pharma essential?

Expand your thinking past cures.

Think Google [new Pixel phone].

Think Apple [vs. Samsung].

Why was Blackberry destroyed?

We can guide but you must organically uncover the TRUTH.

THEY are watching.

ARCHIVE EVERYTHING OFFLINE.

Q

This is an excellent find.

There was another one from last night, "Earnhardt" should be "Earhardt"

Extra n

>>1285457

See:

>>1285254

Anonymous ID: 8439f9 May 3, 2018, 7:26 a.m. No.1285555 🗄️.is 🔗kun >>5577

>>1285542

well hopefully you had some good times and got to run through it a few times

memories

>>1285327

Amazing feat and astounding story. Read the book some years back. The lack of security at the towers at that time. he was able to go in and out, bring in equipment, without detection. Really put 911 in perspective.

>>1285316

Good catch

Anonymous ID: fffb1c May 3, 2018, 7:27 a.m. No.1285558 🗄️.is 🔗kun >>5706

Jordan = MOAB? Pompeo & marines turned up in Jordan right after Q said MOAB. maybe MOAB didn't refer to the 'mother of all bombs'

>>1285550

>Bunker Apple Yellow Sky [… + 1]

Bunker - trailer, new apple bldg

Apple - phones

yellow - asia, china

sky - plane

>>1285511

Yhmtyk

You Have More Than You Know

>>1285233

P=PenQuin

>>1285465

Well, anon, i like ur thought process. Thanks for sharing

Doing some digging on this guy…..interesting info here regarding a fall in 2015that cost him his LEFT EYE

>>1285537

Anonymous ID: 56347f May 3, 2018, 7:28 a.m. No.1285565 🗄️.is 🔗kun >>5623

>>1285340

doddering old fool who was once at the top of his game

Anonymous ID: 3cc9e0 May 3, 2018, 7:28 a.m. No.1285567 🗄️.is 🔗kun >>5783

https

://uk.reuters.com/article/uk-palestinians-gaza-salaries/anger-as-palestinian-authority-cuts-gaza-salaries-and-pays-late-idUKKBN1I41M6

From yersterday's CDAN blind.

Some guy on this blog says it's J Depp. It's prly not. Says 3 floors, this is 2 floors.

Had property in this building in LA. Owned 5 penthouse suites,

The blind says 3 floors.

http ://www.condopedia.com/wiki/Eastern_Columbia_Lofts#Layout_and_Features

Back to believing its Dopey. 3 floors = Mandalay Bay. The blind specifically mentions sunglasses belonging to bodyguard. I think that was slipped in the blind because we are always seeing dopey in sunglasses.

>>1285514

In more previous breads pictures are taken down… (only significant ones?)

See: https://8ch.net/qresearch/res/655305.html#656105

Anonymous ID: be2352 May 3, 2018, 7:29 a.m. No.1285570 🗄️.is 🔗kun >>5586

>>1285450

Sarcasm, anon.

>>1285539

never thaught about that..:D

thanks for the heads up.

Anonymous ID: 89ed54 May 3, 2018, 7:29 a.m. No.1285572 🗄️.is 🔗kun >>5680

>>1284552

Q drop talking about killing existing platforms. Was Q being literal?

Anonymous ID: 8439f9 May 3, 2018, 7:30 a.m. No.1285574 🗄️.is 🔗kun >>5720

>>1285538

don't forget nasa

worlds biggest money laundering scheme

Anonymous ID: b06664 May 3, 2018, 7:30 a.m. No.1285575 🗄️.is 🔗kun >>5589

BAKER NOTABLE

>>1285316 → POTUS tweet uses GOOD and GREAT (in that order), shout out to Q post

RSP_COUNT 1

>>1285555

nice quads. sadly no. one thing that sticks out in my mind was (the time was after 9/11) she was adamant almost upset that I assumed she was from Iran by her characteristics. I AM PERSIAN! kek

yes, memories, thanks anon

Anonymous ID: 6054bc May 3, 2018, 7:30 a.m. No.1285578 🗄️.is 🔗kun >>5592

When's Iran Deal deadline? May 12?

>>1280852 (previous bread)

https://twitter.com/realDonaldTrump/status/890361489126805504

https://twitter.com/realDonaldTrump/status/893416615504748544

>>1285439

Serious deja vu here. From months back. Even to the "Thauce" response. Weird.

Anonymous ID: 3cc9e0 May 3, 2018, 7:31 a.m. No.1285581 🗄️.is 🔗kun >>5856

Winning

https

://uk.reuters.com/article/uk-usa-economy/u-s-trade-deficit-narrows-sharply-labour-market-tightening-idUKKBN1I41MK

>>1285542

KEK!

Anonymous ID: 839e8a May 3, 2018, 7:31 a.m. No.1285583 🗄️.is 🔗kun >>5744

"e" is out, "l" is in?

>>1285521

If they are cartons of something heavy they might be packed with a packing material. So say each carton has something dense in it, packing material would fill it and make each carton less dense.

Anonymous ID: 78be58 May 3, 2018, 7:32 a.m. No.1285585 🗄️.is 🔗kun >>5668

So file names are arranged the same.

Group of 8 numbers, then 4-4-4 then 12

Hex code maybe?

>>1285570

Died a while ago here it seems

Anonymous ID: 2b2eb8 May 3, 2018, 7:32 a.m. No.1285587 🗄️.is 🔗kun >>5754

>>1285556

As an achievement, it's tops in my book. Endlessly inspiring.

>>1285424

>the best settings to read the boards as fast as possible

I like reading from bottom. Filter as you go. You will eventually catch up.

>>1285575

GOT IT

Anonymous ID: 6ed370 May 3, 2018, 7:32 a.m. No.1285590 🗄️.is 🔗kun >>5658

>>1285568

Is Dopey considered an A list celeb?

>>1285563

wtf..thx anon..guy seems more and more like a ding ding ding

Anonymous ID: aee2d4 May 3, 2018, 7:33 a.m. No.1285592 🗄️.is 🔗kun >>5596

>>1285578

Yep

Anonymous ID: 87cb9d May 3, 2018, 7:33 a.m. No.1285593 🗄️.is 🔗kun >>5620

>>1285476

This.

Remember, Story scandal is nothing more than a MSM distraction. They raided Cohen's office(s) for dirt, and got more than they bargained for:

>>1215845

Q very specifically stated that he will neither confirm/deny that the SC is on the team. The Stormy thing is nothing more than a laser pointer to distract the MSM. Again, "they fall for it every time".

>>1242619

Anonymous ID: b06664 May 3, 2018, 7:33 a.m. No.1285594 🗄️.is 🔗kun >>5610

BAKER NOTABLE

>>1285527 → possible use of the word marker related to other Q posts at same time

What is this moron up to.

Kellyanne Conway's husband trolls Trump with FEC rules

The husband of White House counselor Kellyanne Conway took a veiled shot at President Trump following revelations the president repaid his longtime attorney, Michael Cohen, for the $130,000 given to former adult film actress Stormy Daniels.

George Conway, a lawyer who removed his name from consideration for a top Justice Department post, tweeted Thursday a link to the Federal Election Commission’s web page for handling personal loans from a candidate for federal office.

Conway included in his tweet a screenshot from the page, which explained what is not considered the candidate’s personal funds.

“If any person, including a relative or friend of the candidate, gives or loans the candidate money ‘for the purpose of influencing any election for federal office,’ the funds are not considered personal funds of the candidate even if they are given to the candidate directly. Instead, the gift or loan is considered a contribution from the donor to the campaign, subject to the per-election limit and reportable by the campaign. This is true even if the candidate uses the funds for personal living expenses while campaigning," the passage highlighted by Conway states.

https:// www.washingtonexaminer.com/policy/courts/kellyanne-conways-husband-trolls-trump-with-fec-rules

>>1285592

Thanks Anon

I can't even pretend that there's any of this I find unbelievable at this point…

Anonymous ID: 345feb May 3, 2018, 7:34 a.m. No.1285600 🗄️.is 🔗kun >>5646

Looks to me like FIVE pallets. The one in the back looks like a double stack. One in the foreground, two behind that and then a single double stack in the back. Look at the wood pallets themselves, not what is on them. It looks like the one in the back has had the plastic wrap partially pulled down, probably to grab a box off the top or examine contents.

When you load a truck, you put the heavier stuff over the axles, you have to distribute the load correctly when you load the trailer.

>>1285584

Or the picture could just be about showing a partially filled trailer that indicates business isn't so good. Yeah, yeah, I know the whole truck may have been full and several stops have emptied it out, Or it could just have been taken at the beginning of the loading of it. But we could just be looking at a metaphor for business isn't so good.

Today Trump tweets:

Mr. Cohen, an attorney, received a monthly retainer, not from the campaign and having nothing to do with the campaign, from which he entered into, through reimbursement, a private contract between two parties, known as a non-disclosure agreement, or NDA. These agreements are…..

..very common among celebrities and people of wealth. In this case it is in full force and effect and will be used in Arbitration for damages against Ms. Clifford (Daniels). The agreement was used to stop the false and extortionist accusations made by her about an affair,……..

despite already having signed a detailed letter admitting that there was no affair. Prior to its violation by Ms. Clifford and her attorney, this was a private agreement. Money from the campaign, or campaign contributions, played no roll in this transaction.

Lets review the Stormy Story shall we:

Stormy makes affair claim (privately) against Trump

Cohen paids her to keep quiet, $130,000

She signs statement denying affair and NDA (non-disclosure agreement)

In some way Trump reimburses Cohen the $130,000

MSM catches wind of this and claims campaign contribution violations.

Then Stormy violates the NDA and goes public

Cohen reveals the settlement

Trump says he did not know anything about the $130,000 payment.

Cohen’s office is raided

Rudy comes out with a statement that says Trump did reimburse Cohen for the $130,000

Trump confirms in his tweets, yeah I did reimburse the $130,000

Hello possible Stormy Trump affair, big yawn

Bye bye campaign contribution violations

Truth:

Trump NEVER had an affair with Stormy Daniels (she is a Trump woman and can work with Trump and any Story he wants)

Donald Trump Jr. HAD an affair with Aubrey O’Day in 2012 -2013 (O’Day is a loose cannon, NOT workable)

Now let’s re-read the above summary with this in mind.

Aubrey O’Day (NOT Stormy) makes affair claim (privately) against Trump Jr. (NOT Trump)

Cohen paids her to keep quiet, $130,000

She signs statement denying affair and NDA (non-disclosure agreement)

In some way Trump reimburses Cohen the $130,000

MSM catches wind of this and claims campaign contribution violations.

Now Trump has a problem, these pesky MSM allegations of campaign contribution violation.

Stormy to the rescue!

Stormy goes public, she PRETENDS to violate the NDA and that she is the one involved in all this (even though she isn’t, it is O’Day who got paid off), that she got the $130,000 pay off.

Cohen reveals the settlement

Trump says he did not know anything about the $130,000 payment.

Cohen’s office is raided (how convenient)

Rudy comes out with a statement that says Trump did reimburse Cohen for the $130,000

Trump confirms in his tweets, yeah I did reimburse the $130,000

Hello possible Stormy Trump affair, big yawn

Bye bye campaign contribution violations

Trump what a gentleman, protecting his eldest son Donald Trump Jr. and his affair with O’Day.

IMAO he’s not worth it

I guess Vanessa agrees with me.

>>1282709 (previous bread - notables)

Would be nice to have something like this for every time Q says "Timestamp"

Example attached

>>1285532

give me all your shekels

muah ha ha ha

a few more

JetBlue doesn’t fly overseas.

>>1285484

Has the aspect ratio of these been covered already?

iPhone 8/X

Letterbox Significant?

>>1285498

In so many ways. An inspiration. All the things that could have and should have gone wrong…he beat them all.

God was with him, imho.

Pallets with boxes full of U$D.

Has nothing to do with phones.

No idea who is sending/receiving.

Pay-off of some sort most likely.

Anonymous ID: aee2d4 May 3, 2018, 7:35 a.m. No.1285610 🗄️.is 🔗kun >>5644

>>1285594

BAKER SURE APPRECIATES THE HELP ANON

I've been raking some, too. We've got a pretty good list so far.

>>1285579

Foxconn - Wikipedia

https://en.wikipedia.org/wiki/Foxconn

Hon Hai Precision Industry Co., Ltd., trading as Foxconn Technology Group, is a multinational electronics contract manufacturing company headquartered in Tucheng, New Taipei, Taiwan.Foxconn is the world's largest contract electronics manufacturer and the fourth-largest information technology company by revenue. The company is the largest private employer in China and one of the largest …

History ·

International operations ·

Major customers ·

FIH Mobile ·

Controversies

.

Foxconn suicides - Wikipedia

https://en.wikipedia.org/wiki/Foxconn_suicides

The Foxconn Suicides were a spate of suicides linked to low pay at the so-called "Foxconn City" industrial park in Shenzhen, China, that occurred alongside several additional suicides at various other Foxconn-owned locations and facilities in Mainland China. Within 2010, there were 18 attempted suicides by Foxconn (Chinese: 富士康) employees resulting in 14 deaths in the

Foxconn Wisconsin assembly work to generate millions in …

https://www.jsonline.com/story/money/business/2017/12/01/foxconn…

Foxconn's Wisconsin operations are expected to employ 2,000 people and generate $1 billion in sales by 2019 - well before its Racine County factory is built.

Apple has given a series order for 10 episodes of "Are You Sleeping," a drama series that will star Octavia Spencer, who is known for her work in movies that include "Hidden Figures," "The Help," "Gifted," and "The Shape of Water."

News of Apple's work on "Are You Sleeping" first surfaced in January, but now Variety says the company has decided to move forward with production on the show.

"Are You Sleeping" is based on a novel by Kathleen Barber, which has been described as a psychological thriller. The book focuses on a podcast that reopens a murder case, similar to the popular "Serial" podcast that led to a new trial for Adnan Syed, in jail for allegedly murdering a former girlfriend. Sarah Koenig, who created and produced "Serial," will consult on "Are You Sleeping."

The novel the TV show is based on explores how the reopening of the murder case impacts the victim's daughter and disrupts her life, and it's likely the TV show will follow a similar plot.

"Are You Sleeping" was written by Nichelle Tramble Spellman, and the series will be produced by Reese Witherspoon's Hello Sunshine and Chernin Entertainment/Endeavor Content.

Apple is also working with Reese Witherspoon's production company on an as of yet untitled "morning show drama" that takes a look into the cutthroat would of morning TV.

Apple now has more than a dozen television shows in the works, with a full list of what's on the horizon available in the original content section of our Apple TV roundup.

It's not yet known when the first of Apple's TV shows will debut nor how they'll be distributed, but rumors have suggested we could see the first fruits of Apple's efforts in 2019.

>>1285568

You missed the fact that CDAN is about Hollywood and the blind says that it was an A-list celeb. Most likely an actor or singer. And from the sound of it, if the murder happened in the USA, he was a foreign celeb.

Anonymous ID: ea20c3 May 3, 2018, 7:35 a.m. No.1285614 🗄️.is 🔗kun >>5677

Very happy to finally find people who never makes mistakes. Be blessed and good luck out there.

Anonymous ID: c547e2 May 3, 2018, 7:35 a.m. No.1285615 🗄️.is 🔗kun >>5649

>>1285528

Other than driving cats insane…

What do you use a laser pointer for??

>>1285454

that dinner meeting with trump and the SAP clients was excellent to see/hear.

"i know you, i know all about you"

priceless

a couple of months ago someone on twatter said there were coded messages in q's pics. I've tried to find it but have been unsuccessful.

Anonymous ID: 8439f9 May 3, 2018, 7:36 a.m. No.1285618 🗄️.is 🔗kun >>5851

>>1285584

im telling you now, after quite a bit of digging

i have came to the conclusion that what is on the

boxes on the pallets are:

Big Toes

there seams to be a huge shortage in China.

machete' accidents from cutting rice stalks.

Some reverse psychology here.

A few from the Voter ID memes collection

to celebrate Court decisions allowing the obvious, the identification of citizens as legitimate voters.

Anonymous ID: ce3589 May 3, 2018, 7:36 a.m. No.1285620 🗄️.is 🔗kun >>5758

>>1285593

So the 'big' info that was siezed, can be admitted into evidence if they bring a suit against the Prez. That's why they won't do it. Discovery.

>>1285398

Wouldnt that be a twist, that the Disclosure files are actually bundled with the Baker Girls instead of the Q images?

My baker girl folder just got more interdasting

>>1285565

Agreed. And that is just the most kind way to explain him, in my opinion. He might be much worse than that.

HOLY FUCKING SHIT

EVERY ANON ON THIS BOARD

Read about fucking John Jay McCloy

Seriously, never ever have I heard of him before.

He's the freaking financier of WW2! He was the concierge for the cruel financing of Hitler! He was sent by the Rockefellers and gave millions to Germans Nazi regime and also the dictatorship in Italy (Mussolini)

wikipedia.org/wiki/John_Jay_McCloy

Also notice today's Nazi post of Bloomberg:

https://www.bloomberg.com/news/articles/2018-05-03/world-s-youngest-billionaires-are-shadowed-by-ghosts-of-german-past

>>1285605

RR out

johnny flew out of

Ronald reagan airport

Anonymous ID: 4afc22 May 3, 2018, 7:37 a.m. No.1285626 🗄️.is 🔗kun >>5657

session_close

>>1285606

https://www.jetblue.com/airline-partners/

Maybe this is useful

Anonymous ID: 45364b May 3, 2018, 7:37 a.m. No.1285628 🗄️.is 🔗kun >>5847

TFVOS=

Semi-Supervised Video Object Segmentation (VOS) with Tensorflow.

https://github.com/philferriere/tfvos

I linked this a few days ago, but everyone was arguing and it was missed.

But with Q’s posts last night and Fox article yesterday, take a look please. This is worth a deeper dig. Pics related.

This links to Iran as well.

http:// www.foxnews.com/politics/2018/05/02/pentagon-orders-stores-to-ban-certain-chinese-phones-amid-spying-concerns.html

https:// wikileaks.org/hackingteam/emails/emailid/597644

https:// www.wired.com/2012/07/fbi-zte/

Patriots, News is Live

Anonymous ID: 56a8a7 May 3, 2018, 7:38 a.m. No.1285631 🗄️.is 🔗kun >>5746

>>1285603

The original picture is getting a 404 so its not showing correctly. Let me try it again

Brilliant find anon.

>So..if the guy is not a friendly friend, he probably is into soemthing very BAD. his thing could very well be blackmailing POTUS.

Definitely bad.

Definitely into blackmail

Definitely NOT blackmailing potus

we talked about this back in Jan

the guy is connected to NSA (meaning that that is most likely his MAIN job)

He was the only American there

Potus brought him to tell all the CEOS at the table that he HAS IT ALL via SAP/NSA spying over the decades.

McDermott mentions infant mortality to say "we know about your involvement in trafficking" blah blah blah

Record exports cut US trade deficit to $49 billion https://apnews.com/ea766935a9224d6fa59ecabbd780b70f/Record-exports-cut-US-trade-deficit-to-$49-billion?utm_campaign=SocialFlow&utm_source=Twitter&utm_medium=APBusiness

>>1285550

>Bunker Apple Yellow Sky

BAYS is the abbreviation for the county, where the attempted Roth extraction failed.

Nothing to do with apple company.

Anonymous ID: e0da34 May 3, 2018, 7:39 a.m. No.1285638 🗄️.is 🔗kun >>5846

>>1285122

>>1285401

Oops! Did not intend to black out that first line.

in case you missed this yesterday

lol had to

morning anons

Anonymous ID: 1fc88c May 3, 2018, 7:39 a.m. No.1285641 🗄️.is 🔗kun >>5650

>>1285528

BAKER, NOTABLE

>>1285606

The JetBlue plane was just flying alongside Q's plane as Q took two location photos. The crumb was Q's location. Don't go nuts over JetBlue. Consider where Q was, and when, and why.

Anonymous ID: d0fd8f May 3, 2018, 7:40 a.m. No.1285643 🗄️.is 🔗kun >>5686

Anonymous ID: b06664 May 3, 2018, 7:40 a.m. No.1285644 🗄️.is 🔗kun >>5662

>>1285610

Here to serve.

Please append

>>1285605

>>1285625

Whoever is posting the marker shit, keep the post numbers grouped. I'm over here picking up your toys.

Anonymous ID: aee2d4 May 3, 2018, 7:40 a.m. No.1285645 🗄️.is 🔗kun >>5703

>>1285640

THANK GOD SOMEBODY CAUGHT IT!!

I was beginning to think I was the only one who got it!

Anonymous ID: ee7c64 May 3, 2018, 7:40 a.m. No.1285646 🗄️.is 🔗kun >>5737

>>1285600

>When you load a truck, you put the heavier stuff over the axles, you have to distribute the load correctly when you load the trailer.

You are correct unless there are only three (or even 5) pallets. The loading above the goose neck is not only normal but necessary to install the load lockers to prevent movement back and forth..

Anonymous ID: 903612 May 3, 2018, 7:40 a.m. No.1285647 🗄️.is 🔗kun >>5937

Anonymous ID: 024e28 May 3, 2018, 7:40 a.m. No.1285648 🗄️.is 🔗kun >>5727

>>1285448

last I had was the number 4 discussion, pic related

>>1285615

They are used to designate targets or direct fire in the military.

>>1285641

ALREADY RAKED

>>1285637

Have we figured out where this airport is yet?

Anonymous ID: 5cda55 May 3, 2018, 7:41 a.m. No.1285652 🗄️.is 🔗kun >>5679

This makes believing into aliens a piece of cake.

And I don't find this hard to believe either.

Anonymous ID: 6054bc May 3, 2018, 7:41 a.m. No.1285653 🗄️.is 🔗kun >>5674

>>1285642

If Jetblue isnt relevant, why did Q take 2 pictures of a plane flying? Unless it was relevant to Apple headquarters in china

Have we reached a consensus on what "think google [new pixel phone]" and "think apple [vs. Samsung]" means yet?

A tweaked version of the pallet pic, it almost appears maybe the number 10 written on the left pallet. The pallet on the right also appears to maybe have a frame, if you look at the vertical line meeting with the horizontal lines - maybe a server enclosure?

>>1285448

Rubber bullet Baton theory for your consideration, still playing catch up so not sure about your inquiry

>>1285531

>>1285626

bye

Anonymous ID: 401a68 May 3, 2018, 7:42 a.m. No.1285658 🗄️.is 🔗kun >>5690

>>1285568

>>1285590

Forbes list, MSNBC, etc…yes, a celebrity.

>>1285613

Not just about Hollywood, anon. (pic related)

http://www.crazydaysandnights.net/search?q=beatrice&max-results=8

>>1285480

They be trying to catch him riding dirty but have come up bupkas on Russian collusion, Stormy etc…

Anonymous ID: ae410e May 3, 2018, 7:42 a.m. No.1285660 🗄️.is 🔗kun >>5678

>>1285624

> John Jay McCloy

He's a bad one alright. He was deep state before deep state was cool.

Apache Keystone

>>1285644

GOT EM

Anonymous ID: a87a8c May 3, 2018, 7:43 a.m. No.1285663 🗄️.is 🔗kun >>5673

>>1285602

>campaign contributions, played no roll in this transaction.

see what he did here? roll not role

typo = rick roll

= bait and switch

coincidence?

NOT

potus is so funny!

>>1285437

Any new updates?

Jokes aside, SAP is in the same big date & AI business as amazon, google et el. I attending a SAP presentation a couple of years ago about a project in San Palo Brazil where HANA is connected to a live data feeds from 1000's of security cameras across the city. Based on facial and license place recognition and travel patters of everyone, they claimed the system could quickly identify suspects when crimes happened and could also predict who was GOING TO commit a crime. The predictions where supposedly filtered out to the cops on the street to look for and watch the pre-crime suspects.

>>1285640

see above post

Anonymous ID: 45364b May 3, 2018, 7:44 a.m. No.1285667 🗄️.is 🔗kun >>5847

F-35 P - F-35 plane

Lockheed Martin F-35

https://en.wikipedia.org/wiki/Lockheed_Martin_F-35_Lightning_II_development

Anonymous ID: 556a87 May 3, 2018, 7:44 a.m. No.1285668 🗄️.is 🔗kun >>5675

>>1285585

I cant vouch for wether this is a common format .. but it is used in Microsoft Sharepoint's databases.

8-4-4-4-12

Corner protection for boxes maybe?

supplemental addition

>>1285602

see what else potus did here?

he denied the stormy settlement

msm now claims he lied

seems obvious

but the settlement was not stormy so he did not lie

stable genius

Anonymous ID: e030f9 May 3, 2018, 7:45 a.m. No.1285672 🗄️.is 🔗kun >>5817

finally found the tweet

>>1285663

Mandatory if you say Rick Roll

Anonymous ID: 70e6f0 May 3, 2018, 7:45 a.m. No.1285674 🗄️.is 🔗kun >>5689

>>1285653

As stated, the photo shows Q was at a location. The location has been identified as the San Jose area, the home of Apple. Did Q visit Apple HQ? When and why?

Anonymous ID: 49bf86 May 3, 2018, 7:45 a.m. No.1285675 🗄️.is 🔗kun >>5708

>>1285668

Lord help them if they store the evidence on Sharepoint.

Evil Trips - Evil Toe!

>>1285614

Yeah but to keep making the $ame mi$take over and over and over?

>>1285624

>>1285660

He was 2nd President of World Bank after founder Eugene Meyer failed to establish the Bank at Wallstreet.

His work between 49 and 52 as high commisioner in Germany is also hard to believe.

Mind blown by this guy.

>>1285652

Interdasting pics caught the other day here.

>>1284552

that's high autism anon. Q crumb above + new @realDonaldTrump banner related?

>>1284638

brilliant idea…from Pentagon to hex-a-decimalgon. love it.

>>1285572

>last pic related?

ICYMI, also related & educational: FEBRUARY 27, 2018

Fiscal Year 2019 Cyber Command Budget Request

Admiral Michael Rogers note missing 's' on c-span.org is director of the National Security Agency and the head of U.S. Cyber Command, which runs the military’s computer network defenses.

>https://www.c-span.org/video/?441677-1/nsa-chief-testifies-fiscal-year-2019-budget

>>1285629

BAKER pls ADD

THINK THAT'S A DEVELOPING NOTEABLE

Anons,

Found another connection

Marker and corresponding Q post.

Anonymous ID: 401a68 May 3, 2018, 7:46 a.m. No.1285683 🗄️.is 🔗kun >>5696

Manafort Lawyers Claim Leaky Mueller Probe Has Provided No Evidence Of Contacts With Russian Officials

thefederalist.com/2018/05/03/manafort-lawyers-claim-leaky-mueller-probe-has-provided-no-evidence-of-contacts-with-russian-officials/

The alleged lack of evidence would be in sharp contrast to the repeated leaks from anonymous

but highly placed government officials that led to the appointment of a special counsel.

The special counsel’s office says it has no evidence in its possession responsive to Manafort’s

request for transcripts, notes, or tapes of any and all conversation or contacts between Russian

intelligence or government officials and Manafort, according to the filing.

>>1285643

This

Is it a hand truck on top.

>>1285624

Good info.

>>1285674

Hints:

POTUS tweet caps: SJC FBI BAD

Investigation report

https://oig.justice.gov/reports/2018/o20180413.pdf

>>1285658

>>1285613

THIS. Many other examples.

>>1285637

No windows?

There's a lot of talk of heavy water in Iran deal. It's required that they ship it out of Iran I believe to countries on the deal

Reading couple past breads. Regarding random info drops after first pics i.e. Qf35 or whatever. I remember Q saying something to the effect of his info drops are not only for us anons. And since then, Q has told us repeatedly that the whole world is watching. Perhaps someone is trying to setup comms with a close by F35 strike fighter? Just the vibe I got from Qf35 drop.

>>1285603

interesting…

>>1285683

lmao, thats great!

it could be gold. other precious metals. anything of extreme value in the physical form.

>>1285625

al franken too

Anonymous ID: e3c319 May 3, 2018, 7:48 a.m. No.1285699 🗄️.is 🔗kun >>5717

that's a long ass BIG TOE anon

Anonymous ID: 5479dd May 3, 2018, 7:48 a.m. No.1285700 🗄️.is 🔗kun >>5705

130k

AC-130

Anonymous ID: 903612 May 3, 2018, 7:48 a.m. No.1285701 🗄️.is 🔗kun >>5749

Sarah is a class act!

This would fit with what we know about the reefer. But where did the stuff come from?

>>1285645

for those who didnt…

Anonymous ID: f31949 May 3, 2018, 7:49 a.m. No.1285704 🗄️.is 🔗kun >>5753

>>1282527

I GOOGLED HOW TO WIND A CLOCK

"To wind the clock simply place the key, or crank, into the winding point and turn clockwise sixteen revolutions. When the clock is fully wound an internal mechanism will prevent you from winding any further"

>>1285700

hmmm

>>1285558

been trying to say this myself but after 3 times being called an idiot,shill,clown I gave up. Morningstar payments confirms this was what was meant

>>1284721 THE ANTI Christ MUST BE REVEALED FIRST!

>>1284682

AND DRINK STARBUCKS. WHAT IS IN THE COFFEE?

>>1285675

Turns out that the 8-4-4-4-12 is a completely standard thing …. a UUID …

https://en.wikipedia.org/wiki/Universally_unique_identifier

In its canonical textual representation, the sixteen octets of a UUID are represented as 32 hexadecimal (base 16) digits, displayed in five groups separated by hyphens, in the form 8-4-4-4-12 for a total of 36 characters (32 alphanumeric characters and four hyphens). For example:

123e4567-e89b-12d3-a456-426655440000

xxxxxxxx-xxxx-Mxxx-Nxxx-xxxxxxxxxxxx

The four bits of digit M indicate the UUID version, and the one to three most significant bits of digit N indicate the UUID variant. In the example, M is 1 and N is a (10xx), meaning that the UUID is a variant 1, version 1 UUID; that is, a time-based DCE/RFC 4122 UUID.

The canonical 8-4-4-4-12 format string is based on the "record layout" for the 16 bytes of the UUID

Anonymous ID: 648f53 May 3, 2018, 7:49 a.m. No.1285709 🗄️.is 🔗kun >>5745

>>1285398

When the cat herding gets out of hand, break out the laser pointer. Autists love the point of light if you move it fast enough. Keeps 'em occupied when they get restless.

does this bother anyone else?

the word is awakened.

I notice no one uses it, even broadcasters, who are suppose to speak the english language.

Anonymous ID: e49e9d May 3, 2018, 7:49 a.m. No.1285712 🗄️.is 🔗kun >>5721

I have a feeling that something big is about to happen. It wpuld be smart to drop the cohen payment bombshell rigjt before anothet huge bombshell that will take the attention off cohen.

Im expecting something to drop soon.

Anonymous ID: edc754 May 3, 2018, 7:49 a.m. No.1285713 🗄️.is 🔗kun >>5722

It looks they used thin metal bands (I don't know the actual name for it) to hold the boxes together, then shrinkwarpped over it. That would be my explanation for the vertical lines.

I don't think it is a server frame, both pallets look like they're made up of multiple smaller boxes.

Whoever packaged them went out of their way to make sure they would be secure.

http://www.keystone-engine.org/

>>1285563

Same mind virus.

Anonymous ID: bac19f May 3, 2018, 7:50 a.m. No.1285716 🗄️.is 🔗kun >>5723

Shot is the dark as to what is on those pallets.

Rigged Voter Booths or equipment

>>1285699

a longggggg (v) toe

This one wont age well

Anonymous ID: ae410e May 3, 2018, 7:50 a.m. No.1285719 🗄️.is 🔗kun >>5742

>>1285642

>Consider where Q was, and when, and why.

I wonder if EM's meltdown was related.

https:// www.zerohedge.com/news/2018-05-02/musk-meltdown-tesla-tumbles-after-elon-cuts-conference-call-question

>>1285574

Ok but please don.'t make the insane leap of faith required & devolve into FLATTARDERY the ridiculous psyop that (((they))) try to use to discredit all "conspiracy theories" with since around 2015.

>>1285712

I agree. RG threw out more bait to the media last night so something is going on behind the scenes.

>>1285713

My bad, pic unrelated. It was still on my clipboard

>>1285716

use it now, for God's sake!

Anonymous ID: d0fd8f May 3, 2018, 7:51 a.m. No.1285724 🗄️.is 🔗kun >>5996

How Tim Cook Will 'Double Down' On Apple Secrecy: An Underground Bunker

I sense Q incoming…

>>1285412 (me)

>>1285422

>>1285464

FUCKING HELL ANONS

I think I found it.

Check out this source, got KICKED offline as soon as I found it (#coincidence)

IRIS SCANS are used to scan for AIDS, CANCER, HEREDETORY diseases and a whole bunch of other stuff.

Did you know that??? I sure as fuck don't!

So why don't they scan us huh?? no one has to "find out too late".

http:// smallbusiness.chron.com/dangers-retinal-scanners-70631.html

SO Adreno + chrome + iris scan + your location + your metadata = they can look for PERFECT healthy yummy specimens, and I have NO DOUBT (guessing here) that 5g or other nasty frequency shit makes (young) people produce moar adrenochrome.

That's why there all going ape shit and triggered into clubbing someone over the head for wearing "the wrong prom dress.

>>1285648

Q POSTS PHOTO ID

B3D12FDF-7189-4836-AD41-F4

DB0379CC-9229-43B5-AD54-F4

EB072EBC-0DF3-4A2C-BE89-E3

8466691D-0F75-44F5-AA92-43

39E6E8ED-2D45-4AB9-A4EA-68

901FFF2C-CFFC-4586-8226-7

9E1AB60E-071C-4226-ADEC-B

95DDEF59-7086-4535-985D-5

0568570F-2EA7-4162-A75F-4E

A3589E21-85D1-4056-9DC7-5

703C92E0-E064-4400-932F-2

83139841-57B9-47B5-8FA6-D

AA00D4A7-BF25-44EC-BB62-4

BC185452-3F1B-493B-98D9-92

EFABC59D-40D3-4570-81E3-5

C8F91EAD-51C7-47FA-96C5-C

72C68DD2-F512-4DC8-ADA8-E

CAFB8AB7-539E-4AFB-9EC0-E

CC1B1FD7-8B70-4CEB-A4F7-F5

89F919D3-5900-4DCA-BA1B-DB

25666BD0-F5F9-4A63-AE62-4A

C13A8327-8986-4D5E-AC6B-EC

EA29DD13-F16F-4580-9DC8-0D

8B01A899-533A-4231-8BAF-6

763B79E9-EA56-4EBD-A42A-2

EF3D1B1B-2E68-4FD4-814F-E

B42CA278-6C32-4618-A856-0

D6C46F7A-C7B1-4A32-9576-E28854C1C1DC

F0704A26-CA59-40E8-9285-5

ABD8260F-EBBB-4C18-A9AE-8

13372080-45DC-4E32-B340-3

31506F85-476A-4DD6-BDF4-56

C879615C-3616-402C-B3F6-81

FC8DF5A5-6BB2-4A87-90BF-B4

CBFE279C-FAD2-403C-A11C-E

683C2B19-0FF1-4C01-B33B-3C

32AD9484-F41A-4806-AD48-6C

18454392-100A-4B49-A774-67

784A60C6-B1C0-4DCE-ACE1-A9

BF865568-AABA-4354-A7C6-18

18A539B4-3085-4E11-8945-D

B1ADF2C9-65EF-42CB-A3D8-8B

7F0F82A1-151F-4868-96EE-054CE9876425

7803B61A-1F3E-47BD-88D4-F

DEA28E7A-5339-4D0B-A991-AB

482D19E4-6664-478F-8836-30

3155B65F-063D-445E-A3BD-5

2C880EB2-FFFC-4E95-B22C-B

5D00DA74-A956-474C-A7A1-5

8BF7AC13-C658-41A6-A0E3-8

54950FD4-115E-404E-B1DF-4

A783B991-11D9-40D0-BD69-1

710102CD-50EE-4035-93E4-6

E349DAAB-AEE3-45EF-B056-2

C2C6E563-AEEE-46D4-95F9-0

9AB57841-1F3F-4630-889B-4

77C6EF7B-C1F0-49A6-BD1E-C

29ABE882-37B0-472A-A79E-F

9B7BDECB-79FD-4D3C-BE97-A

BA1C5CD5-5C3B-4FE5-93B1-F

540296AD-9205-4253-B4CF-B

25346004-2104-4DBA-9B88-E9

B6C47FD8-1F66-4549-8A4B-2

0704911B-FBA8-4DE7-9C53-9

03821C90-07E4-4906-B30D-A

6AECCB3F-2186-4C21-9749-06

C7248201-F913-4F0C-A667-9

Exec_y.png

c7829.jpg

DUGtJVsU8AElqAt.jpg-large.jpg

Unknown.jpg

switzerland-davos-forumjpe….jpg

alkd839.jpg

6a0120a610bec4970c0162fc20

kT4H8Kfh.jpg

soros-and-rothschild.jpg

rothschilddavidwjcyfranc.jpg

QFF.jpg

RTM.png

learn-some-history-13th-am

Unknown.jpg

WDSHN_ISIS_TRAITOR_NN.jpg

Clown_Comm_Narrative.png

FREEDOM_.png

NSA_Traf_CAM_LONDON2847.png

Just_Waiting.png

Anonymous ID: 670731 May 3, 2018, 7:51 a.m. No.1285728 🗄️.is 🔗kun >>5763

Dedicated shipments are common. The truck doesn’t have to be full. These guys are rich and don’t want to intermingle their load with another. Likely high value or sensitive.

>>1285718

He's right.

They did it right out in the open

JetBlue has the Caribbean covered.

file size not equal to res. photoshop datasnip. layers? orig image - black layer - low res crumb plane pic?

“Eric Bolling, one of the most influential and successful conservative media figures, is joining CRTV, announced CRTV president Gaston Mooney,” a press release from Conservative Review reads."

http://dailycaller.com/2018/05/03/eric-bolling-new-show/

Ugly-ass toes…..cover that up!

>>1285727

>>1285726

QUOTE FROM WEBSITE

>Health Risks

Retinal scans are often used in health scanning procedures – to identify communicable diseases including AIDS, chicken pox and malaria – and to scan for hereditary diseases including various types of cancers. The scan itself poses no threat to the eye or to your overall health, though users of retinal scans complain of discomfort from the technology as they must lean in and keep their eye close to the machine for 30 seconds in order for a scan to be accurate.

Anonymous ID: 10216b May 3, 2018, 7:52 a.m. No.1285736 🗄️.is 🔗kun >>5775

C-130 looks like remotely controlled. Normal descent, then suddenly dives and corkscrews into the ground.

9/11 airplanes into WTC seemed remotely controlled. One 747 captain said he couldn't turn a 757 or 767, whatever it was, as tightly as one turned going into one of the towers.

This control can be accomplished thru the Flight Management System, locking out the cockpit and flying thru the FMS. I read some posts saying that tech. had indeed been developed. Heavy jets all have FMS and have for years. Smaller ones like 737 I am not sure.

C130 crash happened right after Trump blamed Iran for 9/11 by demanding repayment from them. Was the C130 crash Iran spitting at him because of this?

Anonymous ID: 345feb May 3, 2018, 7:52 a.m. No.1285737 🗄️.is 🔗kun >>5812

>>1285646

Yup. Also, the second pallet back on the right seems to be of a different height, suggesting that the boxes are of a different size possibly indicating a different product than the other pallets. No idea if that even matters though.

Anonymous ID: 164379 May 3, 2018, 7:53 a.m. No.1285738 🗄️.is 🔗kun >>5808

Can someone please tell Q that when taking photo shots to please go widescreen, so we can actually make out what he's posting?

Anonymous ID: e9a1fb May 3, 2018, 7:53 a.m. No.1285739 🗄️.is 🔗kun >>5818

>>1285625

>>1285534

It's not. This faggot has 20 other posts about random horseshit in this bread.

>>1285719

Q wasn't there. a trusted person, watching the area was there. But the Q team, I doubt. that's what operatives are for.

>>1285629

Add this to it. 2012 seems significant here. Iran, China, Hong Kong all related.

Secret Pallets of cash flown? Or maybe spy equipment sent it’s refrigerated.

Anonymous ID: b97d2d May 3, 2018, 7:53 a.m. No.1285744 🗄️.is 🔗kun >>5913

>>1285583

e for Eric Schmidt?

e for Edward Snowden?

>>1285709

indubitably

Anonymous ID: b40f65 May 3, 2018, 7:54 a.m. No.1285746 🗄️.is 🔗kun >>5761

>>1285631

Excellent! Any more like this that you have discovered?

Fentanyl in the boxes?

>>1285325

All the other pallets were in front of those. They were the last one's to come off.

And who says that pallets with boxes full of money can't be lifted? I saw that comment previously on here from someone else.

Anyone whose ever operated a fork truck will tell you that merely taking some weight of the pallet off the floor allows you to slowly drag/slide the pallet out if need be.

Does anyone really think that whomever went to this amount of trouble didn't think through how they would unload or distribute boxes full of cash?

Assuming it is cash, of course.

>>1285701

Love our SHS - Warrior Princess of Press Secretaries !!!!

GERMANARCHIVEANAON UPDATE

I added #1593 to #1610 to the folder, and updated the checksums.

mega.nz/#F!LPZxEIYJ!N5JwCNoxOxOtAoErKdUgvw

1593-1610.zip MD5: 19e1afbe9ed6f8df09f1fdd7329b8d82

The archive now contains 1616 breads.

The ZIPs contain .webarchive files as usual. So these files are still SAFARI ONLY.

GERMANARCHIVEANON OUT

Anonymous ID: 5cda55 May 3, 2018, 7:54 a.m. No.1285751 🗄️.is 🔗kun >>5755

BIG POST.

SSP = Secret Space Program.

My fav secret space programs is pleiadians <3

Where is this airport?

>>1285704

so any links to the number 16 in crumbs?

>>1285587 >1285608

>>1285556 <Agree.

Anonymous ID: 8c78b9 May 3, 2018, 7:55 a.m. No.1285755 🗄️.is 🔗kun >>5777

>>1285751

That’s according to Apple Insider, which today posted a number of photos taken outside the 70,000 square-foot building, reportedly referred to by employees as “Athena.” Shipments of equipment, wrapped in anti-static foil and labeled “delicate instruments,” have become routine at the facility in the months since Apple acquired it.

This activity suggests that Apple plans to put the facility to work, but for what is far from certain. Apple designs the processors in its mobile devices, but it contracts the actual manufacturing out to Taiwan Semiconductor Manufacturing Company and Samsung.

https:// www.digitaltrends.com/apple/apple-fabrication-building-san-jose-california/

Exclusive: Apple's top secret 'Athena' chip fab gets new 'delicate equipment'

https://iphone.appleinsider.com/articles/16/04/29/exclusive-apples-top-secret-athena-chip-fab-gets-new-delicate-equipment

Could this be a possibility?

Just found this article regarding a large fentanyl shipment from China:

Mar 28, 2018 3:29 pm ET

Men Shipped Fentanyl, Carfentanil From China To Montco Homes: DA

Breaking: The pair shipped massive quantities of the lethal drugs from China directly to doorsteps of Montgomery County homes, the DA said.

https:// patch.com/pennsylvania/norristown/men-shipped-fentanyl-carfentanil-china-montco-homes-da

>>1285620

e for inadmissible "e"vidence?

>>1282527

Wind a clock 16 times is that the 16 year plan, is the key a number of a man, who is the anti Christ? 666 Is this Hillary's handler? Is he more evil than Soros? And is 17 Q the new plan?

Anonymous ID: ae410e May 3, 2018, 7:56 a.m. No.1285760 🗄️.is 🔗kun >>5772

>The pallet on the right also appears to maybe have a frame

Why don't the pallets have holes for the forklift? Are they on roller pallets for an air drop?

t. teamster

Anonymous ID: 56a8a7 May 3, 2018, 7:56 a.m. No.1285761 🗄️.is 🔗kun >>5937

>>1285746

Unfortunately not, another anon made that a few weeks back and I happened to save it – thankfully because it was 404'd for some reason.

Definitely an area to dig on though

Rubio walks back criticism of GOP tax law

www.politico.com/story/2018/05/02/marco-rubio-tax-law-response-565586

>>1285728

The picks look like they may be server racks. Or, maybe, storage racks with tons of drives. Could be moving a lot of currency in the form of crypto contained within.

Maybe. Refrigerator truck would make sense, you would want to keep the equipment cool, even when powered off, to make damn sure no data is lost.

>>1285380

filter this obvious shill

Anonymous ID: c33a3e May 3, 2018, 7:57 a.m. No.1285766 🗄️.is 🔗kun >>5893

bakers

>>1285750 GERMANARCHIVEANAON UPDATE

to replace

>>1285137 Threads & Research Section

>>1245678 Germanarchiveanon

>>1285750 Germanarchiveanon

ohalso

>>945864 EMINEM THREAD

fell off the board

>>1285579

from the maybe-q post:

(LEARN O.C.)

I would say who ever said san Jose was correct.

Anonymous ID: 51783e May 3, 2018, 7:58 a.m. No.1285769 🗄️.is 🔗kun >>5780

My initial thought when I first saw it last night was that it was somewhere in Asia. But at SFO you do fly over the Pacific right before landing.

>>1285255

Just come back to the thread so not 100% sure what this is about. However, Mark Thompson covered up the Jimmy Savile affair at the BBC. He blocked a documentary that was going to out Savile as a Pedo. Then he escaped the country with a parachute job at the New York Times I think.

https://www.telegraph.co.uk/news/uknews/crime/jimmy-savile/10512203/Former-BBC-boss-Mark-Thompson-lied-over-Savile-evidence-Nick-Pollard-claims.html

https://www.theguardian.com/media/2012/oct/16/new-york-times-mark-thompson-jimmy-savile-bbc

>>1280036

>>1280616

Any link between Apple and plane Q circles over Hagerstown,"The Hub" shipping center?

>>1285760

There are traditional slots for a forklift to pick them up. He changed the original image to try to catch anything that couldn't be seen in the original.

>>1285685

“Accordingly, if the representations of the Special Counsel are accurate, and there is not, in fact, any evidence of communications between Mr. Manafort and foreign officials, then the perpetrators of this elaborate hoax must be identified and punished and the substantial unfair prejudice to Mr. Manafort must be remedied,” the filing continued.

Interesting article, ty anon !!!!

Anonymous ID: 4c53f3 May 3, 2018, 7:59 a.m. No.1285775 🗄️.is 🔗kun >>5803

>>1285736

Keep in mind this C130 was VERY old, and was on its last flight to AMARG in New Mexico for mothballing. In fact it was probably one of the least-automated C130s flying today so any sort of hacking of the FMS is less than likely. Most likely reasons IMHO: Broken control linkage, shifted CG, loss of hydraulics, rudder actuator failure, flaps set incorrectly.

>>1285134

>>1285012

As I have repeatedly pointed on on Boards & SM,…….

The Pacer dot gov records are Sealed, so IMPOSSIBLE to know which are actually INDICTMENTS.

But keep following. . . . the numbers here are staggering & obviously atypical.

This is real.

Here's an amended one to reflect the RECORD.

TY for the attorneys & Anons behind the scenes working to tabulate on their own time…. & paying Pacer for the counts. YOU are patriots.

Winning will be Glorious!

#WWG1WGA indeed.

https://

www.pacer.gov/

Anonymous ID: 5cda55 May 3, 2018, 7:59 a.m. No.1285777 🗄️.is 🔗kun >>5794

>>1285755

>muh aliens

Have they ever mentioned Pleiadians? Do you know what Pleiadians are? And how you can get in contact with them? All you can hear is

>muh distraction

>muh unexplained

>muh man made

>muh threat to national security

Secrets, fear mongering, PARTIAL disclosure.

We are in for a FULL DISCLOSURE.

>>1285753

There are only two.

This one:

[The 16 Year Plan To Destroy America]

And this one:

How bad is the corruption?

FBI (past/present)

#1

#2

+29 (16)

DOJ (past/present)

#1

#2

+18

STATE (past/present)

#1

+41

I think with the markers we make like a clock and use a key in the middle and turn it 16 times?

Wonder who the major individual owners are of JetBlue?

http:// investors.morningstar.com/ownership/shareholders-major.html?t=JBLU

>>1285769

No you don't. You've obviously never been to SFO

>>1285718

>>120030 Embedded in pic data - looks to be programming

http:// www.w3.org/TR/rdf-plain-literal/

>>1285567

Haven't they heard, "crime don't pay"?

You guys are overthinking this.

Salisbury-gate smoking gun found? Initial reports said Skripals poisoned with Fentanyl

Nick Griffin

Sott.net

Tue, 01 May 2018 20:00 U

>>1285726

This company uses facial pictures to identify genetic disorders. It used as part of the screening process at medical centers. They claim its very effective.

https:// www.fdna.com/

money (laundering) beauty industries >feminine occult symbols

these people seem interested in DNA (every product has some sort of double helix like promo graphic)

american society for aesthetic plastic surgury inc == Nefertiti (conehead - king lineage? - vanity)

award statues for the beauty industry = gold female with wings "goddess"

Anti-Aging & Beauty Trophy

1st BIOPTRON (redcross insignia)

2nd mesoestetic

3rd Teoxane Laboratories +(redcross insignia) (RHA-4)

4th …..{lost interest}

(swiss) & all that but that, i know

but crosses stood out seems like an Lynn [LdR] & Red cross sorta thing,

might need a beautyfag? don't know the industry

could be nothing but i'll nick a bit of bread incase anyone else is on the beauty industry

>>1285764

Date and time of posting???

>>1285238

That Hillary email is one of the "From Hillary To Hillary"… where they were probably all just using "drafts" without sending, THINKING they couldn't be surveilled/captured. But Q said THEY HAVE IT ALL… INDEED THEY DO!! oh Hillary and Cheryl Mills, not as smart as you think you are!

Maybe Q is showing us the extent of technology that is available. Were those pictures captured off of other people's phones. Perhaps even different phones. JetBlue has integrated apple wallet check-ins. Apple has given it all up. Think of Eagle Eye and Empire of the State. With geospatial information and root device access, "he has it all".

Want to see a story of shipping Apple products to HK? Now you have and from multiple perspectives.

Q has given us a demo and he could be on the east coast for all we know!

>>1285785

https

://www.sott.net/article/384462-Salisbury-gate-smoking-gun-found-Initial-reports-said-Skripals-poisoned-with-Fentanyl#

>>1285778

number games are not in my wheelhouse anon

i wish i could help

Anonymous ID: 8c78b9 May 3, 2018, 8:01 a.m. No.1285794 🗄️.is 🔗kun >>5811

>>1285777

stfu

>>1285789

was just on my fox page so now

I can't find the same perspective as Q's pics but here is SFO.

>>1285726

BAKER

Notable!!!

Just a thought… Q posted a handful of random pics because (like 95% of us here), Q was also sick and tired of reading shit about Jews and gave these stupid fucks something new to play with.

I can't find the same perspective as Q's pics but here is SFO.

Anonymous ID: 903612 May 3, 2018, 8:02 a.m. No.1285800 🗄️.is 🔗kun >>5822

BAKER

Sealed indictments up to almost 29k!!

→ >>1285776

Holy shit!

>>1285602

VERY plausible &

NOTABLE imho

—-

btw: Rudy said it's VERY common for lawyers to handle that sorta smut claims themselves, SOP, and pay the STFU money. they get reimbursed thru their monthly retainer. Probably the only reason a client has this lawyer, gets a nice fee and has to handle the bimbo squad out of pocket

If it's in the US I say it is def out west to start

Anonymous ID: 777edd May 3, 2018, 8:03 a.m. No.1285803 🗄️.is 🔗kun >>5843

>>1285775

Pretty sure that the EMP, electronic tricks, etc. are out the window, right? I am not a planefag, but don't think that a C130 would have most of the more recent electronic controls.

Anonymous ID: b06664 May 3, 2018, 8:03 a.m. No.1285804 🗄️.is 🔗kun >>5937

This marker thing looks very promising. Spider web marker.

Crude image, but:

Looks like this string of messages points to falsifying identities to keep them secret, move them thru society and then put them out there on behalf of the cabal.

Connect this line.

Angela Merkel

Ray Chandler

NoName's wife

Is the spider web marker all about this?

There is a major shift underway in the public sentiment that is underscoring why our computer has been forecasting the collapse in Marxist/Socialism. The message of the Democrats has been the same since the Great Depression – vote for us and we will rob those who have more and give it to you. When we just look at the fact and put aside the political biases, the chart shows a very striking trend. When we combine both the Senate and the House and then plot the number of seats each party held as a percent of the whole combination, we see that the Democrats peaked with FDR. They have won at times ever since, but the percentage of seats held has been gradually declining.

Now an online survey of more than 16,000 registered voters ages 18 to 34 has revealed that support for Democrats over Republicans in Congress has continued to decline among the youth. It has fallen another 9% since the 2016 election to just 46%. The responses say that the Republican Party is a better steward of the economy. This should come as no surprise. The entire Marxist agenda resonated with the Great Depression generation as the Marxists blamed corporations and never mentioned the Global Sovereign Debt Crisis of 1931. The younger generations are simply viewing the world differently as to what they can do themselves rather than what government can do for them. They simply want to keep more of what they work for. The Marxist message of the Democrats is gradually fading out. Equal Justice for All means it should apply fairly to everyone, not just some.

-Armstrong Economics today.

https: //www.armstrongeconomics.com/international-news/politics/the-changing-wind-in-politics-by-generation/

>>1285780

Tell that to my family in San Francisco.

Anonymous ID: 4d87a3 May 3, 2018, 8:03 a.m. No.1285808 🗄️.is 🔗kun >>5823

>>1285738

Does it matter when the images are heavily cropped?

>>1285764

IMHO, once this BS/fake case ends, Q swings immediately to the offensive.

>>1284613

The process starts in China, where pallets of iPhones are moved from factories in unmarked containers accompanied by a security detail. The containers are then loaded onto trucks and shipped via pre-bought airfreight space, including on old Russian military transports. The journey ends in stores where the world's biggest technology company makes constant adjustments based on demand, said people who have worked on Apple's logistics and asked not to be identified because the process is secret. https://www.engadget.com/2013/09/11/the-logistics-behind-transporting-millions-of-iphones-from-china/

Anonymous ID: 5cda55 May 3, 2018, 8:04 a.m. No.1285811 🗄️.is 🔗kun >>5830

>>1285794

Superimposing Jordan Sather over David Wilcock only gets people two sources of information in one image.

p.s. careful with COBRA, contact was lost recently

>>1285737

Looking at it some more, it looks like there is a box missing on the one in the back because of the way that the shrink wrap sags. That usually happens when you take a box off the top and creates slack in the tension of the shrink wrap.

Anonymous ID: 7f92d4 May 3, 2018, 8:04 a.m. No.1285813 🗄️.is 🔗kun >>5865

Ref to 130 could be Notable

>>1285786

So why THE FUCK do they let us die of cancer if all it fucking takes is a 30 sec retina scan????

I'm gonna dig if they can measure hormonal levels in a ret scan. Get someone with elevated adreno chrome levels?? YUMMY

>>1285809

completely agree

the end of the which hunt, SIGNALS PHASE [3]

Anonymous ID: 51783e May 3, 2018, 8:05 a.m. No.1285816 🗄️.is 🔗kun >>5829

What about JA??

>>1285672

>>1285531

Anonymous ID: 2b2eb8 May 3, 2018, 8:05 a.m. No.1285818 🗄️.is 🔗kun >>5825

>>1285739

Timestamps important.

Countdown?

Markers.

>>1285809

me hopes so, the plan is coming along as planned

>>1280036

Jetblue and Apple pioneer together with facial recognition techniques. A very dangerous development. (picture related)

Anonymous ID: e02a8a May 3, 2018, 8:06 a.m. No.1285821 🗄️.is 🔗kun >>5866

That is SJC, San Jose International. The plane's wheels are up so it is taking off. If you take off from SJC to the northwest, you go over the wetlands at the south end of San Francisco Bay. That looks like the Eden Landing Ecological Reserve in the photo.

>>1285776

>>1285800

Sorry for the type = "on"

My best sources & my personal guess is most will be Sealed Arrest Warrants & Search Warrants.

Impossible to have these many Indictments w/o a record number of Grand Juries,

And so far, info on this fact has been virtually ZIPPO, Nil, Nada…..

>>1285808

Yes. You get more of those pixels filled in with detail, which means that when it's cropped, whatever you're cropping has more detail. You always start with the most amount of detail, so that as things get widdled down you still end up with the most amount of information possible.

>>1285809

completely agree

the end of the which hunt, SIGNALS PHASE [3]>>1285811

let me guess, you are here ecause of the ONE post Q replied to about incarnated extraterrestrials (which Q DIDN'T even acknowledge, he replied to the picture, and the anon used SARCASTICALLY)

>>1285818

Quoting Q. Should have posted a snap.

>>1285770

>with a parachute job at the New York Times I think.

>>1285255 confirms.

>not 100% sure what this is about.

Original sauce for the Mark Thompson dig is in Notables #1610 -

>>1284656 Left/Right TV - possible left/right up/down explanation

Looks like the NY Times is getting into Cable TV with some "innovative programming".

>Mark Thompson covered up the Jimmy Savile affair at the BBC.

Quelle surprise. Thx. for the sauce. Picture is becoming earlier, yes?

Anonymous ID: b97d2d May 3, 2018, 8:07 a.m. No.1285827 🗄️.is 🔗kun >>5860

>>1285764

Possibly Iphones due to ZTE and Blackberry in D.C. being infected w/virus?

>>1285816

USAID/CIA promoting American MSM-style journalism throughout the world. Maybe media is a keystone for the cabal.

Anonymous ID: 8c78b9 May 3, 2018, 8:07 a.m. No.1285830 🗄️.is 🔗kun >>5845

>>1285811

let me guess, you are here because of the ONE post Q replied to about incarnated extraterrestrials (which Q DIDN'T even acknowledge, he replied to the picture, and the anon used SARCASTICALLY)

Anonymous ID: 51783e May 3, 2018, 8:07 a.m. No.1285831 🗄️.is 🔗kun >>5844

Hmmmmm……..

Brennan and Clapper endorse her but her conf vote will be close?

San Jose!!

Notice same fields at top of pic.

Plane going in for landing

Anonymous ID: 78be58 May 3, 2018, 8:08 a.m. No.1285834 🗄️.is 🔗kun >>5890

Follow the LOOP

Anonymous ID: 607f0b May 3, 2018, 8:08 a.m. No.1285835 🗄️.is 🔗kun >>5877

>>1285781

Where is that "130 tons" statement from?

Anonymous ID: 024e28 May 3, 2018, 8:08 a.m. No.1285837 🗄️.is 🔗kun >>5908

>>1285727

Awesome, thanks. I'm no photofag, was it discussed how to unpack these images when we figure the key out?

Interesting

“roll” could equal bread roll, shout out to the anons

Anonymous ID: 115657 May 3, 2018, 8:09 a.m. No.1285840 🗄️.is 🔗kun >>5863

trying to learn to read the map correctly.

this is what I came up with for the 12/12 correlation to the 1/19 posts.

>>1285778

I'm lost.

Not saying your not onto something here. But it seems a bit elaborate. Even still, lets say we do this … what would be our result if we do. We unlock the key to what? Some cache of new information?

>>1285753

I've been looking for a "number sixteen" connection in regards to AS. Why do you ask Anon?

Anonymous ID: 4c53f3 May 3, 2018, 8:09 a.m. No.1285843 🗄️.is 🔗kun >>5904

>>1285803

Depends on what sort of INS sensors the autopilot on this particular C130 relied on and if the plane was flying with any sort of autopilot at the time. Theoretically, certain MEMs-based INS systems could be disrupted using electronic warfare, but doubtful this thing was using MEMs-based INS. C130s also have varying levels of EMP-hardening that would protect it from all but the most powerful of attacks.

Anonymous ID: f9f1ca May 3, 2018, 8:10 a.m. No.1285844 🗄️.is 🔗kun >>5864

>>1285831

Brennan and Clapper endorse her? THAT can't be good!

Anonymous ID: 5cda55 May 3, 2018, 8:10 a.m. No.1285845 🗄️.is 🔗kun >>5852

>>1285830

I've been here before Q mentioned or implied anything about aliens at all, because some people can see where this is headed.

qanon.pub

LEARN[OC] = learn our comms

also [A]UDIT:PENT_S2:G5

could be audit Pentagon and s2…? G5 possibly means "Group of 5"

Recent Audit of Pentagon:

"Audit finds Pentagon failed to properly keep track of $800 million in projects, says report"

https://www.cnbc.com/2018/02/05/audit-finds-pentagon-failed-to-properly-keep-track-of-800-million-in-projects-says-report.html

I think it's quite clearly multiple boxes stacked then shrinkwrapped.

Full of cash?

Anonymous ID: f5ed6b May 3, 2018, 8:10 a.m. No.1285849 🗄️.is 🔗kun >>5897

photoshopped?

NEWS UNLOCKS CRUMBS

Do the Apple/boxes/plane pics have anything to do with today being National World Password Day

WORLD PASSWORD DAY – FIRST THURSDAY IN MAY | National Day …

>>1285618

If they cut their toes of, trying to harvest rice, then they're doing it rong, lol.

Anonymous ID: 8c78b9 May 3, 2018, 8:11 a.m. No.1285852 🗄️.is 🔗kun >>5892

>>1285845

hahahahahaha

kys

Site embedded in plane pic!!!

http:// www.w3.org/2005/10/Process-20051014/cover.html#toc

That's one slippery fucking slope!

Must be San Jose bc it's only 30 min from Apple HQ. So was Q's pallet pic taken in HK or US?

NOTABLES SO FAR

#1611

>>1285096 ; >>1285225 Xiaomi (Chinese Electronics Producer)

>>1285227 You realize Trump literally tweeted the court case in a nutshell.

>>1285241 Jet Blue and Apple

>>1285363 Anon Analysis - Cook has been brought to heel.

>>1285430 Bill McDermott, CEO of SAP

>>1285496 Giuliani says 3 Americans held by North Korea to be released Thursday

>>1285528 Relative to the Aircraft Incidents and EW (Electronic Warfare)

>>1285543 Crytic Post Could Be More Than It Seems

>>1285316 POTUS tweet uses GOOD and GREAT (in that order), shout out to Q post

>>1285581 US Trade Deficit Drops Sharply

>>1285527 possible use of the word marker related to other Q posts at same time

>>1285605 ; >>1285625 Marker Graphics

>>1285629 Chinese Products in the USA

>>1285685 Manafort Lawyers Claim Leaky Mueller Probe Has Provided No Evidence Of Contacts With Russian Officials

>>1285727 Q Posts Photo ID

>>1285726 Perfect Way to Find Perfect Specimens

>>1285602 Analysis of the Stormy Situation

Anything I missed anons?

WARMING THE OVEN

>>1285386

^^^^^^^This. Notable.

Anonymous ID: 8c78b9 May 3, 2018, 8:11 a.m. No.1285858 🗄️.is 🔗kun >>5878

Sun Tzu, The Art of War

>>1285786

First your employer will offer a $100 discount on your insurance if you get The Diagnostic Scan.

Then, if you hold out against that little carrot and all the peer shaming that will come not taking the scan, they're make a condition of ongoing employment.

#imho

Anonymous ID: 8439f9 May 3, 2018, 8:11 a.m. No.1285860 🗄️.is 🔗kun >>5872

>>1285827

i do not like rudy one bit, dont trust him

he was Complicit on 911

he either flipped or potus is using him

because he does have cred with the normies

Thanks, Anon!

Anonymous ID: e97e19 May 3, 2018, 8:11 a.m. No.1285862 🗄️.is 🔗kun >>5894

>>1285840

by the way, if the [markers] analyzing anon is around: i don't think you should focus on the posts where Q says marker, but the posts containing the markers he's refering to…

>>1285844

Practically everyone in intelligence has, current and former.

>>1285813

You know where this 130 ton statement comes from?

pic here:

>>1285781

Anonymous ID: 4c53f3 May 3, 2018, 8:12 a.m. No.1285866 🗄️.is 🔗kun >>5922

>>1285821

Personally, I feel like the plane the pic was taken from was landing at Moffett field since it is at a lower altitude and to the west of the Jet Blue plane taking off from SJC Mineta International, but thats just me.

>>1285466

Which Q pics are you referring? The latest ones last appear to have nothing to do with HK (at this point).

Have you discovered a link between last night's and the ones from HK last month, etc.?

Anonymous ID: e97e19 May 3, 2018, 8:12 a.m. No.1285868 🗄️.is 🔗kun >>5920

Anonymous ID: 2ff3d3 May 3, 2018, 8:12 a.m. No.1285869 🗄️.is 🔗kun >>5916

Anonymous ID: 51783e May 3, 2018, 8:12 a.m. No.1285870 🗄️.is 🔗kun >>5887

>>1285848

It would be funny if we all found new iPhones in our mailboxes one day. Hahahaha. Qphones.

Alice connection?https://www.osha.gov/pls/oshaweb/owadisp.show_document?p_id=22695&p_table=INTERPRETATIONS

Chertoff's handrubbing intensifies

>>1285860

Smokescreen?

Anonymous ID: 164379 May 3, 2018, 8:13 a.m. No.1285874 🗄️.is 🔗kun >>5886

Now this sounds like the real shit!

>>1279851

not putting me toe theory in notables???

oh come on : )

Anonymous ID: 17b2ac May 3, 2018, 8:13 a.m. No.1285876 🗄️.is 🔗kun >>5880

Rudy Giuliani Says Trump Paid Back Stormy Daniels’ Hush Money, Rips ‘Pervert’ Comey

In an appearance stuffed with odd factual errors, like saying no president had ever before been subpoenaed, and sweeping claims about “criminal” Hillary Clinton and “disgraceful liar” and “very perverted man” James Comey, Giuliani flat out said Trump had paid back the money shelled out to buy the porn star’s silence, and that there was no problem there.

https ://www.thedailybeast.com/rudy-giuliani-says-trump-paid-back-stormy-daniels-hush-money-rips-pervert-comey

Anonymous ID: 7f2232 May 3, 2018, 8:13 a.m. No.1285877 🗄️.is 🔗kun >>5895

>>1285835

https://www.zerohedge.com/news/2017-01-09/obama-gifts-iran-massive-uranium-shipment-russia-sufficient-more-10-nuclear-bombs

There are a few others. I like zero hedge as the comments provide more stuff to look through

Anonymous ID: 401a68 May 3, 2018, 8:13 a.m. No.1285878 🗄️.is 🔗kun >>5935

>>1285858

Anonymous ID: fc2bf3 May 3, 2018, 8:13 a.m. No.1285879 🗄️.is 🔗kun >>5882

We have the best people don't we folks!

>>1285876

In an appearance stuffed with odd factual errors, like saying no president had ever before been subpoenaed, and sweeping claims about “criminal” Hillary Clinton and “disgraceful liar” and “very perverted man” James Comey, Giuliani flat out said Trump had paid back the money shelled out to buy the porn star’s silence, and that there was no problem there.

>>1285770

He's an expert on fake news, apparently.

https://www.nytco.com/mark-thompson-delivers-speech-on-fake-news/

>>1285879

The day shift today is impressive AF

Put the pictures in a particular order to tell a story

Pentagon bans sale of ZTE, Huawei phones on military bases, report says

http://www.foxnews.com/tech/2018/05/03/pentagon-bans-sale-zte-huawei-phones-on-military-bases-report-says.html

>>1285882

It's amazing what you can get done if you ignore the shills and get down to the business of HELPING POTUS SAVE THE FUCKING WORLD.

>>1285874 <

>>1285339 <

>Now this sounds like the real shit!

>>1279851 <

>>1285874 <

yeah, good stuff… sad timing with the Qdrops coming right after, it sorta pushed that momentum out of the way…

>>1279851 We need to find the key.

>>1279958 this post key to everything.

>>1280033 timestamps

This would deserve its own thread…

anyone on it?

DOIT

>>1285870

KEK!!! That WOULD be great

>>1285848

If it is intercepted cash, I can see it being shipped in a reefer truck in order to preserve possible DNA evidence of the individuals connected to the money

>>1285885

"mark it down"

>>1285834

What are they hiding in their Bunker?

I dont know where this Stormy Daniels thing is going. But the more I think about it, the more Stormy HAS to be working FOR Trump and playing some role that will ultimately benefit the storm movement

>>1285852

You really need to up your game son

Anonymous ID: c33a3e May 3, 2018, 8:16 a.m. No.1285893 🗄️.is 🔗kun >>5901

>Anything I missed anons?

see >>1285766 for small updates, not notable-related:

>>1285750 GERMANARCHIVEANAON UPDATE

to replace

>>1285137 Threads & Research Section

>>1245678 Germanarchiveanon

>>1285750 Germanarchiveanon

ohalso

>>945864 EMINEM THREAD

fell off the board

>>1285862

We are sure it's not HK int'l right? The bottom of the pic looks like there is standing water.

>>1285877

thanks

>>1285882

Day shift and Friday nights …last night was a nightmare during drops …anons arguing it’s not a reefer when it obviously is …fine if ya don’t know but correcting the educated then saying “well I drive a forklift” was just ugly last night

>>1285849

nope that is an actual toe, when i was grabbing it off the web, there was a story i glanced at.

had surgery to shorten the big toe, lmao

Maybe this one. Apple and Jetblue - facial recognition

Anonymous ID: 992ef1 May 3, 2018, 8:17 a.m. No.1285899 🗄️.is 🔗kun >>5906

MARKERS

Ok you fuck faces, here's the dealio

Q/Tweet Markers are not the only markers. That's a variety of them. Not sure what those ones are for, but those ones are number markers.

But there's many markers. For example, Q says Biden/Chine is an important marker.

Also, this fag here:

>>1282709

Has got the right zeal, but you can't count a rt as a marker too! WTF

So here's my theory.

Find markers that match each other, then check the timestamp of those two or three.

I'm not entirely sure if [marker] is a marker itself, but trying to hint that there's a marker inside the current crumb.

SNOWDEN - Hong Kong

APPLE PIC FROM Q - Hong Kong

British Monarch still OWNS Hong Kong

WE NEED TO DIG GENERAL HONG KONG

>>1285893

Meant to tell you I got that. It's done.

Just a reminder - 2 scampers involved with China

Mitch McConnell - China deal

Senator Joe Handsy Biden's Son - China deal

>>1285843

Curious thing is:

All nine crew members were Puerto Ricans who had helped with hurricane recovery efforts as part of the 198th Fighter Squadron, nicknamed the Bucaneros, which flies out of Base Muniz in the northern coastal city of Carolina.

http:// www.dailymail.co.uk/news/article-5686877/Doomed-military-cargo-plane-FINAL-FLIGHT-60-YEARS-service.html

ANONS! Another anon above pbserved that Q posted about "Find the Roll"

>>279968

Find the roll.

1 of 4.

Find the 4th.

Find the film.

Not the capture.

Enhance.

Spread.

Will go viral.

Source _ archive offline.

Raw only.

Q

Here's what we know:

The images are screenshots from Q's iphone, not taken by the camera ("Find the film, not the capture")
The number 4 always appears in the file names as the 15th digit ("4th")

Is Q trying to tell us to FIND the source film from which he took these screenshots? Something in that film is important to archive and spread.

FIND IT ANONS!!!

>>1285899 >>1285863

>>1285900

Dubs Chekked

>>1285837

example

LPFUDZUTUCVLMVMFCSTUDXURBMZAICMJWUXFCNLYOWZLSGSSWDQLWDEBWCSIXBHPMLLKABISBZCCYUEMXWVUMMSOGRCSASGEAISVYOHRZKBSAKOSDHRCJQCWPSISGGFTSMENJJGYDYIVQMGRWOKSARMCEGZJPPCUCMOJVBNAMNOLONXTHKXWEGEZHYBSNQNENRSEOXGVJWFJWVIPBVIKKZLZBESPBEJQAKSHOMHLKFDYMEYUGMHULHEBMGOFDPKBAZBSGGXQKYWARSDMSGXHDHSURWSAMSZO

VAU - S-E V-N

BJVQLSWFDQFVXOPJSRIXSNKCWCBKFJEFOVBNRAOTDLUIORBPINJQNKUYFQYRLXXIHRCFDCJIDWLWWKFWFIYABWAJAOYLLIOWFBIANRZNBHFEVXAGSSXPTEHTWIZROCESJTCPCDAGGSBQCWFLDWWZIYNHMNYQKYBRTZUHIMRFHJDGGYQQOTUBPUYREPNXEAHHRHANRECYZSHIBQFTSALBOWVVLGHUHGUMNSLRUKKJUWFTXWANDFQNXCQZNUUCOVYGVWDJJJMRLMIVOPCPONPMEWTKQMUEBJUR

??????? Doesn't look right at all. Should be something different?

↑↓ ↑↓ ↑↓

W 17× 5.9%

F 15× 5.21%

N 15× 5.21%

R 15× 5.21%

I 13× 4.51%

U 13× 4.51%

B 13× 4.51%

J 13× 4.51%

H 12× 4.17%

Q 12× 4.17%

C 12× 4.17%

O 12× 4.17%

Y 11× 3.82%

L 11× 3.82%

A 11× 3.82%

S 10× 3.47%

V 9× 3.13%

X 9× 3.13%

D 9× 3.13%

T 9× 3.13%

E 9× 3.13%

P 9× 3.13%

G 8× 2.78%

K 8× 2.78%

M 7× 2.43%

Z 6× 2.08%

#N : 26 Σ = 288.00 Σ = 100.03

ZZQ - Z-N A-C

ZHOANEYWAPHACPFWEGCARYCVZRNMOTVKVTUTMIMIZSRYRZWWTHUAUAIFDVWLADJFBAQIQOSPEDSNSTUIFTMCEXNVSXGMSDUUUOXOFRSNXOFACRMIUVCEXYZQCBNJEDBIIQMOXMVVNFDBXDBHKVNMMLQYRWWRYNMOGDUIMDYCKBFKAXNNQQMRQZZBASODHBOUHBKNKZQTALNUBHRRVQZMQQDANRVQGRKXQTEBFGLVBWHWCHQDILWNKVIYGCRCKLMXOYQUXDWJCKHWQNZNZXHAYWVRUNPLWFQE

Look like garabage? WTF

↑↓ ↑↓ ↑↓

N 18× 6.25%

Q 18× 6.25%

M 15× 5.21%

R 15× 5.21%

A 14× 4.86%

V 14× 4.86%

W 14× 4.86%

U 13× 4.51%

D 13× 4.51%

B 12× 4.17%

C 12× 4.17%

X 12× 4.17%

I 11× 3.82%

H 11× 3.82%

O 11× 3.82%

Z 11× 3.82%

Y 10× 3.47%

F 10× 3.47%

K 10× 3.47%

E 8× 2.78%

S 8× 2.78%

T 8× 2.78%

L 7× 2.43%

G 6× 2.08%

P 4× 1.39%

J 3× 1.04%

#N : 26 Σ = 288.00 Σ = 100.00

Well that didn't work for shit. Back to the drawing board. We need the Right Rotors and Plug board for this B…….

why is

Kelly Conway’s husband badmouthing geotus on twitter?

how much would anfew pallets of refrigerated adrenochrome be worth?

BAKING

>>1285908

PASTEBIN that stuff

>>1285744

Didn't POTUS tweet about an "e"?

>>1285908

OPERATIO DEFCON This seems off? Shouldn't it be OPERATION? That could be a clue. Looks like there is only one N? Maybe we got a keys right here? We need 3 rotors and the plug board. I think they normally have 2 sets? but there could be more?

OPE ← Rotors?

RATIO ←? Plug board? I guess we would have to match them up? R-A T-I

OPE Engima

IRBGJIGNIHIGIRIDKIKFTFIVRFRSTNGGIIRPWRGGIRRGIRIFIJGIIKSRIVRKIRIIIRFRSRTIRFQPIRTIRFRGRFIGIJSRURILSUFGIRGMIRIFJIIFJIOEIIVRIRNGIINLIRXGIIIGHFTIIRIPIRIFNAFQJFRGIIVGUIRRIRGBIIIIIRIRIIRFCISFIIIRIRGZIAGRIRIIIIUGIRTIRFKGRFRGIORFINRGSIRRIRGGIDLRIFIIIRFFIIUGIRGBYIRFNRFRIRIGIIIPJIRGIRRFHIRRGRGHRFFI

↑↓ ↑↓ ↑↓

I 94× 32.64%

R 63× 21.88%

G 33× 11.46%

F 28× 9.72%

N 7× 2.43%

S 7× 2.43%

J 7× 2.43%

T 6× 2.08%

K 5× 1.74%

U 5× 1.74%

H 4× 1.39%

P 4× 1.39%

V 4× 1.39%

L 3× 1.04%

B 3× 1.04%

A 2× 0.69%

O 2× 0.69%

Q 2× 0.69%

D 2× 0.69%

C 1× 0.35%

Y 1× 0.35%

Z 1× 0.35%

X 1× 0.35%

W 1× 0.35%

E 1× 0.35%

M 1× 0.35%

#N : 26 Σ = 288.00 Σ = 100.01

Seems like we are getting somewhere here. Notice that now we have 4 letters with really high frequency? Gotta mean we are geting close to something and it also means that this could be DNA since there is a high concentration of 4 letter.

OPE R-A T-I (0)

TABGJTGGTHTGTATDKTAFIFTTAFAGTNGGTTAPWAGGTAAGTATFTJGTTKSATVAFTATTTAFATATTAFQPTAITAFAGAFTGTTSATATLTAFGTAGGTATFTTTFJTTETTVATAGGTTNFTAXGTTTGHFTTTATFTATFTAFQJFAGTTVGUTAATAGGTTTTTATFTTAFCTSFTTTATAGZTAGATATTTTUGTATTAFAGAFAGTOAFTNAGTTAATAGGTDLATFTTTAFFTTUGTAGBYTAFTAFATATGTTTFTTAGTAAFHTAATAGTAFFT

↑↓ ↑↓ ↑↓

T 111× 38.54%

A 67× 23.26%

G 37× 12.85%

F 33× 11.46%

J 4× 1.39%

V 3× 1.04%

N 3× 1.04%

H 3× 1.04%

U 3× 1.04%

S 3× 1.04%

L 2× 0.69%

Q 2× 0.69%

P 2× 0.69%

B 2× 0.69%

K 2× 0.69%

D 2× 0.69%

I 2× 0.69%

O 1× 0.35%

Y 1× 0.35%

Z 1× 0.35%

X 1× 0.35%

E 1× 0.35%

W 1× 0.35%

C 1× 0.35%

#N : 24 Σ = 288.00 Σ = 99.980

Well shit we are getting closer! We have a bunch of T's, A's, and G's so we are on the right track it seems. Maybe we nee another part to the plugboard?

doesnt exist

Anonymous ID: 7b42bc May 3, 2018, 8:19 a.m. No.1285916 🗄️.is 🔗kun >>5945

>>1285869

That's a social marketing tactic. Normies eat it up. Never really appealed to me, like pretty much all of normie culture.

(Ret.) General McChrystal is on the board of directors for JetBlue.

http:// blueir.investproductions.com/investor-relations/corporate-governance/board-of-directors

Anonymous ID: 5479dd May 3, 2018, 8:19 a.m. No.1285918 🗄️.is 🔗kun >>5923

>>1285914

OPE R-A T-I O-D ← 3 on the plug?

TABGITGGTHTGTATOKTAFUFTTAFAGTNGGTTAPWAGGKAAGTATFTLGTTASATVAFTATTTAFATATTAFQPTAITAFAGAFTFTTSATATLTAFGTYGGTATFTTQFQTTETTVATAGGTTNFTAXGTTTGSFTTTATFTGTFTAFQJFAGTTVGUTTATAGGTTKTQATFTTAFCTSFTTTATAGZTAGASATTTTUGTATTAFAGAFAGTDAFTNAGTTAAWAGGTOZATFTTTAFFTTUGTAABATAFTAFATATGTTTFTTHGTAAFWTAATAGTAFFC

↑↓ ↑↓ ↑↓

T 105× 36.46%

A 66× 22.92%

G 36× 12.5%

F 34× 11.81%

Q 5× 1.74%

S 5× 1.74%

U 4× 1.39%

W 3× 1.04%

N 3× 1.04%

V 3× 1.04%

K 3× 1.04%

Z 2× 0.69%

C 2× 0.69%

P 2× 0.69%

B 2× 0.69%

L 2× 0.69%

H 2× 0.69%

O 2× 0.69%

I 2× 0.69%

D 1× 0.35%

E 1× 0.35%

Y 1× 0.35%

X 1× 0.35%

J 1× 0.35%

#N : 24 Σ = 288.00 Σ = 99.990

Same Bullshit, like it seems the F is an outlayer?

OPE R-A T-I O-D E-F ← Holy shit 4 plug's?

>Source _ Archive offline.

Sounds like we already have it hidden somewhere. Perhaps hidden in one of the pictures Q has posted?

>>1285868

I see the same standing water in both pics. 99% sure it's San Jose. 30 min from Apple HQ.

Q's pic posts are usually to confirm their ties to the president and POTUS had hos China/trade tweet late last night when Q was here. Not sure we are meant to be chasing planes, I think it is another conf of Q.

>b215f3

>e97e19

>>1285866

If the plane was squawking then it can be identified by going through the flight history data that the planefags are always showing us. Just have to find that jetBlue plane taking off at SJC on May 2 at the same time.

>>1285918

TAKGITGGTHTGTATHKTAEUETTAEAGTNGGTTAYWAGGKAAGTATETLGTTAHATVAETATTTAEATATTAEQPTAXTAEAGAETETTSATATMTAEGTYGGTATETTQEQTTFTTVATAGGTTUETAUGTTTGSETTTATETGTETAEQGEAGTTVGUTTATAGGTTKTQATETTAEVTKETTTATAGOTAGOSATTTTOGTATTAEAGAEAGTJAETKAGTTAAWAGGTQZATFTTTAEETTKGTAAOATAETAEATATGTTTETTHGTAAEWTAATAGTAEEC

Same shit? hmmm That kinda Messed it up? The O and the D don't seem to be doing it right.

OPE R-A T-I D-E F-C

TAGGTTGGTTTGTATTTTACACTTACAGTTGGTTAATAGGTAAGTATCTTGTTTTATTACTATTTACATATTACAGTATTACAGACTGTTTATATTTACGTAGGTATCTTTCTTTTTTTATAGGTTACTAGGTTTGACTTTATCTATCTACTACAGTTGGTTAATAGGTTTTTATCTTACTTTCTTTATAGCTAGCTATTTTGGTATTACAGACAGTTACTTAGTTAATAGGTAGATATTTACCTTTGTAGGTTACTACATATGTTTCTTTGTAACTTAATAGTACCT

↑↓ ↑↓ ↑↓

T 137×47.57%

A 73× 25.35%

G 44× 15.28%

C 34× 11.81%

We got it! Look at all that A T G C peoples. Ok, then we probably gotta decode this DNA into binary like before? Fack I don't have my DNAsolver.exe, Wait Nevermind I found it.

https://www.dropbox.com/s/90f580t1gn62jy8/DNA_solver.exe?dl=0

New blow for ZTE and Huawei: Devices pulled from military base stores

https://www.digitaltrends.com/mobile/senate-intelligence-committee-huawei-zte-news/

Anonymous ID: b4798b May 3, 2018, 8:20 a.m. No.1285925 🗄️.is 🔗kun >>5942

>>1285885

"Darkness cannot drive out darkness; only light can do that. Hate cannot drive out hate; only love can do that." -Martin Luther King Jr.

Anonymous ID: 5479dd May 3, 2018, 8:20 a.m. No.1285928 🗄️.is 🔗kun >>5932

>>1285923

DNA to BINARY

01001010 01011010 01010110 01000101 01010011 00110101 00110010 01011010 01010000 01001010 01000010 01000111 01011001 01010100 01010011 01000101 01001100 01000101 00110010 01000101 00110010 00110110 01010100 01000101 01001110 01001010 01000111 01010111 01010101 01010100 01001010 01010011 01001010 01010110 00110101 01000111 01000111 01001101 00110010 01011010 01010000 01001010 01010101 01000111 01010011 01010111 01010100 01001011 01001011 01000101 01011010 01000101 00110010 00110010 01010011 01010010 01010000 01001010 01001000 01000101 01001111 01010110 01001010 01010011 01001100 01000110 01010111 01010110 01000011 01010000 01001001 00111101

010010100101101001010110010001010101001100110101001100100101101001010000010010100100001001000111010110010101010001010011010001010100110001000101001100100100010100110010001101100101010001000101010011100100101001000111010101110101010101010100010010100101001101001010010101100011010101000111010001110100110100110010010110100101000001001010010101010100011101010011010101110101010001001011010010110100010101011010010001010011001000110010010100110101001001010000010010100100100001000101010011110101011001001010010100110100110001000110010101110101011001000011010100000100100100111101

BINARY TO BASE64? ←- Malformed input Guess again?

JZVES52ZPJBGYTSELE2E26TENJGWUTJSJV5GGM2ZPJUGSWTKKEZE22SRPJHEOVJSLFWVCPI=

Let's think here. If the Binary to Base64 is out putting base64 then it usually mean there it another base. Let's Try base32.

Binary to Base32

010010100101101001010110010001010101001100110101001100100101101001010000010010100100001001000111010110010101010001010011010001010100110001000101001100100100010100110010001101100101010001000101010011100100101001000111010101110101010101010100010010100101001101001010010101100011010101000111010001110100110100110010010110100101000001001010010101010100011101010011010101110101010001001011010010110100010101011010010001010011001000110010010100110101001001010000010010100100100001000101010011110101011001001010010100110100110001000110010101110101011001000011010100000100100100111101

IIQAP2L6D9K00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000

Seem Fishy messed up.

>>1285776

When the indictments are unsealed, do they drop off this list?

I'm putting this up to potentially exclude denver intl

Anonymous ID: 5479dd May 3, 2018, 8:21 a.m. No.1285932 🗄️.is 🔗kun >>5939

>>1285928

Binary to Base64

SlpWRVM1MlpQSkJHWVRTRUxFMkUyNlRFTkpHV1VUSlNKVjVHR00yWlBKVUdTV1RLS0VaRTIyU1JQSkhFT1ZKU0xGV1ZDUEk9

Base64 to Base32

KNWHAV2SKZGTCTLMOBIVG22KJBLVMUSUKJKXQRSNNNKXSTTMKJDFI23QJBLDCVSVKNWE4S2WNJLEQURQGB4VO3CCJNLFKZCUKYYVETCTGBLGCUSUJF4VKMKKKFJWW2CGKQYVUS2VGB4EOVRRLJCFKRLLHE==

base32 to MD5

d41d8cd98f00b204e9800998ecf8427e

WTF AM I DOING? No idea schwellington, Didn't that f'n Phone Booth use MD5 hashes? Hmmm making a phone call…… (760) 733-9969….. nothing new it seems. Weird song playing in the background as usual. Sounds like some Mr. Robot type stuff.

Let's get this Straight. We Did Enigma to DNA. Then we took the DNA and ran it threw the DNA_solver.exe we where given and it gave us the binary. Now we need to figure out what to do with the binary code. It seems that binary to base64 does not do the trick and output's some funny business. I also tried to go to base32 and it also doesn't seem to be doing any good with an out that looks understandable. Oh dear me what's the problem son.

Square One. Binary to Base32 to Base64 to ????

01001010 01011010 01010110 01000101 01010011 00110101 00110010 01011010 01010000 01001010 01000010 01000111 01011001 01010100 01010011 01000101 01001100 01000101 00110010 01000101 00110010 00110110 01010100 01000101 01001110 01001010 01000111 01010111 01010101 01010100 01001010 01010011 01001010 01010110 00110101 01000111 01000111 01001101 00110010 01011010 01010000 01001010 01010101 01000111 01010011 01010111 01010100 01001011 01001011 01000101 01011010 01000101 00110010 00110010 01010011 01010010 01010000 01001010 01001000 01000101 01001111 01010110 01001010 01010011 01001100 01000110 01010111 01010110 01000011 01010000 01001001 00111101

By golly, I think you nailed it. Could it have been even more obvious?

>>1285878

Tremendous cocksucka [uncle Joey]

Anonymous ID: b40f65 May 3, 2018, 8:21 a.m. No.1285937 🗄️.is 🔗kun >>5995

>>1285804

These: middle and right have same times, different dates. Pic to left same time minus 2 mins, different date.

>>1285647

>>1285761

Anonymous ID: 5479dd May 3, 2018, 8:22 a.m. No.1285939 🗄️.is 🔗kun >>5940

>>1285932

Seems to do something interesting, well it worked we going with it.

https://emn178.github.io/online-tools/base32_encode.html

GAYTAMBRGAYTAIBQGEYDCMJQGEYCAMBRGAYTAMJRGAQDAMJQGAYDCMBREAYDCMBRGAYDCMJAGAYDCMJQGEYDCIBQGAYTCMBQGEYCAMBRGAYTCMBRGAQDAMJQGEYDAMBQEAYDCMBQGEYDCMBAGAYTAMBQGAYTAIBQGEYDAMBRGEYSAMBRGAYTCMBQGEQDAMJQGEYDCMBQEAYDCMBRGAYDCMJAGAYTAMBQGEYDCIBQGEYDAMJRGAYCAMBRGAYDAMJQGEQDAMBRGEYDAMJQEAYDCMBQGAYTAMJAGAYDCMJQGAYTAIBQGAYTCMBRGEYCAMBRGAYTAMJQGAQDAMJQGAYDCMBREAYDCMBQGEYTCMBAGAYTAMBRGAYTAIBQGEYDAMBRGEYSAMBRGAYTAMJRGEQDAMJQGEYDCMBREAYDCMBRGAYTAMBAGAYTAMBRGAYTAIBQGEYDCMBQGEYSAMBRGAYDtCMBRGAQDAMJQGEYDCMJQEAYDAMJRGAYTAMJAGAYTAMBQGEYTCIBQGEYDAMBRGEYSAMBRGAYDCMJQGEQDAMBRGEYDAMJQEAYDCMBRGEYDCMBAGAYTAMJQGAYDAIBQGEYDAMJQGEYCAMBRGAYTAMJQGEQDAMJQGAYDCMJREAYDCMBRGAYDCMJAGAYTAMJQGEYTCIBQGEYDCMBRGAYCAMBRGAYDCMBRGEQDAMJQGAYTAMJREAYDCMBQGAYTAMJAGAYTAMJRGAYTAIBQGEYDAMBRGAYSAMBQGEYTAMBRGAQDAMBRGEYDAMJQEAYDCMBRGAYDCMJAGAYTAMJQGAYTAIBQGEYDCMBQGAYCAMBRGAYDCMBRGAQDAMJQGAYTAMBQEAYDCMBQGAYTAMJAGAYTAMBRGEYTCIBQGEYDCMBRGEYCAMBRGAYDCMBRGAQDAMJQGEYDAMJREAYDCMBQGEYTAMBAGAYTAMBQGEYTAIBQGEYDCMBRGEYSAMBRGAYTAMJRGAQDAMJQGAYDAMJREAYDCMBRGAYDAMBAGAYTAMBRGAYDCIBQGAYTCMJRGAYSA===

The some Base32 to Base64 encoding

http://www.motobit.com/util/base64-decoder-encoder.asp

R0FZVEFNQlJHQVlUQUlCUUdFWURDTUpRR0VZQ0FNQlJHQVlUQU1KUkdBUURBTUpRR0FZRENNQlJF

QVlEQ01CUkdBWURDTUpBR0FZRENNSlFHRVlEQ0lCUUdBWVRDTUJRR0VZQ0FNQlJHQVlUQ01CUkdB

UURBTUpRR0VZREFNQlFFQVlEQ01CUUdFWURDTUJBR0FZVEFNQlFHQVlUQUlCUUdFWURBTUJSR0VZ

U0FNQlJHQVlUQ01CUUdFUURBTUpRR0VZRENNQlFFQVlEQ01CUkdBWURDTUpBR0FZVEFNQlFHRVlE

Q0lCUUdFWURBTUpSR0FZQ0FNQlJHQVlEQU1KUUdFUURBTUJSR0VZREFNSlFFQVlEQ01CUUdBWVRB

TUpBR0FZRENNSlFHQVlUQUlCUUdBWVRDTUJSR0VZQ0FNQlJHQVlUQU1KUUdBUURBTUpRR0FZRENN

QlJFQVlEQ01CUUdFWVRDTUJBR0FZVEFNQlJHQVlUQUlCUUdFWURBTUJSR0VZU0FNQlJHQVlUQU1K

UkdFUURBTUpRR0VZRENNQlJFQVlEQ01CUkdBWVRBTUJBR0FZVEFNQlJHQVlUQUlCUUdFWURDTUJR

R0VZU0FNQlJHQVlEdENNQlJHQVFEQU1KUUdFWURDTUpRRUFZREFNSlJHQVlUQU1KQUdBWVRBTUJR

R0VZVENJQlFHRVlEQU1CUkdFWVNBTUJSR0FZRENNSlFHRVFEQU1CUkdFWURBTUpRRUFZRENNQlJH

RVlEQ01CQUdBWVRBTUpRR0FZREFJQlFHRVlEQU1KUUdFWUNBTUJSR0FZVEFNSlFHRVFEQU1KUUdB

WURDTUpSRUFZRENNQlJHQVlEQ01KQUdBWVRBTUpRR0VZVENJQlFHRVlEQ01CUkdBWUNBTUJSR0FZ

RENNQlJHRVFEQU1KUUdBWVRBTUpSRUFZRENNQlFHQVlUQU1KQUdBWVRBTUpSR0FZVEFJQlFHRVlE

QU1CUkdBWVNBTUJRR0VZVEFNQlJHQVFEQU1CUkdFWURBTUpRRUFZRENNQlJHQVlEQ01KQUdBWVRB

TUpRR0FZVEFJQlFHRVlEQ01CUUdBWUNBTUJSR0FZRENNQlJHQVFEQU1KUUdBWVRBTUJRRUFZRENN

QlFHQVlUQU1KQUdBWVRBTUJSR0VZVENJQlFHRVlEQ01CUkdFWUNBTUJSR0FZRENNQlJHQVFEQU1K

UUdFWURBTUpSRUFZRENNQlFHRVlUQU1CQUdBWVRBTUJRR0VZVEFJQlFHRVlEQ01CUkdFWVNBTUJS

R0FZVEFNSlJHQVFEQU1KUUdBWURBTUpSRUFZRENNQlJHQVlEQU1CQUdBWVRBTUJSR0FZRENJQlFH

QVlUQ01KUkdBWVNBPT09

OK, well now what? Seems like some weird stuff? kinda looks like a PGP key or a hash or something. Like IDK? MD5? can you go base64 or MD5 and what the hell purpose would that serve us here? No idea.

https://cryptii.com/base64/md5 ← SHWING

d41d8cd98f00b204e9800998ecf8427e

Yay, we have a Hash……. The F that does do for us? password for something? or some crap? probably these cicada peoples like to do that kinda stuff.

I thought about it and it doesn't make sense to go from base32 to base64 since they are the same style of encoding I guess. I noticed that if we add a base32 to Hex, then covert the Hex to Base64 we get a different MD5 hash. It also is interesting be that would have made 7 layers or actions to get to the final hash. No idea what it's for and I'm not sure I have seen this before.

>>1285939

I thought about it and it doesn't make sense to go from base32 to base64 since they are the same style of encoding I guess. I noticed that if we add a base32 to Hex, then covert the Hex to Base64 we get a different MD5 hash. It also is interesting be that would have made 7 layers or actions to get to the final hash. No idea what it's for and I'm not sure I have seen this before.

Enigma

LPFUDZUTUCVLMVMFCSTUDXURBMZAICMJWUXFCNLYOWZLSGSSWDQLWDEBWCSIXBHPMLLKABISBZCCYUEMXWVUMMSOGRCSASGEAISVYOHRZKBSAKOSDHRCJQCWPSISGGFTSMENJJGYDYIVQMGRWOKSARMCEGZJPPCUCMOJVBNAMNOLONXTHKXWEGEZHYBSNQNENRSEOXGVJWFJWVIPBVIKKZLZBESPBEJQAKSHOMHLKFDYMEYUGMHULHEBMGOFDPKBAZBSGGXQKYWARSDMSGXHDHSURWSAMSZO

DNA

TAGGTTGGTTTGTATTTTACACTTACAGTTGGTTAATAGGTAAGTATCTTGTTTTATTACTATTTACATATTACAGTATTACAGACTGTTTATATTTACGTAGGTATCTTTCTTTTTTTATAGGTTACTAGGTTTGACTTTATCTATCTACTACAGTTGGTTAATAGGTTTTTATCTTACTTTCTTTATAGCTAGCTATTTTGGTATTACAGACAGTTACTTAGTTAATAGGTAGATATTTACCTTTGTAGGTTACTACATATGTTTCTTTGTAACTTAATAGTACCT

BINARY

01001010 01011010 01010110 01000101 01010011 00110101 00110010 01011010 01010000 01001010 01000010 01000111 01011001 01010100 01010011 01000101 01001100 01000101 00110010 01000101 00110010 00110110 01010100 01000101 01001110 01001010 01000111 01010111 01010101 01010100 01001010 01010011 01001010 01010110 00110101 01000111 01000111 01001101 00110010 01011010 01010000 01001010 01010101 01000111 01010011 01010111 01010100 01001011 01001011 01000101 01011010 01000101 00110010 00110010 01010011 01010010 01010000 01001010 01001000 01000101 01001111 01010110 01001010 01010011 01001100 01000110 01010111 01010110 01000011 01010000 01001001 00111101

Base32

IIQAP2L6D9IB984KGI7B5A56HAC8KP4ACHMAH2KSII7ATAL8IIJ99B3AHQ79KP5KK2AAL3L6LQK9D5KAMI568P56KIG9944AJQM999KOHINAP1L0I9T

HEX

422007E97E1A021E28C8F87A0EF8E01054FE0047600FA54908F826058508487603C3EA7F54AD000BDAFCB8287D50188EF82FEF948373804C18A71D0D03D6B722

base64

QiAH6X4aAh4oyPh6DvjgEFT+AEdgD6VJCPgmBYUISHYDw+p/VK0AC9r8uCh9UBiO+C/vlINzgEwYpx0NA9a3Ig==

MD5

fc74c3b9b2e74e2c1bd37a2db15e29eb

7 layers of Encoding it seems.

😅

>>1285925

>We need to find the key.

Q mentions a key, a picture of the sky.

>The graphic is your key.

Nov 9, 2017.

Whether that helps, I don't know.

Anonymous ID: bc175b May 3, 2018, 8:22 a.m. No.1285944 🗄️.is 🔗kun >>5993

See, that is far more inline with Q's Comms than this DNA wannabe spook.

Anonymous ID: 8439f9 May 3, 2018, 8:22 a.m. No.1285945 🗄️.is 🔗kun >>5965

>>1285916

ignorant

its like sniffing condems, tide pods, ice bucket challenge

sheep will do anything, i think higher ups do it just for laughs

these people that do that are like the new court jesters

>>1285327

WWG1WGA

Anonymous ID: 4d4f5c May 3, 2018, 8:22 a.m. No.1285948 🗄️.is 🔗kun >>5998

Soooo Rudy said his disclosure was "planned long in advance."

Hivemind thinking POTUS wants Stormy in the news a bit longer?

Hivemind being smart now thinking Stormy is a LARP?

>>1285894

jetBlue does not fly to HK

Anonymous ID: 541999 May 3, 2018, 8:23 a.m. No.1285951 🗄️.is 🔗kun >>5962

Hmm, maybe It unlocks the file that JA uploaded with a dead man trigger?

I was assuming that sections of the film were embedded within the images themselves, and once we figured out the key, we could parse the hidden files from the image

>>1285579

No spaces in: MadeintheUSA……..

Be. Sure. To. Drink. Your. Ovalteen.

Pence reads Jer. 29. You know the plans I have for you to prosper you…. AWESOME

whoa.

nice.

thank you.

>>1285232

I look forward to your Sovereign Citizen takedown video. Stop trying to pretend you don't have to obey the law because your autism gives you technically abilities. Lawfags will pwn you every time, 100% of the time because you're WRONG and deluding yourself is just going to get you in trouble. There's a reason that driving is regulated—it has nothing to do with attempting to restrict your ability to fucking travel you retard.

Anonymous ID: 5479dd May 3, 2018, 8:24 a.m. No.1285962 🗄️.is 🔗kun >>5970

>>1285951

yes, exactly, vault seven

Anonymous ID: 992ef1 May 3, 2018, 8:24 a.m. No.1285964 🗄️.is 🔗kun >>5972

>>1285900

Biden and Apple and HK?

>>1285945

It extends their reach by increasing post interaction. They actually profit from it. Plus they get all that free OC of people branding themselves.

>>1285894

it kind of reminded me of Piarco in Trinidad

>>1285841

Here is what I know

Q uses [MARKER] in brackets only 3 times, One more and we would have 4 making 4 points of a clock? 3,6,9,12. I'm trying to find a relation to an actual clock as Q says "Think Clock". Also the 3 in brackets, 2 of them have "Left eye" before them.

Q also says "wind the clock" which I googled and found that you use a key and rotate it clockwise 16 times. Maybe this is relevant maybe not.

Q also posted the following:

The "marker."

Learn to read the map.

News unlocks the map.

I believe Q also indicated by reposting someone talking about the deltas in the posts being markers and we all went off on the POTUS tweet and Q posting deltas but I think we need to focus on the timestamps. Re-reading the posts with "marker in them" makes me think we are supposed to focus on the timestamps themselves rather than just the deltas.

There is also RNA.

Anyways good to see efforts for this

>>1285841

Give this guy a call.

https://www.inc.com/joseph-steinberg/how-to-hide-data-in-plain-sight-so-nobody-can-find-it.html

>>1285962

Makes sense with the 7 layers of encoding!

That is great! Thank you anon!

>>1285964

And Mitch McConnell has ships

>>1285908

>>1285468

why is it you are such an obvious shill?

filtered

15 = O

maybe replace all the 4's with the letter O